14 ias 19 the limit on a defined benefit asset minimum funding requirements and their interaction
Math Concept Reader MCR g4 putting the world on a page
... Through Australia and Japan Julia’s grandfather is a philatelist A philatelist is a person who collects postage stamps During his travels, Grandfather finds and purchases stamps He then saves them as ... after she helps Grandfather organize his stamps, Julia wants to become a philatelist and start a stamp collection of her own Grandfather and Julia talk about stamps with familiar images 11 ca43os_lay_070103ad_cp.indd ... 1:31:12 AM DIGITAL FINAL PROOF Before he leaves, Grandfather reminds Julia to handle the stamps carefully Grandfather reminds Julia to carefully handle the stamps “Not all of the stamps are valuable,”...
- 19
- 392
- 0
A study on the development on tunable opto fluidic devices by diamond turning and soft lithography
... demands for curvature accuracy and surface finish and they have been successfully fabricated with diamond turning [21] Another example of the applications of diamond turning is the fabrication ... tolerances Careful selection of material could also prevent premature damage to the diamond cutting tool and substrate 13 To elaborate on the importance on material considerations, a few concrete examples ... of the calibration plate and gray scale masks is one of the major drawbacks of this method A gray scale mask that is less than 20 mm2 costs about S$2000 while the calibration plate costs about...
- 141
- 332
- 0
A study on textual equivalence between some australian short stories and their vietnamese translations
... & ! A , % / , , ! & ! D F @ & %A B & ? G F @ A @ A " ) 1 & @ & :A ! ! @ ! A ? E @E A ! * @ A F0 F F / F @ & 5A & ? @ A ? @ A ! !C " 2 ! F @ & ;A * ? ' & ; ! # () / / F & @ & >A ! ? B @ & =A & ... B / B " ) B / @ A " C * @ A ) @ A B @ A B @ A @ A , C , :% C " $ )C " # ( " # ( / , ! ! & O ;;: $( :Q ! ! =:: '; Q / @%& A … F "8 F '') & :: @%& %A … "8 $() @%& :A … "9 %5>) @%& 5A … & "9 # %5') ... 'A # $ / & , , B B ( ) > C " ) B / & / E B B @ & $A F @ & A # * M " / B & @ &% (A E < < , B ! ' @ &% A G ! ! E & ?* ! ' ) = B & ! " @ &% %A B & N + B C B , , B F " ) ' ( , , ! @ &' A ' ' @ &%:A...
- 76
- 441
- 1
Tài liệu Báo cáo khoa học: Modeling of tRNA-assisted mechanism of Arg activation based on a structure of Arg-tRNA synthetase, tRNA, and an ATP analog (ANP) ppt
... ArgRS and S cerevisiae ArgRS, a large conformational change of the anticodon loop, the D-loop, and the T-loop, and deviation of the inclination of base planes of the acceptor stem and the anticodon-binding ... rather than the C On the other hand, the interaction with C results in the aminoacylation reaction It is expected that the direct interaction between the the 2¢-OH group of tRNA and the a- carboxyl ... the kcat and Km values for tRNAArgICG and tRNAArgUCU on the Asn106 fi Ala, Phe109 fi Ala and Gln111 fi Ala mutant proteins of S cerevisiae ArgRS are the same as those on the wild-type ArgRS [14] This...
- 17
- 512
- 0
Closing the Cancer Divide: A blueprint to expAnd Access in low And middle income countries pdf
... Marian Affarah Marcella Alsan Ala Alwan Ana Mar a Amaris Islene Araujo de Carvalho Martha del Socorro Arias Novoa Larry Bagley Emily Bahnsen Anna Barker Matthew Basilico Janine Barnaby John Beard ... Rwanda: Comprehensive National Cervical Cancer Prevention Program and the Rwanda Task Force on Expanded Access to Cancer Care and Control 233 Afsan Bhadelia, Kathy Cahill Afsan Bhadelia, Imad ... national program on cancer care and control 102 Afsan Bhadelia, Imad Treish, Zaid Bitar, Ruba Anastas, Mahmoud Sarhan Part III: MUCH CAN BE DONE Section 6:Innovative delivery of cancer care...
