1046 amp 8211 256 b c and the spring and autumn period 770 amp 8211 476 b c
Báo cáo khoa học: Detection and characterization of a novel extracellular fungal enzyme that catalyzes the specific and hydrolytic cleavage of lignin guaiacylglycerol b-aryl ether linkages pdf
... source of carbon Cell growth and the production of the b- aryl ether cleavage enzyme We cultured 2BW-1 in stationary test tubes at 28 C To observe the expression of b- aryl ether cleavage activity, ... addition, the enzyme also cleaved the b- aryl ether bond in GOG to produce GG and guaiacol (Fig 6) To clarify the substrate specificity of the b- aryl ether cleavage enzyme, we synthesized the substrates ... Substrate specify of the b- aryl ether cleavage activity of 2BW-1 Structure I, guaiacylglycerol b- O-4-methylumbelliferone; II, guaiacylglycerol; III, O-benzyl-guaiacylglycerol b- O-4-methylumbelliferone;...
- 10
- 670
- 0
Báo cáo khoa học: Expression and characterization of soluble forms of the extracellular domains of the b, c and e subunits of the human muscle acetylcholine receptor pot
... between one a subunit and the c ⁄ e subunits and the other between the second a subunit and the d subunit [4] The c ⁄ e and d subunits play a major role in shaping the ligand-binding sites and also ... that the acetylcholine-binding proteins and the b ECD have similar structures and that the secondary structures of a non-a ECD (b) and the a ECD resemble one another, being largely composed of b- structure ... CTTACTTCCGGCGGATGATGAGCGAG-3¢ for e1–219, (b) 5¢-ATAGTTTAGCGGCCGCTTAGTGATGGTGATG GTGATGCTTCCGGCGGATGATGAGCGAG-3¢ for e1– 219HIS, (c) 5¢-ATAGTTTAGCGGCCGCTTACGGCTT CCGGCGGATGATGAGCGAG-3¢ for e1–220,...
- 12
- 394
- 0
The 10 Most Significant Differences between C# and C++
... private CheckBook checkBook; public Account() { balance = 0.0; numChecksProcessed = 0; checkBook = new CheckBook(); } } Why can’t I just initialize the data members directly and let the language ... WriteLine() command, as function call, 74, 160 writing code, CD115–CD119 collection class, CD61–CD71 constant, CD6 forms code, CD175–CD179 generic code, 348–349 generic collections, 340–341 graphical ... 254–257 BankAccount program, 222–224 BankAccount ConstructorsAnd Function program, 245–247 BankAccount ConstructorsAndThis program, 247–248 BankAccountWith Multiple Constructors program, 243–245 base...
- 35
- 471
- 0
DSP applications using C and the TMS320C6X DSK (P3)
... ASM function called from C to find factorial ref _factclasmfunc: cproc reg mv mv sub loop: [b] _factclasmfunc number a ,b number ,b number,a b, 1 ,b mpy a ,b, a sub b, 1 ,b b loop return a endproc ;Linear ... a counter B0 and performs a conditional (based on B0 ) branch to LOOP The branch decision is before the decrement; with the branch decision based on a negative number (not on whether the number ... into the 16 MSBs of B2 The MVC (move constant) instruction is the only instruction that can access the AMR and the other control registers (shown in Appendix B) and executes only on the B side...
- 41
- 573
- 1
DSP applications using C and the TMS320C6X DSK (P4)
... passbands, using the coefcient le pass 2b. cof This lter was designed with MATLAB Figure 4.1 6b shows the frequency response of the comb lter, using the coefcients le comb14.cof These plots were obtained ... (FIRcirc) The C program FIRcirc .c (Figure 4.33) calls the ASM function FIRcircfunc.asm (Figure 4.34), which implements an FIR lter using a circular buffer This example expands Example 4.13 The coefcients ... SUB A6 ,B4 ,B4 B4 ,1 ,B4 ;since coeff buffer data as bytes ;B4 =bottom coeff array h[N-1] MVKL MVKH 0x00070040 ,B6 ;select A7 as pointer and BK0 0x00070040 ,B6 ;BK0 for 256 < /b> bytes (128 shorts) MVC B6 ,AMR...
