a bax bcl 2 claudin 2 claudin 4 claudin 5 zo i and b catenin

Báo cáo y học: " Epithelial expression of TLR4 is modulated in COPD and by steroids, salmeterol and cigarette smoke" pot

... against Gram-negative bacteria, including Escherichia coli and Pseudomonas aeruginosa and the yeast Candida albicans [4] Chronic Obstructive Pulmonary Disease (COPD) is a condition characterised ... GCCCCAGGACACTGTCCTCCTC 29 82- 30 02 2697 -27 16 65 bp TGCCCTGCCTATATGCAA GAACACATCGCTGACAACT 381-398 936-918 48 6 bp GGTATAGGCGATCCTGTTACC TGC TCATGGCTTTTTGCAGCA TTTTGTTC 26 88 -27 09 45 /b> 42 - 45 /b> 67 20 2 bp AACTCTGGTAAAGTGGAT ... Respiratory Research 20 07, 8: 84 nalling via TLR4 induces production of the anti-microbial peptide human beta-defensin (HBD2) [3], which has a broad spectrum of antimicrobial activity, particularly...

12
361
0

Báo cáo y học: "Long acting b2-agonist and corticosteroid restore airway glandular cell function altered by bacterial supernatant" pdf

Danh mục: Báo cáo khoa học

... Aldrich), which is a thiazolidinone CFTR inhibitor [ 25 /b> ] Ion and water content analysis Ion and water content was determined using electron probe X-ray microanalysis and a quantitative dark field ... Campbell EJ, Hill SL, Bayley DL, Stockley RA: Association between airway bacterial load and markers of airway inflammation in patients with stable chronic bronchitis Am J Med 20 00, 109 :28 8 -29 5 ... Li JD, Chapelin C, Coste A, Escudier E, Nadel J, Basbaum C: Mucin gene (MUC and MUC 5AC) upregulation by Gram-positive and Gram-negative bacteria Biochim Biophys Acta 1998, 140 6 : 25 /b> 1 - 25 /b> 9 30 Swiatecka-Urban...

15
323
0

Báo cáo y học: " Overcoming beta-agonist tolerance: high dose salbutamol and ipratropium bromide. Two randomised controlled trials" pps

Danh mục: Báo cáo khoa học

... treatment in acute severe asthma improves bronchodilation [ 15] , whereas it affords little additional benefit in stable asthma [29 ] It is possible that this is because the response to beta-agonist ... tolerance measured in these trials was actually lower than that experienced by patients who continue take their long-acting beta-agonists twice daily [ 12] Abbreviations There are potential limitations ... participants We also thank Dr J McLachlan and the staff of the Waikato Hospital Respiratory Laboratory, Dr Graham Mills and the Waikato Respiratory Research Unit and Jan Cowan of the Respiratory...

7
181
0

Báo cáo y học: "Inhaled steroid/long-acting β2 agonist combination products provide 24 hours improvement in lung function in adult asthmatic patients" pps

Danh mục: Báo cáo khoa học

... both salmeterol and formoterol have a long-lasting clinical efficacy after a single daily dose, which maintains significance above baseline at a 12 hour monitoring time point [ 12, 13,18 - 25 /b> ] In the ... A) , both SFC and FBC produced a similar prolonged bronchodilation beyond 12 hours which was statistically and clinically significant compared with placebo at 16 hours This is important as subjects ... 24 /b> hours following administration of a single inhalation of study medication (Figure 1) At each evaluated time point, the mean change in both the SFC and FBC group was statistically significant...

8
216
0

Bóa cáo y học: "Reduction in airway epithelial chloride transport in septicaemia related pulmonary oedema reversible by beta agonist application" docx

Danh mục: Báo cáo khoa học

... Physiol Lung Cell Mol Physiol 20 06, 29 0 : 24 /b> 2 - 24 /b> 9 Jiang X, Ingbar DH, O’Grady SM: Adrenergic stimulation of Natransport across alveolar epithelial cells involves activation of apical Cl-channels Am ... Manocha S, Gordon AC, Salehifar E, Groshaus H, Walley KR, Russell JA: Inhaled beta -2 agonist salbutamol and acute lung injury: an association with improvement in acute lung injury Critical Care ... Care 20 06, 10:R 12 Perkins GD, McAuley DF, Thickett DR, Gao F: The beta-Agonist Lung Injury Trial (BALTI): a randomized placebo-controlled clinical trial Am J Respir Crit Care Med 20 06, 173 :28 1 -28 7...