- 286
- 453
- 0
Báo cáo khoa học: Crystal structure of RNase A tandem enzymes and their interaction with the cytosolic ribonuclease inhibitor potx
... (Figs and S1) revealed that the linkers not constrain the ability of the RNase A entities to adopt the same orientation in the crystal as monomeric RNase A On the other hand, the decreased activity ... was from Metabion International AG (Martinsried, Germany) All other chemicals were of the purest grade commercially available Expression, renaturation and purification of RATEs The experimental ... RNase A entities) was incubated in the absence or in the presence of RI (100 pm or 25 nm) for min, and the reaction was started by addition of FAM-AUAA-TAMRA (final concentration 50 nm) After a...
- 10
- 535
- 0
Proposal for a COUNCIL DIRECTIVE on a common system of financial transaction tax and amending Directive 2008/7/EC pot
... on the one hand, and the purchase/sale, transfer, conclusion or modification of derivatives agreements, on the other hand, have a different nature and characteristics, they have to be associated ... all financial transactions that fall under the same category pursuant to paragraph (a) and (b) Chapter III Payment of FTT, related obligations and prevention of evasion, avoidance and abuse Article ... N /A N /A N /A N /A N /A N /A Payments (5) N /A N /A N /A N /A N /A N /A N /A N /A Year N is the year in which implementation of the proposal/initiative starts Technical and/ or administrative assistance and...
- 31
- 569
- 0
Báo cáo hóa học: " Research Article On a New Hilbert-Hardy-Type Integral Operator and Applications" pptx
... Yang, On the norm of a Hilbert’s type linear operator and applications,” Journal of Mathematical Analysis and Applications, vol 325, no 1, pp 529–541, 2007 B G Pachpatte, On some new inequalities ... obtained As applications, a new Hilbert-Hardy-type inequality similar to 1.3 is given, and two equivalent inequalities with a best constant factor as well as some particular examples are considered ... Journal of Mathematical Analysis and Applications, vol 243, no 2, pp 217–227, 2000 N Das and S Sahoo, “New inequalities similar to Hardy-Hilbert’s inequality,” Turkish Journal of Mathematics,...
- 10
- 333
- 0
Báo cáo hóa học: " On the Geometrical Characteristics of Three-Dimensional Wireless Ad Hoc Networks and Their Applications" pptx
... generated independently and uniformly in the space and the distance between them are calculated A total of 10000 such trials are carried out The simulation and theoretical results on the distance ... increase sharply and hence the mean value of the max-flow capacity decreases The quantified and more exact depiction of the phenomenon requires further investigation and is beyond this paper Secondly, ... and the max-flow capacity Moreover, in their landmark paper, Gupta and Kumar [4] took into account the distance between the source and terminal of messages in measuring the transport capacity of...
- 10
- 368
- 0
Báo cáo y học: "Ablation of atrial fibrillation with the Epicor system: a prospective observational trial to evaluate safety and efficacy and predictors of success" pptx
... heparin and amiodarone With reconvalescence of the patient, anticoagulation (warfarin or coumadin) and antiarrhythmic therapy (amiodarone 200 mg/d) were switched to oral medication and maintained ... for months After months continuance of oral anticoagulation was determined on basis of the CHADS2 score In case of contraindications for amiodarone treatment, the latter was replaced by a beta blocker, ... transthoracic echocardiography were conducted systematically at and 12 month follow-up visits Statistical analysis Data were entered into a computerized database and analyzed with a statistical package...
