0

12 1000ths of an inch for burns in a young patient and in an elderly patient using the same technique and equipment several weeks later the young patient is doing well but the elderly patient has blisters fo

Tài liệu Physical health and functional ability of an elderly, population in Sri, Lanka doc

Tài liệu Physical health and functional ability of an elderly, population in Sri, Lanka doc

Sức khỏe người cao tuổi

... to injury or an illness Best performance was in "standing from chair without using arms" (84%), semi tandem stand was completed by 78% and full tandem stand by 72% The poorest performance was in ... East Asian Regional Office (WHO/SEARO), New Delhi on "Health and Social Aspects of the Elderly" We are grateful for the financial assistance provided by the WHO/SEARO and the technical assistance ... selected from the electoral wards in the urban areas and from the Grama Niladhari divisions (smallest administrative units) in the rural areas Using the electoral register for each of the clusters,...
  • 8
  • 462
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " The 3'''' sequences required for incorporation of an engineered ssRNA into the Reovirus genome" pot

Điện - Điện tử

... 250 ACG GAU CCG AGA UUU 200 150 CUA CGC CUG AAU AAG UGA UAA UAAGCGGAUGAAUGGCAGAAAUUCGGAUCCAAGAUCUCGAGACGCGAUGGUGUCAUGACCCAAGCUCAGCAGAAUCAAGUUGAAGCGUUGGCAGAUCAGACUCAACAGUUUAAGAGGACAAG CUCGAAACGUGGGCGAGAGAAGACGAUCAAUAUAAUCAGGCUCAUCCCAACUCCACAAUGUUCCGUACGAAACCAUUUACGAAUGCGCAAU ... CUCGAAACGUGGGCGAGAGAAGACGAUCAAUAUAAUCAGGCUCAUCCCAACUCCACAAUGUUCCGUACGAAACCAUUUACGAAUGCGCAAU 3’ G G G G GAGGGAAUCGGAUGGCUUCAUCGGGUCCAGCCUGGCGCUCCUCCACCUCUACGGUACGGCUGGG CUACUUACACACCAGUCAGCACUCCACACACCCCCCUGGGGGAGUGAGGUUCUGCUAGUCUAUUCCCGACGUUAGCGCCGUGAUCAGCGGGGGCAUAAU ... ssRNA, dsRNA and CAT dsRNA panels are Northerns analyzing RNA extracted from cells lipofected 12 hours earlier with wildtype ssRNAs and the ssRNA obtained following transcription of the indicated...
  • 11
  • 455
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article TSI Finders for Estimation of the Location of an Interference Source Using an Ariborne Array" docx

Báo cáo khoa học

... direction of arrival of the offending source Under this assumption, in Sections and we introduce the TSI finder in the lag and angle domains and analyse them in detail Section introduces the necessary formulas ... radar parameters in order to achieve a desired performance level The technique uses any one of the TSI rays to identify its angle of arrival in azimuth plane as well as in elevation plane and then ... This approach optimizes the power output of the array subject to a linear constraint and is applicable to arbitrary array geometries and achieves signal to noise gain of N at the output, using...
  • 17
  • 278
  • 0
LISTS OF ACCEPTABLE POLYMERS FOR USE IN FOOD PACKAGING APPLICATIONS ppsx

LISTS OF ACCEPTABLE POLYMERS FOR USE IN FOOD PACKAGING APPLICATIONS ppsx

Điện - Điện tử

... cars and airplanes are made from polystyrene, and it also is made in the form of foam packaging and insulation (Styrofoam TM is one brand of Food Packaging Materials 13 polystyrene foam) Clear ... we call it a cis- amide The same amide molecule can twist back and forth between the cis- and transconformations, given a little bit of energy The same cis- and trans- conformations exist in polyamides, ... containers Other applications include strapping and both food and non-food containers Cleaned, recycled PET flakes and pellets are in great demand for spinning fiber for carpet yarns, producing...
  • 37
  • 714
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Relative biological effectiveness of fast neutrons for apoptosis in mouse hair follicles" potx

