2 3 diacetamido 2 3 dideoxy d mannuronic acid udp d man 2nac3nac a udp 2 3 diacetamido 2 3 dideoxy d glucuronic acid udp d glc 2nac3nac a and 2 acetamido 3 acetimidoylamino 2 3 dideoxy d mannuronic acid udp d man 2nac3nam a
Báo cáo khoa học: " Radiosensitization by 2-benzoyl-3-phenyl-6,7-dichloroquinoxaline 1,4-dioxide under oxia and hypoxia in human colon cancer cells" pdf
... Comet assay MH provided the compound and critically reviewed the manuscript HM conceived of the study, and participated in its design and coordination and drafted the manuscript All authors read and ... this drug in cancer cells DNA damage by DCQ in irradiated DLD-1 cells under oxia and hypoxia To determine if DCQ is a DNA-targeting agent, the extent of DNA damage was measured by the alkaline ... Page 12 of 13 (page number not for citation purposes) Radiation Oncology 20 07, 2: 1 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Diab-Assef M, Haddadin M, Yared P, Assaad C, Gali-Muhtasib...
- 13
- 229
- 0
NGHIÊN cứu cấu TRÚC của một số sản PHẨM CHUYỂN hóa từ 2 (ACETAMIDO) 3 (4 CHLOROPHENYL)ACRYLOHYDRAZIDE
... 4-(4-chlorobenzylidene) -2- methyloxazol-5-one (A) 26 2. 2 .2. Tng hp 2- (acetamido) -3- (4-chlorophenyl)acrylohydrazide (B) 28 2. 2 .3. Tng hp 5-bromo -2- hydroxybenzylidene -2- (acetamido) -3- (4- chlorophenyl)acrylohydrazide (C) .28 2. 2.4. ... arylidenehydrazide (34 ) c tng hp bng phn ng ngng t gia 3phenyl-5-sulfonamidoindole -2- carboxylic acid hydrazide vi cỏc loi aldehyde [17] Trong ú, 3- phenyl-5-sulfonamidoindole -2- carboxylic acid ... 33 3 .2 Tng hp 2- (acetamido) -3- (4-chlorophenyl)acrylohydrazide (B) 34 3 .2. 1. Phng trỡnh phn ng 34 3 .2. 2. C ch phn ng 35 3 .2. 3. Nghiờn cu cu trỳc .35 3 .2. 3. 1 Ph...
- 75
- 368
- 0
Tài liệu Báo cáo khoa học: Dual P2Y12 receptor signaling in thrombin-stimulated platelets – involvement of phosphoinositide 3-kinase b but not c isoform in Ca2+ mobilization and procoagulant activity pdf
... = 3 5) (D) Human platelets in fibrin-depleted human plasma were preincubated with inhibitors and activated with tissue factor ⁄ CaCl2 After 10 min, FITC-labeled annexin A5 was added, and fractions ... with ADP (20 lM), as indicated, and permeabilized with saponin in the presence of Fluo -3 After adjustment of the free Ca2+ level to 30 0 nM, InsP3 (100 nM) was added, and Ca2+ mobilization was measured ... results demonstrate that both autocrine-released and externally-added ADP reinforce the thrombin receptor-induced Ca2+ responses by a moderate increase of the first Ca2+ peak and a more marked increase...
- 15
- 565
- 0
Báo cáo khoa học: Crystal structures of the human SUMO-2 protein at 1.6 A and 1.2 A resolution ppt
... than 3 .2 A, are observed in the refined model at 1 .2 A, with one exception ˚ between Asp16 and Arg36, which is seen in the 1.6 A model The amino acids are shaded in red, green and blue for acidic, ... interactions include two hydrogen bonds between backbone atoms of Gly27(O)– Lys 33* (N) and Val29(N)–Gln31*(O), and a salt bridge between the side chains of Asp26 and Arg50* (Amino acid residues ... 7868 ( 633 ) 0.169 (0 .26 6) 0.190 (0 .27 3) 0.017 1.8 27 1 .3 97.1 2. 9 17.7 /3 12 22. 8/ 32 2 34 .3/ 67 SHELX-97 20 948 (1 924 ) 0.119 (0 .21 7) 0.185 (0 . 23 9) 0.0 13 2. 3 26 1.8 96.8 3 .2 18.4 /28 8 27 .6 /29 7 42. 8/ 127 observed...
