14 performing a join between tables in different databases
mysql cookbook 2nd edition
... operating system; use the GRANT statement instead 1.2 Creating a Database and a Sample Table Problem You want to create a database and set up tables within it Solution Use a CREATE DATABASE statement ... Data Handling Validating and Transforming Data Using Pattern Matching to Validate Data Using Patterns to Match Broad Content Types Using Patterns to Match Numeric Values Using Patterns to Match ... Transactional Storage Engine Performing Transactions Using SQL Performing Transactions from Within Programs Using Transactions in Perl Programs Using Transactions in Ruby Programs Using Transactions...
- 990
- 1,862
- 0
Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf
... S alboniger [6] They were accordingly named ataP3, ataP5, ataP4, ataP10 and ataP7 The two additional ones were named ata12 and ataPKS1 (Figs and 3) All shared a codon usage and a G+C content at ... are indicated by dotted lines Putative translation initiation and termination codons are in bold letters The start and direction of each ORF are indicated by horizontal arrows and named accordingly ... enzymatic assay [21] Preparation of 3¢-amino-3¢-deoxyadenosine 3¢-amino-3¢-deoxyadenosine was obtained from Helminthosporium sp ATCC20154 as described [30], except that starch was used instead...
- 9
- 728
- 0
Báo cáo khoa học: " Use of flow cytometry to develop and characterize a set of monoclonal antibodies specific for rabbit leukocyte differentiation molecules" ppsx
... MRB12 0A RACT1 4A RACT2 1A RACT3 0A MRB2 5A MRB2 9A MRB14 3A BAQ4 4A CADO3 4A RT1 9A MRB10 7A MRB10 2A RTH18 6A RH 1A LT8 6A RACT4 8A HUH7 3A RTH16 1A RT1 8A RT 3A CAM3 6A H2 0A HUH8 2A BAQ3 0A 25-32 BAG4 0A LT4 1A ISC1 8A ... BAQ4 4A CADO3 4A RACT4 8A HUH7 3A RTH16 1A RT1 8A RT 3A MRB12 8A CAM3 6A H2 0A HUH8 2A BAQ3 0A BAG4 0A LT4 1A ISC1 8A ISC3 9A ISC7 6A ISC 4A ISC2 4A ISC2 6A ISC3 6A ISC9 0A RT1 5A RTH3 3A RACT4 3A RACT4 4A RACT3 8A RT2 3A ... organs mAb H 1A H5 8A TH14B TH8 1A5 RTH 2A RTH23 0A RTH2 1A RT2 2A MRB6 1A RTH2 6A RTH6 5A RACT5 3A RTH 1A RTH19 2A ISC1 6A ISC2 7A ISC29E ISC3 8A RT 1A RACT1 9A RACT2 0A MRB12 0A RACT3 0A MRB2 5A MRB2 9A MRB14 3A RACT14A...
- 16
- 365
- 0
Báo cáo toán học: "MacMahon’s theorem for a set of permutations with given descent indices and right-maximal record" ppt
... (Idesi, r[max, v], scode) ∼ (Idesi, r[max, v], majcode) if yi = 1, i < n − Acknowledgments I am grateful to N Bakhytjan and A Jumadildayeva for assistance in making calculations, and to the anonymous ... l[min, v], l[min, i] and for the bi-statistics (f, majcode), (f, scode), counter-examples appear at n = Main Lemmas For a coding word α = α1 αn ∈ En , we say that i is a right-maximal index and ... Sin for all compositions I = (i1 , , ir ) [5] When A is an ordered alphabet, Sn (A) can be realized as the sum of all nondecreasing words in An The commutative image of Sym is the algebra...
- 14
- 415
- 0
báo cáo khoa học: " A set of EST-SNPs for map saturation and cultivar identification in melon" doc
... on transcribed regions has become a common application in plants because of the large number of ESTs available in databases, and EST-SNPs have been successfully mined from EST databases in non-model ... from the Near-East region such as elongated (chate and flexuosus) and Asiatic ananas and chandalak types; group 3, modern cantalupensis cultivars; group 4, mainly traditional varieties and wild ... seed bank donor (COMAV, Instituto de Conservación y Mejora de la Agrodiversidad Valenciana, Valencia, Spain; USDA/ARS/NCRPIS, North Central Regional Plant Introduction Station, Ames, IA, USA; IPK,...
- 9
- 341
- 0
báo cáo khoa học: " A set of multiplex panels of microsatellite markers for rapid molecular characterization of rice accessions" ppsx
... Savant, Waltham, MA, USA) and the DNA was extracted using a rapid CTAB method as described [39] DNA concentration was measured in 1% agarose gel after electrophoresis using λ DNA (Invitrogen®) as a ... genotyping of accessions with the three panels, as well as statistical analyses and drafting of the manuscript AB designed and optimized multiplex panels A and B, and assisted in drafting the manuscript ... below) had the main objective of avoiding contamination of accessions possessing a probable indica genetic background, what could interfere with the multiplex panel analysis Diversity analysis and...