2
123
0

nghiên cứu phương pháp phân tích các chất kích thích tăng trưởng họ beta-agonist trong thịt heo, gan heo, thức ăn nuôi heo bằng phương pháp phân tích sắc ký ghép khối phổ (gc-ms)

Danh mục: Báo cáo khoa học

... mảnh EI Trong CI có hai kiểu ion h a ion h a học dương (Positive Ion Chemical Ionization-PICI) ion h a ion h a học âm (Negative Ion Chemical Ionization- NICI) Dư i i u kiện đònh, sản phẩm CI tạo ... nhập Clenbuterol Salbutamol Chloramphenicol Sulfamerazine Sulfadimethoxine Sulfamonomethoxine Oxolinic acid Pyrimethamine Nicarbazin 10 Furazolidone 11 Avoparcin T i Malaysia: yêu cầu tất sản ... limited due to lack of appropriate sample preparation Center of analytical services and experimentation (CASE) has devised a quite efficient GC/MS method for CLEN, SAL analysis which are being...

195
1,318
7

Tài liệu Báo cáo khoa học: a-Defensins increase lung ﬁbroblast proliferation and collagen synthesis via the b-catenin signaling pathway doc

Danh mục: Báo cáo khoa học

... that a- defensin-1 and a- defensin -2 induced increases in the phosphorylation of GSK 3b and b- catenin activation and that inhibition of b- catenin activation prevented a- defensin-induced proliferation ... Novus Biologicals (Littleton, CO, USA) Antibodies against active ⁄ dephosphorylated b- catenin, total b- catenin and cyclin D were obtained from Millipore (Billerica, MA, USA) Antibodies against ... human beta-defensin type in bronchiolitis obliterans syndrome after lung transplantation Transplantation 78, 122 2– 122 4 Hiratsuka T, Mukae H, Iiboshi H, Ashitani J, Nabeshima K, Minematsu T, Chino...

12
602
0

Báo cáo toán học: " Measurement of beta amyloid peptides in specific cells using a photo thin-film transistor" pot

Danh mục: Toán học

... with rapid development of microtechnology, the incorporation of microfabricated devices with biochemical analysis techniques has been dramatically increased Antibody-conjugated microbead arrays ... nonspecific antibody bindings in the next step Then, the overnight incubation with a primary antibody (Abcam, Cambridge, MA, USA) was performed for the specific binding to A peptides on the HeLa ... channel and an underlying thin film p-FET as the signal transducer part which was fabricated with an optically high-efficient amorphous Si [α-Si] layer on a Si/SiO2 substrate A droplet including...

12
690
0

Báo cáo y học: "IL-17 induces production of IL-6 and IL-8 in rheumatoid arthritis κ synovial fibroblasts via NF-κB- and PI3-kinase/Akt-dependent pathways" doc

Danh mục: Báo cáo khoa học

... increased in the RA synovium [ 12, 13] IL-17 has been shown to instigate a rapid degradation of inhibitor of B in RA synovial fibroblasts [4] , indicating that activation of NF- B is involved in IL-17 ... 3kinase in transforming growth factor β-mediated activation of Akt in normal and rheumatoid arthritis synovial fibroblasts Arthritis Rheum 20 02, 46 : 15 04- 151 1 Aidinis V, Plows D, Haralambous S, Armaka ... production by renal epithelial cells J Am Soc Nephrol 20 00, 11 :20 44 -20 55 Hata K, Andoh A, Shimada M, Fujino S, Bamba S, Araki Y, Okuno T, Fujiyama Y, Bamba T: IL-17 stimulates inflammatory κ...

