6 9 influence of activation energy a surface temperature vs time and b surface

Pyrolysis and combustion processes of combustible materials under external heat flux

... must be capable of simulating fire behaviors of different types of combustible materials Because of various fire behaviors of these four types of combustible materials, it is challenging and significant ... on surface temperature 152 6. 18 Influence of heat transfer coefficient on mass loss rate 153 6. 19 Influence of permeability of water on surface temperature 153 6. 20 Influence of permeability ... 145 6. 8 Influence of pre-exponential factor on mass loss rate 145 6. 9 Influence of activation energy 1 46 6.10 Influence of activation energy on mass loss rate 147 6. 11 Influence of...

321
496
0

Báo cáo y học: " 6-Month Results of Transdiscal Biacuplasty on Patients with Discogenic Low Back Pain: Preliminary Findings"

Danh mục: Y học thưởng thức

... Village Children, The Hesperian Foundation Edition 19 96 Werner David, Wgere thre is no doctor The Hesperian Foundation, P.O.Box, 1 69 /b> 2, Palo Alto CA ,94 302, USA, 199 2,5 06 pages Finnie Nancy Handling ... b nh chố cú th quỏ mc Cú th dựng phn x gõn xng phõn bit gia bi nóo v bi lit Cỏc loi bi nóo Biu hin ca bi nóo rt a dng tn thng nóo khỏc nhau, vy chỳng ta cú th xp bi nóo theo biu hin chớnh Ba ... USA, 199 2,5 06 pages Finnie Nancy Handling the young Cerebral palsy child at Home Penguin USA, P,O.Box 99 9, Dept.171 09, Bergenfield, NJ0 762 1 USA,175,337 page ...

4
526
0

Báo cáo y học: "HLA-DR regulation and the influence of GM-CSF on transcription, surface expression and shedding

Danh mục: Y học thưởng thức

... 1(3): 1 26- 1 36 1 29 Following an incubation and washing, the primary detection antibody was added, a mouse anti human IgG1 anti-HLA-DR (CR3/43) (Dako, Denmark), at a concentration of µg/ml After a 2h ... Primer: ATCATGACAAAGCGCTCCAACTAT Reverse HLA-DR Primer: GATGCCCACCAGACCCACAG (Sigma, UK) Soluble HLA-DR measurement by ELISA Ninety six well ELISA plates (Nunc, Denmark) were coated overnight at 4˚C ... following manufacturer’s directions and incubated at room temperature until colour development Absorbance was then read at 405 nm on an ELISA plate reader HL -60 cell line maintenance and culture HL -60 ...

11
618
0

Influence of Phosphorus Concentration on the Biodegradation of Dissolved Organic Matter in Lake Biwa, Japan

Danh mục: Môi trường

... Lake Biwa was stable and refractory (Hayakawa and Takahashi, 2002) Prior to biodegradation test, the lake water was filtrated by a glass fiber filter with a particle retention of 1.0 µm (Whatman ... 161 -170 (in Japanese) Hayakawa K and Takahashi M (2002) Behavior of dissolved organic matter in the northern basin of Lake Biwa and current situation related to COD increase, Annual Rep Lake Biwa ... monitored these days, there were few DP data before 199 9 Therefore, the ratio of DP to TP was estimated from DP and TP data in 19 86, 199 0 and 199 9-20 09 at Imazuokichuo-point and Minamihiraokichuo-point...

9
761
2

THE INFLUENCE OF HUMAN ACTIVIES ON THE ENVIRONMENT

Danh mục: Tiếng anh

... plants are killed Sulphur dioxide will dissolve in rain producing Acid Rain • Acid rain damages trees and pollutes rivers and lakes Acid rain causes erosion of buildings and statues particularly ... into the atmosphere Many animal and plant habitats are destroyed causing extinction of species Intensive Farming • Farming has become more intensive to provide a higher % yield from land • Many people ... Improvements in agriculture health and medicine have produced a dramatic rise in the human population This increase in population size leads to an increase in pollution and higher demand for the...

23
390
0

Tài liệu The Influence of Human Activity on the Environment ppt

Danh mục: Điện - Điện tử

... plants are killed Sulphur dioxide will dissolve in rain producing Acid Rain • Acid rain damages trees and pollutes rivers and lakes Acid rain causes erosion of buildings and statues particularly ... into the atmosphere Many animal and plant habitats are destroyed causing extinction of species Intensive Farming • Farming has become more intensive to provide a higher % yield from land • Many people ... Improvements in agriculture health and medicine have produced a dramatic rise in the human population This increase in population size leads to an increase in pollution and higher demand for the...

23
690
0

Báo cáo " Assessment of the influence of interpolation techniques on the accuracy of digital elevation model " potx

Danh mục: Báo cáo khoa học

... Regularized (with varying weight) Plain 0.33 06 0.3 198 0.3108 0. 297 9 0. 291 2 0.2 892 0. 290 5 0 .60 69 0 .60 26 0. 59 86 0. 595 2 Hill 0 .62 65 0 .60 18 0.5807 0.54 86 0.52 76 0.5142 0.5055 0 .60 47 0 .61 47 0 .61 86 0 .62 08 ... CA, USA, 2001 [6] L Mitas, and H Mitasova, General variational approach to the interpolation problem, Computer and Mathemathic Application 16 ( 198 8) 98 3 [7] M .A Oliver, Kriging: a method of interpolation ... DEM surface number of control points is about 0.5-1.0% of the number of source points, but not less than 50 Both point sets are imported into a geodatabase as point feature classes having an attribute...