Báo cáo khoa học

... cytoplasm and nuclear chromatin A and B; H&E staining, C and D; TUNEL staining, ×400 RBE of fast neutrons for apoptosis in hair follicles 337 whole apoptotic bodies showing peroxidase staining In ... studies of the parameters related to the dose-response relationships for radiation-induced damage [19,24,30] The data obtained in this study indicate that there is a quantitative change in apoptotic ... nuclear disintegration, a decrease in nuclear size, a reduction of the cell volume, and an increase in cell density in the hair follicles The location of the target cells against radiation-induced...
  • 6
  • 278
  • 0
Báo cáo y học:

Báo cáo y học: "Organizational readiness to change assessment (ORCA): Development of an instrument based on the Promoting Action on Research in Health Services (PARIHS) framework" pps

Báo cáo khoa học

... data in two of the three QI projects, and advised on the analyses, interpreted findings and helped draft the manuscript All authors read and approved the final manuscript Additional material Additional ... tion; quality management; information and analysis; quality results; employee quality training; employee quality and planning involvement The latter includes six scales: satisfaction, information, ... function of the organization, and is therefore a constant whereas the external facilitation can be designed or developed according to the needs of the organization Assessing the organization or team's...
  • 13
  • 428
  • 0
báo cáo khoa học:

báo cáo khoa học: " A quasi-experimental test of an intervention to increase the use of thiazide-based treatment regimens for people with hypertension" docx

Báo cáo khoa học

... Review and present literature on effectiveness of "academic detailing" to change physician behavior Patient and Administrator Liaison Team Provide informational materials to patients and answer their ... Assess and establish data quality Review and format GMS and PC data on study outcomes ies of the ALLHAT main results publication, several lectures on ALLHAT's findings, and the introduction of an ... during any academic year, staff assistants, and roughly 6,000 adult patients Target panel sizes ranged from 25 patients for interns, 50 for residents, and 100–250 for staff physicians During the...
  • 13
  • 344
  • 0
Báo cáo y học:

Báo cáo y học: "Unusual presentation of cactus spines in the flank of an elderly man: a case report" pdf

Báo cáo khoa học

... analyzed and interpreted the patient data regarding the foreign body of the skin The manuscript was written by AS and critically evaluated by SF, LP, and RD All authors read and approved the final manuscript ... splinters can result in patient harm and malpractice Consent Written informed consent was obtained from the patient for publication of this case report and any accompanying images A copy of the ... perforating collagenosis, and acquired perforating dermatosis) Microscopic analysis revealed the presence of a foreign body (Figure 2) and a surrounding inflammatory infiltrate (Figure 3) The foreign...
  • 4
  • 327
  • 0
Báo cáo y học:

Báo cáo y học: " Profile of subjective quality of life and its correlates in a nation-wide sample of high school students in an Arab setting using the WHOQOL-Bref" pot

Báo cáo khoa học

... Ministry of Education authorized and facilitated the study The following played invaluable roles in data collection: Zaina Al-Zabin, Nahed Kamel, Abdel W Awadalla, and Sumai (and Ministry of Education ... boards of the Kuwait Ministry of Education and the Kuwait Society for the Advancement of Arab Children (KSAAC) Thereafter, the Principal of each selected school was approached for approval and ... 84:308-315 Amiri P, Ardekani ME, Jalali-Farahani S, Hosseinpanah F, Varni JW, Ghofranipour F, Montazeri A, Azizi F: Reliability and validity of the Iranian version of the Pediatric Quality of Life Inventory...
  • 12
  • 500
  • 0
Báo cáo y học:

Báo cáo y học: "Successful resuscitation of an elderly man with deep accidental hypothermia using portable extracorporeal circulation in the emergency department: a case report" pps

Báo cáo khoa học

... oxygen, and warming blankets The decision was made for extracorporeal rewarming and resuscitation 0845 – 0900 Patient was heparinized, CPS unit was assembled and primed, and arterial and venous cannulas ... machine is a modality that originated in the late 1980s, primarily for use in the cardiac catheterization laboratory for assisted angioplasty and resuscitation [9] This became possible after the ... was written by JAC All authors read and approved the final manuscript Consent Written informed consent was obtained from the patient' s next -of- kin for publication of this case report and any accompanying...
  • 5
  • 308
  • 0
design, synthesis, and characterization of polymeric materials for uses in energy storage applications

design, synthesis, and characterization of polymeric materials for uses in energy storage applications