9
411
0

Báo cáo y học: "Effect of short-acting beta blocker on the cardiac recovery after cardiopulmonary bypass" pot

Danh mục: Báo cáo khoa học

... Myocardial protection with oxygenated esmolol cardioplegia during prolonged normothermic ischemia in the rat J Thorac Cardiovasc Surg 20 02, 1 24 /b> : 340 - 351 Scorsin M, Mebazaa A, Al Attar N, Medini B, ... beta-adrenergic antagonist esmolol given at reperfusion improves survival after prolonged ventricular fibrillation Circulation 20 04, 109 : 24 /b> 69 -26 74 Zangrillo A, Turi S, Crescenzi G, Oriani A, Distaso ... Chauhan S, Saxena N, Rao BH, Singh RS, Bhan A: A comparison of esmolol and diltiazem for heart rate control during coronary revascularisation on beating heart Ann Card Anaesth 20 00, 3 :28 -31 Arar...

4
282
0

Báo cáo y học: "Anti-inflammatory function of arctiin by inhibiting COX-2 expression via NF-B pathways" pps

Danh mục: Báo cáo khoa học

... Kinoshita T, Nishibe S, Sankawa U: The Ca2+ activity of lignans Chem Pharm Bull 1986, 34: 35 14- 351 7 Liu S, Chen K, Schliemann W, Strack D: Isolation and identification of arctiin and arctigenin ... vitro assay for deubiquitination of I kappa B alpha Arch Biochem Biophys 20 02, 40 0:76- 84 Dinarello C: Proinflammatory and anti-inflammatory cytokines as mediators in the pathogenesis of septic shock ... some autoimmune diseases such as RA and Crohn’s disease [28 ,29 ] Nitric oxide is synthesized via the oxidation of arginine by a family of NOS, and it plays a vital role in regulating physiological...

9
272
0

Báo cáo y học: "Endotoxin-activated microglia injure brain derived endothelial cells via NF-B, JAK-STAT and JNK stress kinase pathways" docx

Danh mục: Báo cáo khoa học

... Laboratories (Logan, UT, USA) PD98 059 , a MEK inhibitor; SP600 1 25 /b> , a JNK inhibitor; wortmanin an inhibitor of PI3 kinase and pyrrolidinecarbodithoic acid (PDTC), a NF- B inhibitor); AG490, a JAK2STAT ... improved microglial viability JAK-STAT inhibition also improved overall viability in the cocultures Thus, JAK-STAT may be a preferred therapeutic target, as its inhibition appears to inhibit immune ... NF- B may be essential for microglial viability while also suppressing its activation Since microglia are essential to other aspects of tissue viability such as protecting against microbial invasion...

15
290
0

Báo cáo y học: "Anti-inflammatory function of arctiin by inhibiting COX-2 expression via NF-B pathways" potx

Danh mục: Báo cáo khoa học

... Kinoshita T, Nishibe S, Sankawa U: The Ca2+ activity of lignans Chem Pharm Bull 1986, 34: 35 14- 351 7 Liu S, Chen K, Schliemann W, Strack D: Isolation and identification of arctiin and arctigenin ... vitro assay for deubiquitination of I kappa B alpha Arch Biochem Biophys 20 02, 40 0:76- 84 Dinarello C: Proinflammatory and anti-inflammatory cytokines as mediators in the pathogenesis of septic shock ... some autoimmune diseases such as RA and Crohn’s disease [28 ,29 ] Nitric oxide is synthesized via the oxidation of arginine by a family of NOS, and it plays a vital role in regulating physiological...

9
287
0

Báo cáo hóa học: " Combined fluticasone propionate and salmeterol reduces RSV infection more effectively than either of them alone in allergen-sensitized mice" pptx

Danh mục: Hóa học - Dầu khí

... in children are associated with viral infections, early intervention with a combination therapy should have beneficial effects on viral asthma exacerbations Since virus-induced exacerbation is ... is accompanied by airway inflammation, we reasoned that the combination of a steroid and a β -2 agonist might provide protection from severe RSV infection and the ensuing asthma exacerbation This ... by intraperitoneal injection (i. p.) of OVA on day and by intranasal (i. n.) administration of OVA on days 9, 12 and 14 On day 19 the mice were infected i. n with of RSV From day 21 to day 27 mice...