8
464
1

The influence of the cinema on children and adolescents ppt

Danh mục: Sân khấu điện ảnh

... specific The broad generaliim zation might be made that the fl has mainly a provocative effect but is rarely basically causal It would seem to be accepted now as almost beyond doubt that boys and girls ... cinema and youth; with a bibliography 15 M i r a m s , Gordon Speaking Candidly: Films and People Hamilton, N e w Zealand, Blackwood Paul, 194 5, 240 p A critical survey of the cinema and its social ... publicity purposes The star is also an actor or actress: the r6le of the star as a film-actor, and a comparison between his r61e and that of the actor in the theatre The r61e played by the star...

107
723
0

Báo cáo khoa học: "An Empirical Study of the Influence of Argument Conciseness on Argument Effectiveness" docx

Danh mục: Báo cáo khoa học

... Measurements.” Organizational Behavior and Human Decision Processes 60 : 3 06- 325 Elhadad, M ( 199 5) “Using argumentation in text generation.” Journal of Pragmatics 24: 1 89- 220 Infante, D A and A ... to Say: An Attentional-Probabilistic Approach to Argument Presentation Cognitive Science Conference Olso, J M and M P Zanna ( 199 1) Attitudes and beliefs ; Attitude change and attitude-behavior ... evaluations measuring actual behavioural and attitudinal changes (Olso and Zanna 199 1) To summarize, the evaluation framework just described supports users in performing a realistic task at their...

8
402
0

Báo cáo " Influence of laser parameters on the stationary operation of a two-mode random micro laser " pdf

Danh mục: Báo cáo khoa học

... studying the influence of laser parameters on saturated values of mode photon densities, we vary one of parameters in table and remain invariable all the rest of parameters The obtained results are shown ... densities of mode and These equations (1), (2) have been solved numerically by the Matlab language with chosen values of parameters shown in Table (as seen in [12]) Table α1 = 1.1 β1 = 0.4 α = 0 .9 β2 ... Hoang, M.H Hanh / VNU Journal of Science, Mathematics - Physics 23 (2007) 1 39- 142 Discussion and conclusion In the stationary operation of two-mode random microlaser, the variation of laser parameters...

4
343
0

Influence of New Media on Adolescent Sexual Health pdf

Danh mục: Khoa học xã hội

... health and/ or media use, and program developers This research was conducted in RAND Health, a division of the RAND Corporation A profile of RAND Health, abstracts of its publications, and ordering ... contact, such as mutual masturbation and oral sex.21-23 Because noncoital activities are an important part of adolescent sexuality, and because some of them pose a risk of STIs and may be precursors ... area at home, at school, in a library, or on a bus may afford both access and privacy Noar and colleagues1 09 have discussed some additional advantages, including the inherent scalability of the...

72
417
0

Influence of Government Policies on Industry Development: The Case of India’s Automotive Industry pdf

Danh mục: Tự động hóa

... model 194 7 194 8 194 9 195 0 195 1 195 2 195 3 195 4 195 5 19 56 195 7 195 8 195 9 1 96 0 1 96 1 1 96 2 1 96 3 1 96 4 1 96 5 India's Independence Exit of foreign assemblers First report of Tariff Commission IPR of 94 8 ... plants of major automobile and auto-component players across the three leading auto states in India 18 Sr no State Maharashtra Haryana Tamil Nadu District Pune Aurangabad Mumbai Nashik Total Gurgaon ... later also in Mumbai and Kolkata in 193 1 The number of automobiles imported/assembled in India grew significantly in the 192 0s and crossed 30,000 units per year by 193 0 (Narayana 198 9) In 19 36, ...

60
592
0

influence of polymerization temperature on nh3 response of pani tio2 thin film gas sensor

Danh mục: Vật lý

... polymerization temperatures It shows that Fig Schematic energy- band diagram for PANI/TiO2 nanocomposite three characteristic bands of the doped PANI thin ﬁlm prepared at 20 ◦ C appear at about 361 , 402 and ... for 15 to obtain a negatively charged surface Later, the PSS-coated substrate was washed with DI water and dried by a nitrogen blow The PSS-coated substrate was suitable to fabricate PANI/TiO2 thin ... resistance reached a steady value in clean air Gas exposure time was ca 150 s for each pulse of NH3 gas and the chamber was purged with clean air for ca 200 s after each pulse to allow the surface of the...

