6dsrbds and z dna binding domains act on the subcellular localization of adars
Báo cáo khoa học: Detection of nucleolar organizer and mitochondrial DNA insertion regions based on the isochore map of Arabidopsis thaliana ppt
... II and IV [7] There is significant distinction between the conclusions of the two groups Recently, Zhang and Zhang analyzed the A thaliana genome by using the cumulative GC profile [17] They concluded ... describe the DNA sequence being studied The component xn, yn and zn displays the frequencies distributions of the purine ⁄ pyrimidine, amino ⁄ keto and weak H-bond ⁄ strong H-bond along the sequence, ... z0 ¼ such that the Z curve always starts from the origin of the three-dimensional coordinate system The three components of the Z curve, xn, yn and zn, represent three independent distributions...
- 9
- 523
- 0
Tài liệu Báo cáo khóa học: A multi-protein complex containing cold shock domain (Y-box) and polypyrimidine tract binding proteins forms on the vascular endothelial growth factor mRNA Potential role in mRNA stabilization pptx
... that the CCV1 Fig Gel filtration fractionation of the VEGF 5¢-UTR CCV1 complex Balb/c 3T3 fibroblast cytoplasmic extract was fractionated by FPLC gel filtration and fractions assayed by incubation ... P.A (1996) The mouse gene for vascular endothelial growth factor: genomic structure, definition of the transcriptional unit, and characterization of transcriptional and post-transcriptional regulatory ... shown) The presence of PTB was further confirmed by preincubation of cytoplasmic extract with an anti-PTB monoclonal Ig (PTB) before binding to V1 RNA probe in a gel shift assay The formation of the...
- 13
- 604
- 0
Báo cáo y học: "PKC and PKA Phosphorylation Affect the Subcellular Localization of Claudin-1 in Melanoma Cells"
... upon PKC isoforoms such as α, β and γ (4) In this study, we also examine the effects of PKA on claudin-1 expression and localization, and how the localization of claudin-1 can affect melanoma ... modifications of the tight junction protein claudin-1 cause its translocation to the cytoplasm and nucleus and that the subcellular localization of claudin-1 may dictate the metastatic capacity of melanoma ... render the potential sites of PKC and PKA phosphorylation on the claudin-1 protein non phosphorylatable or to mimic constitutive activation of PKC or PKA B) Rendering the serine at position 69 on the...
- 9
- 592
- 0
Báo cáo khoa học: The subcellular localization of vaccinia-related kinase-2 (VRK2) isoforms determines their different effect on p53 stability in tumour cell lines pdf
... phosphorylation the interaction of p53 and Mdm2, therefore causing p53 accumulation The coactivator p300 also interacts with the p53 transactivation domain and contributes to p53 stabilization and activation ... isoforms S Blanco et al The two VRK2 isoforms have a different subcellular localization Substrate specificity of VRK2 isoforms and p53 phosphorylation To identify and confirm the subcellular localization ... given the similarity of their effect on p53 This indicates two novel levels of regulation of VRK Differential stabilization of p53 by VRK2 isoforms proteins, one is the coordination of their...
- 18
- 333
- 0
Báo cáo khoa học: "A study on the immunocytochemical localization of neurofascin in rat sciatic nerve" doc
... revealed the 155 kD polypeptide as the major form of neurofascin, and thus a candidate for the isoform of neurofascin at the node of Ranvier [6] In this report we describe the localization of neurofascin ... reveal the presence of incisures during the earliest stages of myelination and the initial expression of neurofascin in the incisure The cytoplasmic domains of neurofascin contain highly conserved ... Byung-joon Chang et al the result of Davis et al [5] They investigated the NF localization with immunofluorescence In this report we also identified the small non-immunoreactive areas of NF in the...
- 5
- 430
- 0
Báo cáo khoa học: Physicochemical properties and distinct DNA binding capacity of the repressor of temperate Staphylococcus aureus phage /11 doc
... CTCGAGCATTTTAACTACGTTTG Synthesis of O1 DNA Synthesis of O2 and O1O2 DNAs Synthesis of O2 DNA Synthesis of O3 DNA Synthesis of O3 DNA Synthesis of S aureus cspC DNA Synthesis of S aureus cspC DNA (Fig ... estimation, digestion of DNA by restriction enzymes, modification of DNA fragments by modifying enzymes, PCR, purification of DNA fragments, labeling of DNA fragments with radioactive materials and ... high CI and O1 DNA concentrations) that strongly favor the formation of the CI–O1 complex (Fig 4B) The corresponding plot of CI binding to O1 DNA, as obtained from quantitation of the gel shift...
