25 total body surface area burn is taken to the operating room for tangential excision and grafting of burn wounds 2 weeks after injury during induction of anesthesia succinylcholine is given as a muscle relaxant the patient begins to
Tài liệu Báo cáo khoa học: The PA-TM-RING protein RING finger protein 13 is an endosomal integral membrane E3 ubiquitin ligase whose RING finger domain is released to the cytoplasm by proteolysis ppt
... SPPL 2a and SPPL2b [5], and streptococcal C 5a peptidase [6] PA domains have been proposed to serve as substrate or ligand recognition domains [1] or as protease regulatory regions [2] , yet they have ... protein storage vacuole [13] and was shown to bind to C-terminal vacuolar sorting determinants on tobacco chitinase and barley lectin [14], establishing that in plants the PA domain can serve as a ligand-binding ... enzyme, and a commercial E2 enzyme, either UbcH 5a, UbcH5c, or UbcH6, it was able to catalyze the formation of polyubiquitin chains, as shown by the appearance of a high molecular mass ladder of protein...
- 18
- 483
- 0
Báo cáo khoa học: Structure of Streptococcus agalactiae serine⁄threonine phosphatase The subdomain conformation is coupled to the binding of a third metal ion pptx
... Asp191 and Ser160, the last coming from the flap domain [9] There are homologous residues to Asp118 and Asp191 in HsSTP (Asp146 and Asp239) and, of course, in SaSTP (Asp118 and Asp1 92) Our SaSTP ... C and D; Fig 2A) M3 was also modeled as a Mg2+ ion, based on the same principles as for M1 and M2 (see A Fig (A) Stereoimage of the active site of SaSTP monomer C Residues are shown as combination ... monomers active sites In the alignment metal ions M1 and M2, Wn, and carboxylate groups of Asp36, Asp1 92 and Asp231 were used Alignment of 12 atoms resulted in an rmsd value of ˚ 0.3 A As shown, the...
- 10
- 542
- 0
Báo cáo khoa học: MPP3 is recruited to the MPP5 protein scaffold at the retinal outer limiting membrane ppt
... annealing the following primers: 5¢-GACT ACAAAGACCATGACGGTGATTATAAAGATCATGAC ATCGATTACAAGGATGACGATGACAAGCTCATG-3¢ (sense), and 5¢- GTACAGCTTGTCATCGTCATCCTTG TAATCGATGTCATGATCTTTATAATCACCGTCATGG TCTTTGTAGTC-3¢ ... Ready cDNA (Clontech laboratories, Woerden, the Netherlands) was used to amplify MPP3 Primer pair 5¢-GATCCCGGGCCAGCATGCC AGTGCTATCGGAGG-3¢ (sense) and 5¢-GATCGTCGAC TTACCTGACCCAACTAACAGG-3¢ (antisense) ... coimmunoprecipitation with MPP3 (Fig 5A, lanes and 6) it was visible as a double band of 70 and 80 kDa, due to enrichment of the 80 kDa form [24 ] The recombinant MPP5 has a molecular weight of 80 kDa The...
- 14
- 449
- 0
how the use of the diary form narrative is beneficial to the
... combination of descriptions, facts, that represents a group as a whole and the reader can feel as if they are part of the group and read, and think along with the characters Another thing dealing with the ... happen when the diary form of narrative is used For instance, after Lucy had written what was happening to her when her mother passed away, the story went back in time for another important matter ... exactly how a person was talking and acting through the written dialects In the novel Dracula, all the diaries, of all the individuals come together and in the end, become one powerful, combination...
- 2
- 473
- 0
what is what in the nanoworld. a handbook on nanoscience and nanotechnology, 2004, p.350
... where their time of arrival can he measured The time taken for the atom to arrive at thc detector is a measure of the mass of that atom Thus, compositional analysis of the sample can be carried ... distribution ad-jointoperator - an operator B such that the inner products (Ax,y) and (x, By) are equal for a given operator A and for all elements z and y of the Hilbert space It is also known as an associate ... interaction Here r is the interatomic distance, A, a , and b are the empirical parameters, ql and 92 are formal charges of the atoms Horn-Mayer potential - the interatomic pair potential in the form:...
- 350
- 337
- 0
what is what in the nanoworld. a handbook on nanoscience and nanotechnology, 2008, p.541
... particular arrangement of atoms at the apex of the tip But for that reason it can vary by not more than a factor of The resistance is more sensitive to the chemical nature of the adatom and surface ... causing atoms on the surface of the tip to be ejected The atoms travel down a drift tube where their time of arrival can be measured The time taken for the atom to arrive at the detector is a measure ... in their title A list of 62 ‘‘nano’’ journals has been added to the Appendix of the book Only a few of them appeared before 20 00 and most of them started their activity in the last four years...