- 10
- 245
- 0
Báo cáo sinh học: " Exact distribution of a pattern in a set of random sequences generated by a Markov source: applications to biological data" pdf
... 1.55 × 10-6 -10 GCGCGCGC RTAAAYAA* 18 391 11 6.52 × 10 14 7.70 × 10-12 1.65 × 10-9 1.68 × 10-12 WWWTTTGCTCR* 15 17 4.15 × 10-1 4.09 × 10-1 AAAAAAAAAAAAAAAAAAAAAAAA TAWWWWTAGM* YCCNYTNRRCCGN* GCGCNNNNNNGCGC ... obtain an optimal Markov chain embedding of any pattern problem through minimal Deterministic Finite Automata (DFA) In this paper, we first recall the technique of optimal Markov chain embedding ... “homogeneous”) of a selection of known TFs (marked with a star) as well as arbitrary candidate patterns Several known TFs appear to be highly significant (e.g., TF AAGAAAAA with a P-value of 1.31...
- 18
- 409
- 0
Báo cáo y học: "he discovery, positioning and verification of a set of transcription-associated motifs in vertebrates" pps
... 5'-CTCTGTCAAGAAAGTGATGCCGTGAAA-3' Antisense 5'-GAATGTTCAGAAGAGCAGCCGAGGGAT-3' Sense 5'-CCAGGCCACGTTGTTATTTTGCTTCCGC-3' Antisense Deletion 5'-AAAATAACAACGTGGCCTGGCCAGAGCC-3' starting from the best scoring ... CTCGCGAGA 14.6 4.13e-8 TTGGCT TATAAA 13.9 0.01 13.7 0.49 AAGATGGCGG TTTGTT 13.6 0.001 13.4 0.13 ATGCAAAT 13.3 1.0e-4 TAATTA 13.1 0.06 TTTAAG 13.1 0.5 CGCATGCG 13.1 1.1e-5 ATAAAT 12.6 0.02 TTTAAA ... statistical analysis was carried out using the Prism software (GraphPad, San Diego, CA, USA) with a two-grouping variables table with three replicates Mean and standard deviation were calculated using...
- 14
- 295
- 0
Developing a set of legally compliant intangible asset valuation criteria and an equation supported TEV (total enterprise value) valuation approach
... longer acceptable The prevailing, and inadequate, accounting and valuation approaches to valuing intangible assets leave too many questions unanswered Without an accurate intangible asset value, ... International Transfer Pricing: A Case Study 51 CHAPTER Current Trends: Harmonising International Accounting Standards and Improving Intangible Asset Valuation 89 CHAPTER The Law and Intangible Asset ... value’ approach to intangible asset valuation, and a fair value hierarchy that accommodates management representations and assumptions in the assertion and defence of valuations, in such standards...
- 410
- 279
- 0
In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)
... Long An, Tiền Giang, An -18- Giang, Kiên Giang, Cà Mau, Sóc Trăng, Bạc Liêu, Đồng Tháp, Bến Tre, Hậu Giang, Vónh Long, Trà Vinh thành phố Cần Thơ Vò trí đ a lí Nam Bộ: ph a bắc tây - bắc giáp Cam-pu-chia, ... ngữ Nam Bộ Như vậy, không gian đ a lí tiếng miền Nam, phương ngữ miền Nam hay phương ngữ Nam tác giả xác đònh rộng Không gian đ a lí phương ngữ Nam Bộ xác đònh hẹp Ranh giới PNNB trùng với ranh ... (từ thû ấy/ đến nay), thû (từ thû ấy/ đến giờ) V a rút gọn v a đảo trật tự câu nghi vấn tính chất, đặc điểm: bao cao (cao bao nhiêu), bao dai (dài bao nhiêu), bao lớn (lớn bao nhiêu)… Rút gọn,...
- 137
- 853
- 0
Tài liệu The Insider’s Guide to PR: Chapter 7 A GLOSSARY OF PR SPEAK doc
... example, you can promote a barcode printer in the printing media, packaging media and food retailing media • Viral campaign: a communications campaign which is designed to exploit the potential ... would tackle a given brief • Press Pack/Kit: a branded pack handed out to the media by an organisation It normally contains background material, photographs, illustrations and news releases • ... newsletters and intranets • Logo: A graphic or symbol owned by and representing a company or brand • Media Relations: communicating with the media by pro-actively speaking to journalists and sending...
- 2
- 490
- 0
Tài liệu Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 7) pptx
... laboratory company with a charge In Japan, many experts are available for analysis of toxic compounds; their results of analysis and maintenance of their analytical instruments are reliable The above ... by the Japan Information Network (Hiroshima) Trial for quality of analysis of drugs and poisons Actual training of analysis is essential rather than collecting informations on analytical methods ... the headlines of the “poisoning-talking salon” are being demonstrated in the top page of HP, which can be accessed without any password Databases (DBs) in wide areas of poisoning Various kinds...
