3d cg manual reconstruction of a world heritage site in danger
báo cáo khoa học: "Long-term follow-up after en bloc resection and reconstruction of a solitary paraganglioma metastasis in the first lumbar vertebral body: a case report" ppt
... Sarkar C, Sharma MC, Garg A, Gaikwad SB, Kale SS, Mehta VS: Paraganglioma of cauda equina: report of seven cases Brain Tumor Pathol 2005, 22:15-20 Fries JG, Chamberlin JA: Extra adrenal phaeochromocytoma ... demonstrated a thinly encapsulated neoplasm The diagnosis of a paraganglioma was confirmed by histologic and immunohistologic examinations Because vascular invasion and focal infiltration of the ... phaeochromocytoma Surgery 2009, 13:268-279 Lack EE: Extra-adrenal paragangliomas Pathology of Adrenal and Extraadrenal Paraganglia Major Problems in Pathology Philadelphia: WB Saunders; 1994, 273-292 Abe...
- 6
- 323
- 0
saltaire a world heritage site
... guard the main buildings They were carved in London and brought to Saltaire • People who live in Saltaire are mainly educated and smart and so they have cats • Every year, a photographer takes ... takes a photo of the cats and produces a calendar The cats of Saltaire David Hockney • David Hockney is a famous artist who was born in Bradford Now, many of his works are in Salt’s Mill There are ... Bradford 6) Saltaire is a combination of Sir Titus’s surname and the local river He also built • • • • • • • A church Some shops A school A hospital A wash house A library A park This is Salt’s...
- 19
- 226
- 0
báo cáo khoa học: "Reconstruction of a traumatic duodenal transection with a pedicled ileal loop: a case report" potx
... upper abdominal pain and tenderness on examination, and with haematemesis later on Information about the mechanism of injury combined with the clinical findings aroused our suspicion of an intraabdominal ... to palpation The patient underwent laboratory and radiological examination consisting of x-rays of his head, cervical spine, lumbar spine, chest and abdomen His blood was cross-matched and an ... Plain radiological and ultrasound examinations of the patient showed no pathological findings either Soon after being admitted to hospital, the patient presented haematemesis and his clinical...
- 6
- 144
- 0
báo cáo khoa học: " 3-D reconstruction of a human fetus with combined holoprosencephaly and cyclopia" pptx
... maxillae were hypoplastic, with three tooth anlagen on each side Between the maxillae the anlage of a single midaxial incisor was found (Fig 3a) No nasal septum or nasal cavity was present; instead, ... with a Leitz DMRB microscope (Leica, Wetzlar, Figure Photographs of the macroscopic appearance of the head Photographs of the macroscopic appearance of the head a) Frontal view of the investigated ... ethmoid plays an important role in the development of the bilateral symmetry of the face, and may play an important role in the determination of the median plane Competing interests The authors have...
- 11
- 292
- 0
Báo cáo y học: "Reconstruction of a missed posterior locked shoulder fracture-dislocation with bone graft and lesser tuberosity transfer: a case report" ppsx
... vertebra and external rotation was 40° Plane radiographs (Figure 3A) and CT scan (Figure 3B) confirmed a good clinical result and absence of devascularisation or instability of the humeral head Discussion ... glenohumeral joint was assessed via a deltopectoral approach The axillary nerve was palpated to ascertain its position but it was not mobilised The long head of the biceps was still intact and both ... physical therapy with active assisted range -of- motion and strengthening exercises was instituted as plane X-rays showed maintenance of joint congruency and early signs of bone healing Despite the instructions...
- 5
- 313
- 0
The closeness of a foreign sales contract in Binh Minh Household Joint Stock Company
... enumerating and paying taxation as well as performing other financial obligations in accordance with the prevailing laws - Ensuring product quality in line with the registered standards, and offering ... parties are familiar with available insurance policies, but it is too strict and necessary for an international transaction Unless parties are assured that the coverage is available in the amount ... out of two separate conditions, namely INCOTERMS (in accordance with ICC) and FOB-US – a local business custom Despite of arbitrariness of INCOTERMS, in international transactions, any contract...
- 41
- 614
- 0
Exergoeconomic optimization and improvement of a cogeneration system modeled in a process simulator using direct search and evolutionary methods
... graduate Thermodynamics in the Department of Mechanical Engineering at UFRJ He is a member of the Brazilian Society of Mechanical Sciences and Engineering (ABCM) and of the American Institute of ... the beginning of each iteration is performed The analysis provides information to hierarchically classify the components as main, secondary, and remainder, and to define main decision variables ... Valero A Exergy accounting: Capabilities and drawbacks Energy 2006, 31(1), 164-180 Giannantoni C., Lazzaretto A. , Macor A. , Mirandola A. , Stoppato A. , Tonon S., Ulgiati S Multicriteria approach...