- 11
- 432
- 0
Báo cáo khoa học: Alizarine derivatives as new dual inhibitors of the HIV-1 reverse transcriptase-associated DNA polymerase and RNase H activities effective also on the RNase H activity of non-nucleoside resistant reverse transcriptases pot
... different concentrations of K-49 and in the absence () or presence of lM (.) or 10 lM ( ) RDS1643 (B) YonetaniTheorell plot of the interaction of K-49 and efavirenz on the HIV-1 RT RDDP activity ... in the presence of different concentrations of efavirenz and in the absence () or presence of 1.9 lM (s), 3.7 lM (.) and 7.5 lM (4) K-49 (C) YonetaniTheorell plot of the interaction of KNA-53 and ... in a reduction of efavirenz binding and, vice versa, the binding of efavirenz leads to a reduction of the AQ binding Docking studies These results demonstrated that the AQs and NNRTI binding sites...
- 14
- 425
- 0
Báo cáo khoa học: Thermodynamic analysis of the unfolding and stability of the dimeric DNA-binding protein HU from the hyperthermophilic eubacterium Thermotoga maritima and its E34D mutant pdf
... dependence of the heat capacity of the initial and final conformations (Cp,N2 and Cp,U), the heat capacity of the native state was taken to be a linear function of temperature and that of the unfolded ... concentrations) to the two-state model (Eqn 1) The Tm and DHU,m-values refer to the transition midpoint at the monomer concentration of 120 lM DGU,25 and DDGU,25 stand for the changes in standard ... Nevertheless, there is no commonly held view in the literature on the energetic advantages of solvent-exposed salt bridges as the disruption of a salt bridge by the substitution of one of the...
- 11
- 461
- 0
Báo cáo khoa học: An NMR study of the interaction between the human copper(I) chaperone and the second and fifth metal-binding domains of the Menkes protein pot
... interaction of the chaperone with the second domain seems unlikely also in the case of ATP7B The selectivity, if any, for the interaction of one of the six metalbinding domains with the chaperone ... domain constitutes the preferred one for the uptake of the first metal ion by the ATPase from the chaperone, as a result of the specificity of protein–protein interactions between WND2 and HAH1 ... indicated by the behaviour of the NMR signals along titrations Consequently, we can observe experimentally only the copper(I) exchange process The thermodynamic contribution to the formation of the adduct...
- 7
- 368
- 0
Báo cáo khoa học: Mapping the binding domains of the aIIb subunit A study performed on the activated form of the platelet integrin aIIbb3 pot
... were recognized by the activated aIIbb3 integrin Therefore, in the context of this study, the fine mapping of the fibrinogen -binding domains on the aIIb subunit was accomplished and their potential ... influence the binding of RGDcontaining ligands, thus suggesting that the inhibition of fibrinogen binding to the activated receptor, as well as platelet aggregation, could be caused by their interaction ... approach, consisting of synthesizing Ó FEBS 2003 and testing the effect of 20-peptides on the activated form of aIIbb3 in situ, i.e on intact platelets, was pursued In total, 82 overlapping synthetic...
- 8
- 499
- 0
Báo cáo Y học: Effect of coenzymes and thyroid hormones on the dual activities of Xenopus cytosolic thyroid-hormone-binding protein (xCTBP) with aldehyde dehydrogenase activity potx
... effect on the enzyme activity of xCTBP/ALDH1 at the concentrations investigated Ó FEBS 2002 Fig Kinetics of the inhibition of xCTBP/xALDH1 by T3 when NAD+ concentration was varied within the reaction ... reaction mixture The reaction was performed at 24 °C with lg of xCTBP/xALDH1 The concentration of retinal was 30 lM and the concentrations of T3 were (d), 0.4 (e), 0.6 (n), 0.8 (h) and lM (s) .The ... inhibition of xCTBP/xALDH1 by T3 when retinal concentration was varied within the reaction mixture The reaction was performed at 24 °C with lg of xCTBP/xALDH1 The concentration of NAD+ was 0.33 mM and...
- 8
- 405
- 0
THE INFLUENCE OF THE KU80 CARBOXY-TERMINUS ON ACTIVATION OF THE DNA-DEPENDENT PROTEIN KINASE AND DNA REPAIR IS DEPENDENT ON THE STRUCTURE OF DNA COFACTORS Derek S.
... to one stage of the cell cycle and instead can occur at all stages17 Initiation of NHEJ requires the formation and activation of the DNA- dependent protein kinase (DNA- PK) Once activated, DNA- PK ... bind 50fmol of DNA Titration experiments were performed and demonstrate that these concentrations of Ku and DNA were in excess and DNA- PKcs is the limiting factor 2.8 DNA- PK DNA Binding/ Recruitment ... change the model of DNA- PK activation being dependent on both protein/protein interactions and protein /DNA interactions but instead highlights the importance of the N-terminus of DNA- PKcs in activation...