- 9
- 441
- 0
Báo cáo khoa học: Cytosolic phospholipase A2-a and cyclooxygenase-2 localize to intracellular membranes of EA.hy.926 endothelial cells that are distinct from the endoplasmic reticulum and the Golgi apparatus pdf
... cPLA2 -a and convert arachidonic acid into prostaglandin H2 [8,9] To date, two distinct COX isoforms, COX-1 and COX -2, have been identified and characterized, and an alternative splice variant ... demonstrated that this interaction was necessary for cPLA2 -a- mediated arachidonic acid release, and suggested that vimentin may function as an adapter protein for FEBS Journal 27 2 (20 05) 127 8– 129 0 ª 20 05 ... (20 03) Association of cPLA2-alpha and COX-1 with the Golgi apparatus of A5 49 human lung epithelial cells J Cell Sci 116, 23 03 23 10 32 Hallam TJ, Pearson JD & Needham LA (1988) Thrombin-stimulated...
- 13
- 387
- 0
UFC 3-450-01 15 May 2003UNIFIED FACILITIES CRITERIA (UFC)NOISE AND VIBRATION CONTROLAPPROVED docx
... 9-1 9 -2 9-1 9-1 This manual supersedes TM 5-805-4/AFM 88 -37 /NAVFAC DM 3. 10, dated 30 December 19 83, recind DD Forms 22 94, 22 95, 22 96, 22 97, 22 98, 22 99, 23 00, 23 01, 23 02, 23 03, dated October ... Surface Weight (lb/ft2) 1-1 /2 6-1 /2 10 31 13 17 63 14 19 22 125 13 20 24 26 25 0 19 25 27 28 500 23 27 29 29 1000 27 28 29 30 20 00 27 28 31 32 4000 27 31 36 38 8000 31 34 40 43 STC 26 28 30 31 ... Specification Sample Sound Power Level Specification Bandwidth and Geometric Mean Frequency of Standard Octave and 1 /3 Octave Bands 2- 4 2- 5 3- 3 3- 4 3- 6 3- 7 3- 8 3- 9 4 -2 4-7 4-8 4-9 4-10 4-11 4- 13 4-14...
- 152
- 425
- 0
![UFC 3-310-07A 19 COLD-FORMED LOAD BEARING STEEL SYSTEMS AND MASONRY VENEER/STEEL STUD WALLS. [UNIFIED FACILITIES CRITERIA (UFC)] (June 2006) docx](https://media.store123doc.com/images/document/2014_06/27/small_ZYNBNv9Ecs.jpg)
UFC 3-310-07A 19 COLD-FORMED LOAD BEARING STEEL SYSTEMS AND MASONRY VENEER/STEEL STUD WALLS. [UNIFIED FACILITIES CRITERIA (UFC)] (June 2006) docx
... the “room acoustics” material in paragraph 5 3 of the N&V manual and the source data in paragraphs 2 7 and 2 8 of this manual and in chapter of the N&V manual, it is possible to calside an noise ... source may also be a factor that influences sound radiation; for example, chapter data in the N&V manual and paragraph 2 8c in this manual indicate special directivity effects of large intake and exhaust ... paragraphs 3 4 and 3 5 c Sample calculations Sample calculations using these two new data forms (DD Form 23 04 and DD Form 23 05) appear in chapter 2- 10 Other noise sources Gears, generators, fans,...
- 96
- 220
- 0
Giáo án Anh văn lớp 8 - UNIT 3 AT HOME - PERIOD 14 - LESSON 1 : GETTING STARTED LISTEN AND READ ppt
... d Cook e Tidy up f Feed the chicken II / Presentation : Introduce the topic of the passage and some new words Listen and copy down Pre- teach Vocabulary : - a steamer - a cup board - a sauce ... sauce pan Repeat in chorus and - chore individually - a sink Guess its meanings * Checking techniques : What and where and copy - Set the scene of the dialogue between Nam Play game and his mother ... looking at their - cook dinner books Nam has to - go to the market to buy fish and vegetables - call his Aunt , Ms Chi and ask her to meet his mother at grandma,s Read their sentences they have...
- 4
- 1,243
- 2
Tài liệu hướng dẫn sử dụng Micrologic control units 2.0 A, 5.0 A, 6.0 A and 7.0 A pps
... connector 28 long time Ir 29 33 Micrologic 2. 0 A 24 25 26 27 Test 32 at Ir Navigation 29 30 31 12 16 20 24 E5 139 3A 27 28 Indications 24 25 26 E5 139 4A long-time current setting Ir long-time tripping delay ... Industries SA 5, rue Nadar 925 06 Rueil-Malmaison Cedex France Tel: +33 (0)1 41 29 82 00 Fax: +33 (0)1 47 51 80 20 As standards, specifications and designs develop from time, always ask for confirmation ... A Ii setting In = 20 00 A In = 20 00 A See pages and for information on the available settings E6 036 8A Set the tripping delay Thresholds E5 137 2A E5 137 3A tr Ir t 12 16 20 24 (s) I2t OFF curve I2t...