- 14
- 593
- 0
Tài liệu An Evaluation of A Participatory Research Approach in Rainfed Lowland Area of Vinh Trach Village, B pptx
... research approaches to support the small-scale household farming in utilizing and managing of agricultural and natural resources reasonably Central elements in this participatory research are team-work ... multi-disciplinary team-work and also multiple perspectives It gives the appreciative character of social organization of innovation In fact that SWG acts to bring a collaborative and linking among ... objective of the FARM Program is to enhance the capabilities of GOs and NGOs, to build local capacity of resource poor farmers for sustainable use and management of agricultural and natural resources...
- 8
- 492
- 0
Tài liệu Business Ethics: A MANUAL FOR MANAGING A RESPONSIBLE BUSINESS ENTERPRISE IN EMERGING MARKET ECONOMIES pptx
... measurable goals Chapter 10, “Program Evaluation and Organizational Learning,” emphasizes the importance of evaluating a business ethics program as an integral part of organizational learning and of ... Program Evaluation and Organizational 10 Learning 229 Ensuring Organizational Learning Importance of Program Evaluation Developing a Data Collection Plan Reporting Program Performance Conclusion—and ... terms and addressing global standards and best practices, through evaluating the business ethics program as a part of organizational learning Chapters build on each other, but they may be read alone...
- 355
- 500
- 1
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf
... PAGE analysis of the mitochondrial membranes isolated from all these deletion strains and from a wild-type strain In the DQCR9, DISP and DBCS1 strains, a protein band of approximately 500 kDa ... Results Molecular characterization of a 500 kDa bc1 sub-complex in the yeast deletion strains lacking Qcr9p, ISP or Bcs1p BN ⁄ PAGE analysis of a yeast mutant strain in which the gene encoding the Qcr9p ... assistance of specific chaperone proteins is also required The available data indicate that the accessory factor Bcs1p is involved in the binding of ISP to an immature bc1 intermediate Yeast cytochrome...
- 15
- 639
- 0
Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc
... was prepared by incubating catechol with resting cells of a mutant, strain Y-2, of the aniline-assimilating Pseudomonas sp strain AW-2 [20] Results Spectral changes during metabolism of 4-amino-3hydroxybenzoic ... to any other sequences available in FASTA and BLAST database programs at the DNA Data Bank of Japan Recently, we reported the cloning and sequencing of the gene encoding 4-amino-3-hydroxybenzoate ... metacleavage pathway of 2-aminophenol in Pseudomonas sp strain AP-3 (A) Proposed pathway of 4-amino-3-hydroxybenzoic acid in Bordetella sp strain 10d (10) I, 4-amino-3hydroxybenzoic acid; II, 2-amino-5carboxymuconic...
- 7
- 613
- 1
Tài liệu Báo cáo khoa học: The mechanism of a-proton isotope exchange in amino acids catalysed by tyrosine phenol-lyase doc
... The anchoring of a- carboxylate and a- amino group in the external aldimine defines automatically the positions of the a- proton and the side chain of any bound amino acid The lability of the a- proton ... Braunstein, A. E (1947) Labilization of a- hydrogen of amino acids under the action of aminoferase Biokhimia 12, 556–568 (in Russian) Ó FEBS 2004 Esaki, N., Nakayuma, T., Sawada, S., Tanaka, H & Soda, K ... typical representatives of the two groups of amino acid inhibitors mentioned above The interaction of L-phenylalanine, L-methionine, and their a- deuterated analogs with TPL in D2O was characterized...
- 7
- 532
- 0
Tài liệu Báo cáo Y học: Antibacterial and antifungal properties of a-helical, cationic peptides in the venom of scorpions from southern Africa pptx
... charge of parabutoporin, this could explain the higher antibacterial activity on Gram-negative bacteria for parabutoporin compared to opistoporin Also with magainin analogs, an increase in antibacterial ... amino acids) [19], peptides consisting of amino acids 7–22 of parabutoporin (an a- helical part having the four amino acids LAKK identical to mastoparan) and of the first 28 amino acids of the ... Gramnegative and Gram-positive bacteria and their activity was compared with the activity of melittin and mastoparan (Table 1) Parabutoporin inhibits the growth of all Gram-negative bacteria...
- 12
- 598
- 0
Báo cáo khoa học: Structural characterization of a novel branching pattern in the lipopolysaccharide from nontypeable Haemophilus influenzae pot
... in uenzae LPS [16,18,40,41] The lic 3A gene, which has been shown to encode a sialyltransferase that adds Neu5Ac in an a- 2,3linkage to lactose in other H in uenzae strains, is present in strain ... Schweda, E.K.H (2001) A rapid and sensitive procedure for determination of 5-N-acetyl neuraminic acid in lipopolysaccharides of Haemophilus in uenzae: a survey of 24 nontypeable H in uenzae strains ... A- OH (O-deacylated lipid A) , 953.02 Relative abundance was estimated from the area of molecular ion peak relative to the total area (expressed as percentage) Peaks representing less than 3% of...