- 541
- 499
- 0
Báo cáo hóa học: " Vaccinia virus lacking the deoxyuridine triphosphatase gene (F2L) replicates well in vitro and in vivo, but is hypersensitive to the antiviral drug " pot
... the dUTPase as a target for antiviral therapy, F2L was deleted in the WR strain of VV and the replication of the mutant virus (VV Δ F2L-gfp) was evaluated in cell culture and in intranasally infected ... infected cells and may alter the susceptibility of the mutant virus to some antiviral drugs A set of thymidine analogs was selected and a standard plaque reduction assay was used to evaluate the susceptibility ... experiments and analysis of the data KAK contributed to the acquisition and interpretation of data RWM contributed to the conception of the studies and the critical review of the manuscript PCT...
- 6
- 330
- 0
Báo cáo hóa học: " Impairment of the CD8+ T cell response in lungs following infection with human respiratory syncytial virus is specific to the anatomical site rather than the virus, antigen, or route of infection" pdf
... lung tissue) were detected in the two animals euthanized on each day: day 2, 2. 9 and
- 8
- 381
- 0
Báo cáo y học: "Is Obesity Associated with an Increased Risk for Airway Hyperresponsiveness and Development of Asthma" pdf
... 1 .21 –6 .20 ) and the AR was 41% for class II obesity in men, whereas the OR was 4. 82 and the AR was 51% for males with class II obesity In females, obesity was a significant risk factor for AHR at all levels ... relationship and understand the causal mechanisms of obesity and asthma association From a public health standpoint, these studies have substantial implications If asthma were added to the list of conditions ... 52 Allergy, Asthma, and Clinical Immunology, Volume 4, Number 2, 20 08 Canadians examined the association between BMI and asthma prevalence The study found that unit of BMI increase was associated...
- 8
- 416
- 0
Báo cáo y học: "Rheumatoid arthritis seropositive for the rheumatoid factor is linked to the protein tyrosine phosphatase nonreceptor 22-620W allele" docx
... BP and FC analyzed and interpreted the data LM, SL and TB made a substantial contribution to the acquisition of clinical data and the follow-up of the patients All authors read and approved the ... the PTPN 22 putative genotype in the index ASP RA sample, taking advantage of the linkage data available at the PTPN 22 locus, as previously described [ 32] Test for linkage and association in the ... especially factors such as PTPN 22 The increased power of the TDT over the ASP analysis for such factors was predicted long ago [26 ] Our observation of the absence of a major increased frequency of...
- 8
- 342
- 0
Báo cáo y học: " Dimerisation of HIV-2 genomic RNA is linked to efficient RNA packaging, normal particle maturation and viral infectivity" pps
... distinctive neat band but rather as a variably spread band In addition, it is not always possible to clearly distinguish the end of the dimer band from the beginning of the monomer band and the ... dimerisation and encapsidation are associated with correct assembly and particle maturation in HIV -2 Efficient dimerisation and encapsidation are associated with correct assembly and particle maturation ... template was created by reverse transcriptase (RT)-PCR amplification of the sequence from position 61 to 346 of human GAPDH using 5' GGTGAAGGTCGGAGTCAACG 3' and 5' AATTAACCCTCACTAAAGGACTCCACGACGTACTC...
- 14
- 403
- 0
Báo cáo sinh học: "Prediction error variance and expected response to selection, when selection is based on the best predictor for Gaussian and threshold characters, traits following a Poisson mixed model and survival traits" potx
... and U) are used as the notation for a random variable or a random vector; and lower case letters (e.g u i and u) are used as the notation for a specific value of the random variable or the random ... A1 and exactly those females in A2 are selected, that is, the probability that aibp ≥ t1 for all ˆ bp bp i ∈ A1 , and < t1 for all i ∈ F \A1 , and ≥ t2 for all i ∈ A2 and aibp < t2 ˆ ˆ ˆ for all ... scale, a , is a = A1 :A1 ⊆F A2 :A2 ⊆M P (A1 × A2 ) × (f,m) A1 A2 bp ˆ bp E ao |af ≥ t1 , am ≥ t2 − E (ao ) ˆ |A1 | |A2 | (9) where P (A1 × A2 ) is the probability that exactly those males...