- 31
- 3,275
- 19
Unit 3: At home.Period 14: Lesson 1: Getting started, Listen and read pps
... infinitive - Ask Ss to list the things Nam has to - cook the dinner Nam has to - go to the market to buy fish and vegetables - call his aunt, Ms Chi and ask her to meet his mother at grandma’s house ... new words: a steamer: nồi hầm chore: việc vặt nhà a cup board: chạn bát đ a a sink: bồn r a bát a sauce pan: xoong, ồi nấu canh * Checking: What and where While- reading: - Play the tape twice ... practice listening - Ask Ss to practice reading the dialogue in pairs - Call some pairs to read aloud - Present the use of the model verbs - Give form: Has/ Have to + infinitive = must + bare...
- 4
- 484
- 0
Báo cáo khoa học: "A comparison of photosynthetic responses to water stress in seedlings from 3 oak species: Quercus petraea (Matt) Liebl, Q rubra L and Q cerris L" doc
... rapid leaf dehydration in the dark for Q petraea (Epron and Dreyer, 19 92) and for a large spectrum of species (Dreyer et al, 19 92) Rapid leaf dehydration does not affect photochemistry above degrees ... leaf disks Drought effects on stomatal conductance and net CO assimilation rate Stomatal conductance to water vapor (ψ ) w and net CO assimilation rates (A) dis2 played large species-related ... drought-induced embolism than Q rubra drought Q leaf-disk O electrode (Hansatech, UK) A stream of water-vapor saturated air, maintained at 23 °C, and with ambient CO was sufficient to , or heating...
- 13
- 402
- 0
Báo cáo khoa học: "Gas exchange and water relations of 3 sizes of containerized Picea mariana seedlings subjected to atmospheric and edaphic water stress under controlled conditions" pps
... Photosynthesis, water relations, and foliar nitrogen of Picea mariana and Larix laricina from drained and undrained peatlands Can J For Res 20 , 995-1000 Newton M, Cole EC, White DE (19 93) Tall planting ... also decreased with increased seedling size, increased PEG concentration and increased evaporative demand (fig 2) The significant 3- way interaction (table II) reveals that the pattern was not uniform ... under the PEG treatment in the low evaporative environment are comparable to rates observed on black spruce both under controlled conditions (Wang and Macdonald, 19 93; Yue and Margolis, 19 93) and...
- 9
- 201
- 0
Báo cáo y học: "Analysis of the 5''''UTR of HCV genotype 3 grown in vitro in human B cells, T cells, and macrophages" potx
... specimens MOA designed experiments and performed molecular work SZS and DR designed and conducted experiments, analyzed the data, and wrote the manuscript All of the authors have read and approved the ... CCA TRG ATC ACT C 9. 2a- flap Negative 34 4 32 3 AAT AAA TCA TAA CAT GWT GCA CGS TCT ACG AGA C up Positive 11 28 CCC TGA TGG GGG CGA CAC TCC 34 7 down Negative 34 5 32 5 TGC TCA TGG TGC ACG GTC TAC GAG ... 32 3 CAT GWT GCA CGS TCT ACG AGA C 10. 1a Positive 48 71 CTG TGA GGA ACT WCT GTC TTC ACG CRG 10 .2 Negative 31 0 29 3 CAC TCG CAA GCA CCC TAT CAG 9. 1a- flap Positive 24 42 AAT AAA TCA TAA GAC ACT CCA...
- 11
- 276
- 0
Báo cáo khoa học: " The inhibition of assembly of HIV-1 virus-like particles by 3-O-(3'''',3''''-dimethylsuccinyl) betulinic acid (DSB) is counteracted by Vif and requires its Zinc-binding domain" pdf
... (WCL) and extracellular VLP analyzed by SDS-PAGE and immunoblotting, using anti-Vif primary antibody and secondary phosphatase-labelled antibody, followed by anti-Gag primary antibody and secondary ... antibody and secondary phosphatase-labelled antibody, followed by anti-Gag primary antibody and secondary peroxidase-labelled antibody (a) , WCL (*), Asterisk marks posttranslationally modified Gag ... using anti-Vif primary antibody and secondary peroxidase-labelled antibody, followed by anti-Gag primary antibody and phosphatase-labelled secondary antibody (A) , WCL; (B), VLP (m), prestained molecular...