8
530
0

influence of polymerization temperature on nh3

Danh mục: Vật lý

... polymerization temperatures It shows that Fig Schematic energy- band diagram for PANI/TiO2 nanocomposite three characteristic bands of the doped PANI thin ﬁlm prepared at 20 ◦ C appear at about 361 , 402 and ... for 15 to obtain a negatively charged surface Later, the PSS-coated substrate was washed with DI water and dried by a nitrogen blow The PSS-coated substrate was suitable to fabricate PANI/TiO2 thin ... resistance reached a steady value in clean air Gas exposure time was ca 150 s for each pulse of NH3 gas and the chamber was purged with clean air for ca 200 s after each pulse to allow the surface of the...

8
409
0

Research Gaps and Measurement Challenges for Studying the Influence of New Media on Adolescent Sexual Health docx

Danh mục: Sức khỏe giới tính

... research was conducted in RAND Health, a division of the RAND Corporation A profile of RAND Health, abstracts of its publications, and ordering information can be found at www.rand.org/health ... Applications can be categorized in many ways, but some of the most common categories are social applications such as Facebook and Twitter, news and information applications, games, and shopping applications ... programming watched on a computer, for example A media application, also known as application software or an “app,” is computer software that allows a user to perform a specific task or tasks Applications...

13
414
0

Influence of the support on the physicochemical properties of Pt electrocatalysts: Comparison of catalysts supported on different carbon materials

Danh mục: Hóa học - Dầu khí

... Sources 163 (20 06) 93 [12] S.C Hall, V Subramanian, G Teeter, B Rambabu, Solid State Ionics 175 (2004) 8 09 [13] M Inoue, S Akamaru, A Taguchi, T Abe, Vacuum 83 (20 09) 65 8 [14] J.R.C Salgado, F Alcaide, ... of reactant accessibility [7,10] On the other hand, micropores could effectively block the sinking of the metal nanoparticles CNF had a relatively large accessible surface area of 96 m2 g−1 and ... increase the wettability of carbon materials, and phenols and quinones, which are stable at high temperatures, will act as anchoring sites for the metal precursor 3.2 Physicochemical characterization...

7
469
0

the influence of financial pressure on academic administrators' selection of management and resource allocation strategies

Danh mục: Kinh tế

... Reproduced with permission of the copyright owner Further reproduction prohibited without permission Reproduced with permission of the copyright owner Further reproduction prohibited without permission ... Reproduced with permission of the copyright owner Further reproduction prohibited without permission Reproduced with permission of the copyright owner Further reproduction prohibited without permission ... Reproduced with permission of the copyright owner Further reproduction prohibited without permission Reproduced with permission of the copyright owner Further reproduction prohibited without permission...

262
310
0

Influence of brand name on consumer decision Ảnh hưởng của thương hiệu lên quyết định lựa chọn của khách hàng (P1)

Danh mục: Thạc sĩ - Cao học

... on branding and consumer behavior Brand Equity Brand Loyalty Name Awareness Perceived Quality Brand Association Proprietary Brand Assets Emotional Branding Consumer Behavior Complex Buying Behavior ... Measuring and Managing Customer Based Brand Equity, Journal of Marketing Vol 57, January 199 3, p.02 12 THEORETICAL FRAME The brand awareness, brand loyalty, perceived quality and brand association ... Emotional Branding- How Successful Brands Gain The Irrational Edge, p. 39 64 Papanastassiu and Rouhani, 20 06, Too Old for a Brand, p. 16, Cited by Travis Daryl pp. 39& 174 65 Marken G .A, Emotional Branding,...

74
548
0

Báo cáo sinh học: " Replicative homeostasis II: Influence of polymerase fidelity on RNA virus quasispecies biology: Implications for immune recognition, viral autoimmunity and other "virus receptor" diseases" pot

Danh mục: Điện - Điện tử

... relative association constants (K) of A: E (KA:E) and B: E (KA :B) and the velocity (ν) of production of A from B: E ( A) and B from A: E ( B) Removal or addition of either A or B will alter equilibrium ... Virol 199 9, 73 (9) :7317-7327 113 Atkinson RL, Dhurandhar NV, Allison DB, Bowen RL, Israel BA, Albu JB, Augustus AS: Human adenovirus- 36 is associated with increased body weight and paradoxical reduction ... immunological isolation of foetal tissue by the placental trophoblastic layer [55], and placental display of HLA-G [ 56] , probably contribute to foetal stability in the face of a potentially robust...

20
398
0

Báo cáo hóa học: " Applying the scientific method when assessing the influence of migratory birds on the dispersal of H5N1 Paul L Flint" doc

Danh mục: Hóa học - Dầu khí

... Marra PP, Daszak P: Predicting the global spread of H5N1 avian influenza Proc Nat Acad Sci 20 06, 103: 19 368 -73 Peterson AT, Benz BW, Papes M: Highly pathogenic H5N1 avian ¸ influenza: entry pathways ... JSM, Guan Y: Establishment of multiple sublineages of H5N1 influenza virus in Asia: implications for pandemic control Proc Nat Acad Sci 20 06, 103:2845-50 Kilpatrick AM, Chmura AA, Gibbons DW, ... concluded that wild birds are not an important carrier because HPAI viruses such as H5N1 are rarely isolated from apparently healthy wild birds [10] However, the same statement can be made about domestic...

3
245
0

6 9 influence of activation energy a surface temperature vs time and b surface temperature vs activation energy