- 27
- 254
- 0
Some people think that it is important to use leisure time for activitiesthat improve the mind
... watching TV induces mood and brain states akin to mild depression and anxiety, although watchers themselves may be unaware of it The popular genre of forensic crime shows appears to have a particularly ... natural inclination is to avoid social gatherings, as it is for company-loving extroverts Studies show that husbands who reluctantly attend dinner parties at the insistence of their wives have ... things that bring us less overall joy and satisfaction Another reason is that getting the most out of our leisure can initially feel like hard work Finding deep and lasting gratification often requires...
- 4
- 602
- 0
INFLUENCE OF STREAMSIDE SURFACE AREA ON AQUATIC BIOTA AND BIOFILM ACTIVITY
... trophic level, and (2) a separate evaluation of the activity of each microbial community using the oxygen production rate and uptake rate of the biofilm attached to the streamside MATERIALS AND METHODS ... bacteria in the gravel-filled channel is maintained high at an average of 10 % of the total OR, shown a similar change to the number of nitrifying bacteria On the other hand, oxygen uptake rate ... 20 86 122 8 24 63 1440 3 520 325 3 Protozoa (N per cm ) Mastigophora 858 726 1 821 1144 20 87 1347 29 87 29 33 Sarcodina 21 21 28 21 33 40 40 93 Ciliata 481 98 23 7 63 343 53 493 22 7 crawling 321 42 70 127 ...
- 6
- 250
- 0
Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx
... CAGAGAAACAAGCAAAACAAAAAGCTTTTCTTTTCACTAACGTATATGATGTTCAGCTTGAAAGC TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTTCAAATTGCTTTGGC CAGAGAAACAAGCAAAACAAAAAGCTTTTCTTTTCACTAACGTATATGATGGCAAGACAAAAGATGTT TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTCTACAAACTCTGTAAAACTT ... TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTCTACAAACTCTGTAAAACTT AACGGCCCTTCGCAAGTGCAGCTGCGGGATGCAGTCTTGATGAATGGGTTGAACTACGATCCAGAAGC TTCACTGAAGGTGGTCACGATGTTCCATTGACAAATTACTTGAACGCATTGAACTACGATCCAGAAGC ... CATTATTGGAATGAGGAAAT ATTTCCTCATTCCAATAATG TTGAACTACGATCCAGAAGC GGATCCTCATTGAGAACAATTTCCTTGA GGATCCATCATGTTCTCATCATCATAATATG GGATCCGTTAAATATAATGCAGTGACGAAGATA GGATCCAAGTCAAACCTTGAGAAAGAACGA CACGGCATATTATGATGATGAGAACATGATGGATCTCG...
- 15
- 475
- 0
Tài liệu Báo cáo khoa học: Phosphorylation of hormone-sensitive lipase by protein kinase A in vitro promotes an increase in its hydrophobic surface area ppt
... · 0 .25 and · 0.5, where the signal-tonoise ratio was the highest, i.e 2. 4 in the absence of PKA, and 3 .2 in the presence of PKA Negative stain transmission electron microscopy analysis of the ... lipase activity of adipose tissue J Lipid Res 13, 424 – 426 21 Laemmli U K (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4 Nature 22 7, 680–685 22 Baschong ... that this is followed by an interaction between the apolar acyl chains of the phospholipids and side chains of particular amino acids, thus accounting for the increased capacity to penetrate to...
- 11
- 562
- 0
“Marketing is the whole business, taken from the customer’s point of view.” - Peter Drucker docx
... areas • Accessible for the elderly • Tasty breakfast with a place to sit, eat and talk •Clean, accessible restrooms Signs and Banners Create a Vibrant Market Experience The goal is to draw as many ... eating and smoking Salesmanship Every so often, step outside your stall Walk the market as a shopper and evaluate what customers are drawn towards Some vendors always attract a crowd; take time to ... season to hand out •Enter a market theme float in parades •Create a produce display for the county fair •Offer to read an agriculture-themed book during story time at your public library, local...
- 6
- 431
- 0
The Inside Out Diet 4 Weeks to Natural Weight Loss, Total Body Health, and Radiance doc
... that attached to the dietary fat they ate, so it could be distinguished from the fat that was already in the body They also did blood tests and measured body fat They found that all of these patients ... recognized and appreciated Hepatology, the branch of medicine concerned with the functions and disorders of the liver, has only existed as a medical specialty for the last fifty years And, as recently as ... resistance can lead to fatty liver because it changes the way sugar and fat are metabolized in the liver, muscles, and fat cells As a result of these changes, there is an increased uptake of triglyceride...
- 290
- 1,954
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008