10
313
0

Báo cáo khoa học: Expression level and agonist-binding affect the turnover, ubiquitination and complex formation of peroxisome proliferator activated receptor b pptx

Danh mục: Báo cáo khoa học

... PPARb overexpression 10 Ligand-inhibitable polyubiquitination of PPARb 14 16 18 20 22 24 /b> 26 28 30 32 34 Fraction Fig Effect of GW50 151 6 and protein levels on the native molecular mass of PPARb ... stoichiometric amounts of PPARb and its obligatory RxR heterodimerization partner fraction 14 16 fraction 14 16 18 20 22 24 /b> 26 28 30 26 28 30 32 34 36 38 18 20 22 32 34 36 38 60 kDa MDa MDa B ... precipitated by the PPARb-speciﬁc antibody (lane 2) , and vice versa, that PPARb was coprecipitated by both FLAG-directed antibodies (lanes and 4) , suggesting the formation of PPARb oligomers This...

9
350
0

báo cáo hóa học:" Activation of human B cells by the agonist CD40 antibody CP-870,893 and augmentation with simultaneous toll-like receptor 9 stimulation" doc

Danh mục: Hóa học - Dầu khí

... landmark studies, the clinical translational of CD40 activation in cancer patients has been limited, owing primarily to the lack of an appropriate and available drug Human Peripheral Blood and ... in patients with advanced melanoma [ 14] Little direct evidence is available regarding its mechanism of action and in particular, its biological effects on patient APC The primary clinical side ... T-cell reactivity in melanoma patients Clin Cancer Res 20 08, 14: 45 32- 45 /b> 42 Ruprecht CR, Lanzavecchia A: Toll-like receptor stimulation as a third signal required for activation of human naive B cells...

10
624
0

Báo cáo khoa học: "nhaled beta-2 agonist salbutamol and acute lung injury: an association with improvement in acute lung injury" doc

Danh mục: Báo cáo khoa học

... free of ALI in critically ill patients who had ALI This finding was supported by a similar significant association between dose of salbutamol and days alive and free of PaO2/FiO2 marker of ... human ALI Ware and Matthay [6] demonstrated that alveolar fluid clearance is impaired in most patients with ALI/ARDS and that impaired clearance is associated with a poor outcome Basran and colleagues ... Thorax 20 04, 59 ii :A1 24 /b> Tibayan FA, Chesnutt AN, Folkesson HG, Eandi J, Matthay MA: Dobutamine increases alveolar liquid clearance in ventilated rats by beta -2 receptor stimulation Am J Respir...

7
321
0

Toàn văn đánh giá hàm lượng các chất b agonist (clenbuterol và salbutamol) trong thức ăn gia súc và dư lượng trong thịt gia súc bằng kỹ thuật sắc ký lỏng ghép khối phổ

Danh mục: Tiến sĩ

... 40 40 42 43 43 43 44 45 /b> 45 /b> 46 47 53 53 55 55 55 56 57 57 57 57 58 58 58 60 63 64 66 iii 3 .2 Kết khảo sát quy trình chuẩn b mẫu 3 .2. 1 Kết khảo sát ảnh hưởng đệm pH khả giữ l i clen, sal ... 54 58 60 61 62 62 63 64 65 66 67 68 viii 20 21 22 23 24 /b> 25 /b> 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 B ng 3. 12 Kết phân tích h i qui tương quan nồng độ clen diện tích pic sắc ký Kết ... tan mg phần l i tan sau v i giờ) tương đương 4, 8 mg sal sulphate Thành phần phụ thêm bao gồm: butylparaben, calcium phosphate, calcium sulphate, lactose, magnesium stearate, oleic acid, titanium...

149
962
11

Tài liệu Báo cáo khoa học: Autophagy inhibits reactive oxygen species-mediated apoptosis via activating p38-nuclear factor-kappa B survival pathways in oridonin-treated murine ﬁbrosarcoma L929 cells doc

Danh mục: Báo cáo khoa học

16
547
0

Báo cáo sinh học: "Differentiation associated regulation of microRNA expression in vivo in human CD8+ T cell subsets" doc

Danh mục: Hóa học - Dầu khí

8
399
0