Tiến sĩ

... synthetic polymers are copolymers presented in various monomer sequences such as those shown in Figure 1-2 6 Homopolymer AAAAAAAAAAAAAAAA Random AABABBABAABABBA Alternating ABABABABABABABAB Graft ... Various copolymer architectures (A, B = monomer units) BBBBB BBBBB AAAAAAAAAAAAAAA BBBBB AAAAAAAABBBBBBBB A random copolymer is a single polymer chain, which contains two monomers that are in ... Maher Chapter has been adapted for publication in Macromolecules and was coauthored by H.R Allcock and D .A Stone Chapter has been adapted for publication in Chemistry of Materials and was coauthored...
  • 229
  • 608
  • 0
DEVELOPMENT OF PROBIOTIC PRODUCTS FOR USAGE IN SHRIMP FARMING

DEVELOPMENT OF PROBIOTIC PRODUCTS FOR USAGE IN SHRIMP FARMING

Tư liệu khác

... selection of bacterial species of the genus Lactobacillus and the genus Bacillus capable of inhibiting the bacteria in the prawn, and active support for the digestive enzyme strength -Try active antagonists ... strains of bacteria after drying in a certain rate, with nature and bring some prebiotics (MOS, FOS ) -Check the density of microbial cells reached 109/g preparations - Packaging and storage disease ... resistance effectiveness of shrimp in experimental of the 120 days of age shrimp increased by 13% compared to Process Strain of Lactobacillus Strain of Bacillus Cultivation Cultivation Cultivation...
  • 2
  • 241
  • 0
Development and validation of analytical method for naftopidil in human plasma by LC–MSMS

Development and validation of analytical method for naftopidil in human plasma by LC–MSMS

Hóa học - Dầu khí

... ng/mL range Acknowledgments The authors are mostly thankful to Erregierre Pharmaceuticals and Cadila Health Care Ltd for providing valuable drugs and standards and also thankful to the principal, ... different analytical runs (Tables and 3) 3.5 Recovery The recovery of naftopidil was calculated by comparing the peak area of the analyte from the extracted plasma standard with that obtained from an ... kept in the autosampler for 25 h was also assessed The results indicate that solutions of naftopidil and IS can remain in the autosampler for at least 25 h, without showing a significant loss in the...
  • 7
  • 537
  • 0
fluence of au nanoparticles on the properties of tio2 film for use in DSSC

fluence of au nanoparticles on the properties of tio2 film for use in DSSC

Cao đẳng - Đại học

... octahedral chains The distortion of the octahedron in rutile is less than in anatase The Ti-Ti distances in anatase are greater (3.04 and 3.79Å) than in rutile (2.96 and 3.57 Å), where as the ... get a comparable intensity of incident light, as this varies with location on the earth and the mass of the air (e.g height above sea level) Therefore, it is necessary to have a standard for the ... resistance, Rox is the leakage resistance of the composite, Rct is the charge transfer resistance, Cox the capacitance of the composite and Cdl is the capacitance of double layer 116...
  • 170
  • 247
  • 0
The predictive value of physical fitness for falls in older adults with intellectual disabilities

The predictive value of physical fitness for falls in older adults with intellectual disabilities

Tổng hợp

... Participants had to stand upright and sit down again as often as possible in 30 s without using their hands The total number of complete stances was the result of the test Validity and reliability ... organizations Informed consent was obtained from all participants or their legal representatives for both baseline and follow-up measurements; however, unusual resistance was a reason for aborting ... Baseline characteristics and falls Of the 1050 participants in the HA-ID study follow-up fall data were available from 724 participants Of these participants, 25.5% (185 participants) fell at...
  • 9
  • 331
  • 0
Apprenticeships in York - a presentation developed as part of an IAG package raising the profile of the apprenticeship pathway

Apprenticeships in York - a presentation developed as part of an IAG package raising the profile of the apprenticeship pathway

Mẫu Slide - Template

... Training Centre These are the main Training Providers but there are many more, including those who offer more specialised Apprenticeships such as Askham Bryan College For more information on Apprenticeships: ... Mechanical Engineering Technician • Health & Social Care leading to Community Outreach Worker • Rail Transport Engineering…leading to.… Rail Engineering Technician • Retail leading to Purchasing Manager ... 2 012 2 012 Apprenticeships - an Overview • It takes a year as a minimum • A mixture of on and off the job training working for an employer • Work with a mentor • May include day release to a local...
  • 29
  • 163
  • 0

Xem thêm