- 18
- 332
- 0
báo cáo khoa học: " The redox-sensitive transcription factor Rap2.4a controls nuclear expression of 2-Cys peroxiredoxin A and other chloroplast antioxidant enzymes" pps
... was PCR amplified in five fragments using the primers AAACCATGGCATGCATAAGAGTC and TCCGGGAAATCCAGG for fragment 1, AAACCATGGCATGCATAAGAGTC and GATGACGGAGATGATG for fragment 2, TCTCCGTCATCGAAC and ... and GCAGAGTTTCTGGGT for fragment 3, AAACCATGGAATACCCAGAAACT and GCGTGACCGGAGACATG for fragment and CTCCGGTCACGCGATTCAAC and CTCTCTTCACTTGGTTTAC for fragment To generate double-stranded 13 20 ... + + F5 + + + free RAP2. 4a + + Rap2. 4a Rap2.6 Rap2 .2 ERF4/Rap2.5 Rap2 .3 Apetala2 Rap2.7 Rap2.8 Rap2.1 Rap2.10 CBF1 DREB 2A C RAP2. 4a E RAP2.6 F4 CE3: CTCCGGTCACGCGATTCAAC MutA: G MutB: ...
- 14
- 247
- 0
Investigations of the scavenger receptor class a and complement receptor 3 two pattern recognition receptors
... 2. 2 .2. 1 2. 2 .2. 2 2. 2 .2. 3 2. 2 .2. 4 2. 2 .2. 5 2. 2 .2. 6 2. 2 .2. 7 2. 2 .2. 8 2. 2 .2. 9 2. 2 .2. 10 2. 2 .2. 11 2. 2 .2. 12 2 .2. 2. 13 2. 2 .2. 14 2. 2 .2. 15 2. 2 .3 2. 2.4 2. 2.4.1 2. 2.4 .2 2 .2. 4 .3 2. 2.4.4 2. 2.4.5 2. 2.4.6 2. 2.4.7 2. 2.4.8 ... kDa 22 .5 kDa S S HOOC S COOH 39 .5 kDa S C3b NH2 75.5 kDa Factor I and cofactors C3f 35 kDa 22 .5 kDa S S HOOC S COOH 39 .5 kDa S iC3b NH2 75.5 kDa Factor I and cofactors Proteases C3dg 39 .5 kDa ... blood monocytes 89 Microbial and molecular stimuli used in the present studies 89 iii 2. 3. 3.1 2. 3. 3 .2 2 .3. 4 2. 3. 5 2. 3. 6 2. 3. 7 2. 3. 8 2. 3. 9 2. 3. 10 2. 3. 11 2. 4 2. 4.1 2. 4 .2 2.4 .3 2. 4 .3. 1 2. 4 .3. 2...
- 272
- 243
- 0
VERNON I.S.D ATHLETIC DEPARTMENT POLICIES AND GUIDELINES
... tolerated Drugs All athletes in grades – 12 shall be subject to a mandatory student drug-testing program Testing shall be performed in accordance with accepted practices and procedures as established ... the athletic director, the appropriate coach, and the superintendent shall decide what actions will be taken I have read and fully understand all of the policies of the V.I.S .D athletic department: ... PRACTICE AND GAME – NO EARRINGS IN PRACTICE, GAME, AND ANY SCHOOL FACILITIES – NO BANDANAS, RAGS, BODY PIERCING (not including earrings), TONGUE RINGS, ETC FACIAL HAIR OR HAIR (will be asked to take...
- 6
- 386
- 0
Ele ctricity Use d by Office Equipment and Netw ork Equipment in the U.S.: Detailed Report and A ppendices ppt
... 14,756 25 2 12 3, 310 4 ,21 3 1,747 1, 130 1 ,33 6 5,754 1, 630 1,059 35 9 21 2 2, 526 2, 38 6 1995 4 ,26 8 18,109 25 6 11 3, 350 4, 32 3 1,816 1,095 1,4 13 9,041 1,701 1,0 52 39 0 25 8 2, 778 1996 5,190 21 ,39 3 25 2 12 3, 300 ... 7, 821 23 7 12 3, 005 2, 900 1,000 1,900 836 1,444 19 92 2,111 9,7 63 24 2 12 3, 130 2, 900 1 ,20 0 1,700 1,700 1,466 19 93 2, 6 32 13, 059 24 7 12 3 ,22 5 3, 350 1,700 1,000 650 3, 500 1, 5 23 1,966 2, 141 1994 3, 533 ... estimate uncertainty in commercial input data and industrial input data Tables A -27 and A -28 show our estimates of the range of uncertainty in commercial/industrial and residential input data,...
- 50
- 454
- 0
Ph.D. Program in “Economics and Management” Accounting and governace The role of Corporate Disclosure docx
... quality and extent measures, British Accounting Review 43( 3), 20 0 -21 3 PhD Program in Economics and Management Advanced Financial Accounting Guideline for presentations Each student will provide ... sociology and critical perspectives, Accounting and Business Research, 41, 5, 415- 437 PhD Program in Economics and Management Advanced Financial Accounting Classes / : Non-financial information (Federica ... 10,000 words inclusive of all exhibits and references The deadline for the submission is the last day of the final exam period PhD Program in Economics and Management Advanced Financial Accounting...
- 5
- 378
- 0
Tìm thêm: khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25