- 7
- 379
- 0
A STUDY ON IMPROVING ENGLISH SPEAKING SKILLS TO 10TH FORM MINORITY STUDENTS AT GIA PHU HIGH SCHOOL IN THE NEW SET OF ENGLISH TEXTBOOK
... negotiated input: Maintain a high ratio of language use in relation to time spent talking about language; pair and small group problem-solving increases interaction and negotiation; Activities are ... relevant practice, • Set the reading task: make questions • Ask the learners to read the passage in silence and find the answers, • Ask learners to read again aloud and ask for the answer • Explain ... in tasks in which a speaker is having real difficulties in appreciating what a particular task required Martin Bygate (1997:24,25) suggested that conversation can be analyzed in term of routines,...
- 44
- 1,535
- 1
Đề tài " On the Julia set of a typical quadratic polynomial with a Siegel disk " ppt
... asymptotically universal bounds: n area(P0 An+2 ) n area(P0 n area(Pqn+1 An+2 ) n area(Pqn+1 area(Qn An+2 ) area(Qn An+2 ) An+2 ) An+2 ) n n area(P0 ∪ P0 ), n n area(Pqn+1 ∪ Pqn+1 ), area(Qn ∪ Qn ) 0 ... boundary of each puzzle piece P consists of a rectifiable arc in A( ∞) and a rectifiable arc in J(F ) The latter arc starts at an iterated preimage of β, follows along the boundaries of drops passing ... a constant which is asymptotically universal Similarly, bn , we say that an and bn are comparable up to a constant when an which is asymptotically universal Finally, let {an = an (x)} and {bn...
- 53
- 383
- 0
A Study of Elderly Living in Old Age Home and Within Family Set-up in Jammu pot
... This is leading to an increased danger of marginalization of the geriatric population due to migration, urbanization, and globalization Another impact of the globalization is the increasing economic ... 98 ARUNA DUBEY, SEEMA BHASIN, NEELIMA GUPTA ET AL CONCLUSION Old age had never been a problem for India where a value- based joint family system is supposed to prevail Indian culture is automatically ... of the human life span, but it is not so Awareness and acceptance of the fact that ageing has physiological, psychological and social determinants would make the ageing process acceptable, cheerful...
- 6
- 916
- 0
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx
... Primer location Amplified band (bp) P553 P554 P557 P558 GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG First pair GCCTTTGAGTCCATCACTAAC CCAGTGTCTTGGCAGGAATC ... of amplified message DNA ladder is marked M (A) HaCaT keratinocytes (lane 1); normal epidermal keratinocytes (lane 2); C1–4 squamous cell carcinoma (lane 3); dermal fibroblasts (lane 4); epidermal ... (lane 2) or black (lane 3) patients; melanoma WM35 (lane 4); normal epidermal keratinocytes (lane 5); HaCaT keratinocytes (lane 6); C1–4 squamous cell carcinoma (lane 7); dermal fibroblasts (lane...
- 11
- 475
- 0
NUPOS: A part of speech tag set for written English from Chaucer to the present ppt
... CLAWS in this regard, largely because digitally assisted analysis increasingly makes use of syntactic fragments created by tag sequences, and in particular by tag trigrams If you have any interest ... to account separately for its components As said above, combinations of an auxiliary or modal verb with a negative can be expressed in a single tag as the negative form of that verb Combinations ... superlative determiner as adverb most often 931.7 NUPOS, page 17 av-jn negative determiner as adverb adjective as adverb adjective as adverb (un) comparative adjective as adverb adj/noun as adverb...
- 25
- 516
- 0
Báo cáo khoa học: and protein bilinear indices – novel bio-macromolecular descriptors for protein research: I. Predicting protein stability effects of a complete set of alanine substitutions in the Arc repressor ppt
... ị x y Lẳ1 In addition, the amino acid-type bilinear indices can also be calculated Amino acid and amino acid-type bilinear indices are specic cases of local protein bilinear indices In this sense, ... 60 40 acid type in the protein In the amino acid-type bilinear indices formalism, each amino acid in the molecule is classied into an amino acid-type (fragment), such as apolar, polar uncharged, ... regression analysis This dataset was randomly divided into two subsets: one containing 39 mutants, which was used as a training set, and the other containing nine mutants (ve having near wild-type stability...
- 29
- 406
- 0
Giáo trình thực hành BCMSN Chương 7 – Planning for Implementation of Voice in a Campus
... Planning for Implementation of Voice in a Campus Cấu hình interface trunk SW3560_01 SW3560_01(config)#interface range gigabitEthernet 0/1 - SW3560_01(config-if-range)#switchport trunk encapsulation ... (config-line)# login SW3560_01 (config)#line vty SW3560_01 (config-line)# password cisco SW3560_01 (config-line)# login Bước 2: Cấu hình trunk cho interface Fa0/1 Fa0/2 switch Cấu hình interface trunk ... (config-vlan)#vlan 40 SW2950_01 (config-vlan)#name VLAN40 SW2950_01 (config-vlan)#end Cấu hình VLAN SW2950_02 SW2950_02 (config-vlan)#name VLAN20 SW2950_02 (config-vlan)#vlan 40 SW2950_02 (config-vlan)#name...
- 12
- 457
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng 9 tr 25