- 13
- 433
- 0
Báo cáo Y học: Defective translocation of a signal sequence mutant in a prlA4 suppressor strain of Escherichia coli doc
... Dynamics) after scanning of the autoradiogram In vitro transcription, translation, targeting and cross-linking analysis To generate truncated mRNA, plasmids encoding truncated nascent chains of FtsQ ... core of the signal sequence Tetracycline-resistant prlA+ and prlA4 Table Bacterial strains and plasmids used in this study Camr and Ampr indicate resistance to chloramphenicol and ampicillin, ... SecY-(G-10L)94PhoE adduct (Fig 2A, lanes and 5) probably results from the amino-acid substitutions in the mutant PrlA4 protein In the Na2CO3 supernatant, at least three major crosslinking adducts, of apparent...
- 9
- 493
- 0
Considering the Creation of a Domestic Intelligence Agency in the United States pot
... Abbreviations AAT Administrative Appeals Tribunal AD Action Directe [Direct Action] AFP Australian Federal Police AG Attorney-General AIC Australian intelligence community ANAO Australian National ... National Audit Office AQMI Al-Qaida pour le Maghreb Islamique [al Qaeda for the Islamic Maghreb] ASALA Armenian Secret Army for the Liberation of Armenia ASIO Australian Security Intelligence Organisation ... human sources A certain amount of data emanates from well-placed informants and individuals who submit plea bargains during trials for illegal activity While this particular form of human intelligence...
- 218
- 375
- 0
Báo cáo khoa học: The identification of a phospholipase B precursor in human neutrophils doc
... database and search engine Mass determination of proteins was done with the same instrument operated in linear mode and externally calibrated with a mixture of proteins Protein determination and ... and bacterial, protease contamination Protein concentration was determined with a Bio-Rad protein assay kit using BSA as a standard according to the manufacturer’s protocol Any bacterial and protease ... USA) and the tryptic peptides were extracted and analysed in a Bruker Ultraflex MALDI TOF ⁄ TOF instrument using alpha-cyano-4-hydroxycinnaminic acid (Sigma) as matrix The instrument was calibrated...
- 12
- 486
- 0
Báo cáo khoa học: Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase pot
... xb101+ (5¢-gccgcccatatgcaccaccaccaccaccacagcaccagtca gaactct), the reverse primer xa100– (5¢-gtggtgaattcagc cagtgtgcccttg), and pNIall2 as a template To facilitate purification of recombinant enzyme, ... contains 808 amino acids with a calculated average molecular mass of 87 392 Da The total calculated average molecular mass of the heterotetrameric (a2 b2) protein is 290 298 Da Electrospray MS of ... (Qiagen Inc., Valencia, CA, USA) All DNA manipulations were carried out using standard protocols [24] LASERGENE software (DNAstar Inc., Madison, WI, USA) was used for sequence manipulation and assembly,...
- 11
- 584
- 0
Báo cáo khoa học: Identification of a novel binding site for calmodulin in ammodytoxin A, a neurotoxic group IIA phospholipase A2 docx
... CAAATACaAgCGGGtGAACGGGGCTATCGTCTGTGaAAAAGGC GGAATTCGCgGCcGCCtTGTCACACTCACAAATCCGATTCTC GGGCAAGCTTGCgGCcGCAATCTGCTTTCGAcAGAATCTGAAcACATAttcgAAAAAGTATATGC GGGCAAGCTTGCgGCcGCAATCTGCTTCCGAcAGAATCTGAAcACATACAgCTATATATATAGG GGAATTCTGCAGTTAGCATTTgagCTCtccCTTGCACAAgAAGTCCGG ... 3– TAATACGACTCACTATAGGGAGACCACAACGGTTTCC GGGCaagcTTCCCCGTCTCCtCCAGGATCATCtTCCCG GGGCAAgcttgCTaTTcCCTCCTACTCCTcTTACGGATGCTACTGCGGCtgGGGGGG GACTGCAaCCCCAAAtCGGACAG CAAATACaAgCGGGtGAACGGGGCTATCGTCTGTGaAAAAGGC ... interaction of group IIA sPLA2 toxins with CaM was evaluated using a set of AtxA mutants, including this quadruple (KKML) mutant, as well as recombinant DPLA2 and its quadruple reciprocal (YIRN)...
- 8
- 401
- 0
Báo cáo khoa học: Functional importance of a conserved sequence motif in FhaC, a prototypic member of the TpsB/Omp85 superfamily ppt
... used as a template with the following primers : R450AUp (5¢-GACGAGTACACGGT GGCCGGATACAACCTCAGGA-3¢) and R450ALo (5¢-TC CTGAGGTTGTATCCGGCCACCGTGTACTCGTC-3¢); Y452AUp (5¢-ACACGGTGCGCGGAGCCAACCTCAAG ... (5¢-ACACGGTGCGCGGAGCCAACCTCAAG ACGTC-3¢) and Y452ALo (5¢-GACGTCCTGAGGTTGG CTCCGGCCACCGTGT-3¢); RA+YAUp (5¢-ACACGGT GGCCGGAGCCAACCTCAGGACGTC-3¢) and RA+YA Lo (5¢-GACGTCCTGAGGTTGGCTCCGGCCACCGTG T-3¢) After mutagenesis and ... visible in the electron density map and are not included in the final model Structural data are available in the Protein Data Bank database under the accession number 3NJT Overlay assay Channel analysis...
- 11
- 396
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25