- 6
- 480
- 0
Báo cáo y học: "The role of a pseudocapsula in thymic epithelial tumors: outcome and correlation with established prognostic parameters. Results of a 20-year single centre retrospective analysis" pptx
... neoadjuvant chemotherapy or radiation alone, one patient received combined treatment, and in another patient an immunotherapy was performed Adjuvant radiation was executed in 26 cases, chemotherapy alone ... strong significance in the univariate analysis, it failed in the multivariate analysis due to its correlation with clinical Masaoka stage Masaoka stage has a stronger relevance than WHO classification ... Thymoma: results of 241 operated cases Ann Thorac Surg 199 1, 51(1):152-6 Okumura M, Ohta M, Tateyama H, Nakagawa K, Matsumura A, Maeda H, Tada H, Eimoto T, Matsuda H, Masaoka A: The World Health...
- 10
- 355
- 0
Báo cáo y học: "Soft-tissue perineurioma of the retroperitoneum in a 63-year-old man, computed tomography and magnetic resonance imaging findings: a case report" doc
... Hospital, 8-3-33, Kamiochiai, Chuo-ku, Saitama, Saitama, Japan Authors’ contributions MY conceived the study YK and RM performed the literature review AA and KK performed histopathologic and immunohistochemical ... by the Editor-in-Chief of this journal Author details Departments of Radiology, Saitama Red Cross Hospital, 8-3-33, Kamiochiai, Chuo-ku, Saitama, Saitama, Japan 2Department of Pathology Saitama ... immunohistochemical analyses All authors read and approved the final version of the manuscript Competing interests The authors declare that they have no competing interests Funding was neither sought nor obtained...
- 4
- 384
- 0
Báo cáo y học: "Soft-tissue perineurioma of the retroperitoneum in a 63-year-old man, computed tomography and magnetic resonance imaging findings: a case report." pps
... Hospital, 8-3-33, Kamiochiai, Chuo-ku, Saitama, Saitama, Japan Authors’ contributions MY conceived the study YK and RM performed the literature review AA and KK performed histopathologic and immunohistochemical ... by the Editor-in-Chief of this journal Author details Departments of Radiology, Saitama Red Cross Hospital, 8-3-33, Kamiochiai, Chuo-ku, Saitama, Saitama, Japan 2Department of Pathology Saitama ... immunohistochemical analyses All authors read and approved the final version of the manuscript Competing interests The authors declare that they have no competing interests Funding was neither sought nor obtained...
- 4
- 387
- 0
Báo cáo y học: "Over-expression of glutamine synthase in focal nodular hyperplasia (part 1): Early stages in the formation support the hypothesis of a focal hyper-arterialisation with venous (portal and hepatic) and biliary damage" pps
... clear that in early stages of FNH formation there are various features: a) at the border, there were abnormal portal tracts, which were more fibrotic, and there was also an absence of portal ... α-SMA staining In the rather faint GS-positive area, a small hepatic vein (black arrow) was identified on the right The vascular lumen was no longer observed on the left (blue arrow) No artery was ... lack of branches to various tributaries (portal, hepatic veins and ducts) This lack of branches may lead to conditions that are either primary (malformative focal arterial disease) or secondary...
- 28
- 230
- 0
Báo cáo y học: " Characterization of the yeast ionome: a genome-wide analysis of nutrient mineral and trace element homeostasis in Saccharomyces cerevisiae" ppsx
... additional data are available with the online version of this paper Additional data file is an Excel file summarizing the mutants analyzed Additional data file is an Excel file showing the effects ... along the vertical axis Increases greater than 2.5 standard deviations of the wild-type means are shown in red and decreases greater than 2.5 standard deviations are shown in green The bars at ... elementanalysis.Sacchalar samples.partsscoreanalyzedthethataccumulationthose≤-2.5 cells Ionome analysisfile yeastin thatfirst-pass that plasma-atomic romycesthethemetal for ≥2.5 2: z thisareare=inductively...