- 104
- 281
- 0
Effect of dissolved organic matter (DOM) and biofilm on the adsorption capacity of powdered activated carbon in activated sludge
... the effect of DOM and biofilm on the adsorption capacity of PAC in the aeration tank of PACT process Materials and methods 2.1 Operation of powdered activated carbon treatment (PACT) system The ... concentrations in the PACT and the control reactors during and after the shock loading of 3,5-DCP The peak concentration in the PACT and the control reactors were 6.0 and 45.3 mg l-1, respectively ... quilibriumC oncentration of 3,5-D P（m l ) C g Figure Adsorption isotherm of 3,5-DCP onto new PAC, PAC in the aeration tank, and PAC in the bacterial cultivations Summary and conclusions The objective of...
- 10
- 557
- 0
Analysis on the Optimal Dispatching of Mixed-pump Stations and the Operating-mode Adaptability Based on Safety Water Supply
... headloss of the kth pump SOLUTION AND REALIZATION OF THE ESTABLISHED MODEL In view of the characteristic of global optimization ability and implicit parallelism, - 70 - Journal of Water and Environment ... optimization is 3.84%, so the water supply requirement can be satisfied Fig.4 - The Outlet Flow for Each Pump Station of the First and Second Optimization CONCLUSION The purpose of optimal operation ... operation scheme and the speed ratio of speed governing pump are determined to satisfy the dispatching commands, at the same time, to minimize the total consumption of all pump stations Therefore, the...
- 8
- 461
- 0
An experimental study on the thermal valorization of municipal and animal wastes
... where, m is the sample mass normalized by the initial sample mass, n is the number of components, cj is the fraction of combustibles in component j, aj(t) is the reacted fraction of component j in ... expresses the effect of ambient gas composition and f describes the change of surface reactivity as a function of the fractional burn off: As the function g(Po2) represented the partial pressure of ... and m∞ is the normalized amount of the solid residues (minerals) at the end of the experiment A separate equation was used for each component to describe the dependence of the reaction rate on...
- 8
- 627
- 0
Tài liệu Mothers’ Investments in Child Health in the U.S. and U.K.: A Comparative Lens on the Immigrant ''Paradox'' docx
... of socioeconomic profiles and ethnicities in each setting, allows for a 10 broader consideration of the "immigrant paradox." On the one hand, generally similar social and demographic conditions ... socioeconomic and health incorporation on the patterns observed among the total population—in social institutions such as the educational and health care systems, and on markers of health and social ... years and years (age data are not yet available) These interviews and the baseline survey provide detailed information on the demographic, social and economic situations of the families and the...
- 48
- 653
- 0
Tài liệu ITU Study on the Financial Aspects of Network Security: Malware and Spam doc
... dependent on the cost of time of an employee, the skills of the organization and the individual user to deal with spam, the sophistication of filtering technology, and the audacity of attacks ... long as the benefits of semi-legal and illegal activities outweigh the costs of these activities, including the expected costs of sanctions Due to the factors discussed in this report, the economic ... value net The development of accurate measures of these flows is complicated by the large number of legal and illegal players and the elusive nature of some of the transactions Most of the financial...
- 42
- 471
- 0
Tài liệu University Oars Being a Critical Enquiry Into the After Health of the Men Who Rowed in the Oxford and Cambridge Boat-Race, from the Year 1829 to 1869, Based on the Personal Experience of the Rowers Themselves pdf
... first consider the cases of those who, either on their own testimony or on that of their relations and friends, sustained more or less injury from the training and exertion connected with the University ... tale, and with good reason may the British mother bewail the murder of her inno* cents and denounce the callous indifference of those to whom their education is entrusted As a further proof of the ... rows in the race ought to live till the age of 60; and if all the members of the Oxford 1829 crew had lived till the 10th of June, 1869, the 40th anniversary of the race, and then died, their lives...
- 419
- 541
- 0
Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc
... phase of the degradation reaction Note that the enzyme concentrations used in the two reactions differed by a factor of 10 (see Materials and methods) (D) Chromatogram of (GlcNAc)6 degradation products ... this side of the enzyme is optimized for interacting with the longer (polymeric) part of the substrate In conclusion, these experimental data and the inferences made from the sequence and structural ... LlChi18 after of incubation with nM of enzyme The double peaks represent the a- and b-anomers of the oligomers Using standard curves, the total concentrations of dimer, trimer and tetramer were...
- 14
- 683
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008