- 13
- 341
- 0
technical assistance in bridging the “digital divide” - a cost benefit analysis for broadband connectivity in europe - pwc_final_report
... operators have substantial capacity available at Ku-band and to a much lesser extent at C-band In addition, the major operators are incrementally introducing new capacity at Ka-band, specifically ... commercial WiFi, BFWA and satellite services, public sector financial support and other initiatives such as regional aggregation and awareness campaigns 2.3 Terrestrial broadband availability forecasts: ... countries have good broadband availability in urban areas, but face a challenge in rural areas The assumed availability by access speed for residential and SoHo users in urban and rural areas is shown...
- 142
- 504
- 0
Macromolecular architectures based on well defined poly(pentafluorostyrene) design, synthesis, characterization and applications
... et al., 199 8; Tauer et al., 199 5], anionic polymerization [Calderara et al., 199 3; Hirao et al., 199 8; Webster et al., 198 3], cationic polymerization [Charleux et al., 199 9; Faust, 199 9] and ... multifunctional initiators via ATRP [Davis et al., 2000] Comb-shaped and graft copolymers can also be prepared either by ATRP of macromonomers or by ATRP graft polymerization of monomers and macroinitiators ... find applications in nano-objects fabrication and biomedical areas There are two types of fluorinated monomers, fluorinated acrylate monomers, such as perfluoroalkyl (meth)acrylate and fluorinated...
- 190
- 516
- 0
THE STUDY OF a NOVEL MIXED LINEAGE LEUKEMIA 5 ISOFORM AND ITS ASSOCIATION WITH HUMAN PAPILLOMAVIRUS 16 18 RELATED HUMAN CERVICAL CANCERS
... Forward CCACCACAAAAGAAAAAGGTTTCTC Reverse GTGTTGGTAAAGGTAGGCTAGC MLL5β Forward GAAAACCCAGAGTGCCCTGTTCTA Reverse CAATATACGCGAGACTAGTCTT GAPDH Forward GTGAAGGTCGGAGTCAACG Reverse TGAGGTCAATGAAGGGGTC ... Primer Name Sequence (5’-3’) GP5+ TTTGTTACTGTGGTAGATACTAC GP6+ AAATAAACTGTAAATCATATTC MY09 CGTCCMARRGGAWACTGATC MY11 GCMCAGGGWCATAAYAATGG PC04 CAACTTCATCCACGTTCACC GH20 GAAGAGCCAAGGACAGGTAC M =A/ C, ... CGCGGATCCAATGGACTACAAAGACGATGAC GACAAGAGCATAGTGATCCCA MLL5β M5b_NotI.rev AAGGAAAAAAGCGGCCGCCAATATACGCGA GACTAGTCTT GFPMLL5β M5b_SalI.for ACGCGTCGACATGAGCATAGTGATCCCATTG M5b_BamHI.rev CGCGGATCCCAATATACGCGAGACTAGTCTT Primers...
- 140
- 396
- 0
A study on features of intensive relational process in english and their vietnamese equivalents
... traditional grammar and the approach to functional grammar It is considered that his study on Vietnamese grammar in the light of functional grammar is based on the theoretical orientation of systematic ... function, semantics and connection of two participants, and makes the structure of the relational process The relational process displays existence and has two relational participants The relation ... realization on functional grammar (FG), implications and applications of this field G Thompson (199 6:76-77) describes the theoretical and practical aspects of functional grammar model in an accessible...
- 99
- 471
- 1
Equilibrium potassium coverage and its effect on a Ni tar reforming catalyst in alkali and sulfurladen biomass gasification gases
... H2 S concentration measured, see Section 2.2.2 Values inside the parentheses are calculated absolute standard deviations inlet K and S concentrations on the catalyst are also plotted After a three ... / Applied Catalysis B: Environmental 190 (2016) 137 146 143 Table Average molar flow rates in Period and before and after the catalytic reactor Values inside the parentheses are calculated absolute ... realistic steady-state conditions on a typical tar (steam) reforming catalyst Aging of the catalyst resulted in stable BET and nickel surface areas Pre-sulfidation of the catalyst caused an isolation of...
- 10
- 355
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25