- 57
- 478
- 1
DSP applications using C and the TMS320C6X DSK (P5)
... stages The coefficient file contains the numerator coefficients, a’s (three per stage), and the denominator coefficients, b s (two per stage) The a’s and b s used in this book correspond to the b s and ... for the other stages, the input x(n) is the output y(n) of the preceding stage The coefficients b[ i][0] and b[ i][1] correspond to b1 and b2 , respectively; where i represents each stage The delays ... (5.30) In the case of bandpass and bandstop filters with lower and upper cutoff frequencies wD1 and wD2, the two analog frequencies wA1 and wA2 need to be solved The exercises in Appendix E further...
- 23
- 479
- 0
DSP applications using C and the TMS320C6X DSK (P6)
... 2-kHz bandpass filter The filter coefficients are the same as BP55.cof, with a center frequency at Fs/4, introduced in Example 4.4 The coefficient file coeffs.h also contains a set of coefficients ... that the low- and high-frequency components are accentuated while the midrange frequency components are attenuated This is because the filter coefficients are scaled in the program by bass_gain and ... interrupt occurs On each interrupt, an output value from a buffer (iobuffer) is sent to the codec’s DAC and an input value is acquired and stored into the same buffer An index (buffercount) to this buffer...
- 34
- 473
- 0
DSP applications using C and the TMS320C6X DSK (P7)
... result, the samples of the interference are highly correlated On the other hand, the samples of the wideband signal are relatively uncorrelated The characteristics of the narrowband interference permits ... convergence can be observed by increasing beta by 10 The wideband signal desired can be observed by outputting wb_signal (in lieu of E) Furthermore, the wideband signal with additive interference can be ... in the adaptive process Example 7.1: Adaptive Filter Using C Code Compiled with Borland C/ C+ + (Adaptc) This example applies the LMS algorithm using a C- coded program compiled with Borland C/ C++...
- 23
- 428
- 0
Tài liệu DSP applications using C and the TMS320C6X DSK (P8) ppt
... since branching occurs in cycle 9, after the ADD instruction SUB instruction must start one cycle before the branch instruction, since the loop count is decremented before branching occurs Therefore, ... accum B7 ;64-bit data in A2 and A3 ;64-bit data in B2 and B3 *A4++,A3:A2 *B4 ++ ,B3 :B2 ;64-bit data in A2 and A3 ;64-bit data in B2 and B3 *A4++,A3:A2 *B4 ++ ,B3 :B2 ;64-bit data in A2 and A3 ;64-bit ... and B3 ;decrement count ;branch to LOOP *A4++,A3:A2 *B4 ++ ,B3 :B2 A1,1,A1 LOOP A2 ,B2 ,A6 B3 ,A3 ,B6 ;64-bit data in A2 and A3 ;64-bit data in B2 and B3 ;decrement count ;branch to LOOP ;lower 32-bit...
- 21
- 462
- 0
Tài liệu DSP applications using C and the TMS320C6X DSK (P9) doc
... the loop filter and the DCO, and time stamps CCS buffers these data so that the data can be accessed by other applications on the PC host CCS has an interface that allows PC applications to access ... Proceedings of the 1998 ASEE Annual Conference, 1998 14 R Chassaing and B Bitler (contributors), Signal processing chips and applications, The Electrical Engineering Handbook, CRC Press, Boca Raton, ... approach The multirate filter is discussed and implemented using C3 x /C4 x- and C2 x /C5 x-compatible code [37–44] Possible applications include a graphic equalizer, a controlled noise source, and background...
- 16
- 500
- 0
Tài liệu DSP applications using C and the TMS320C6X DSK (P1) ppt
... -33,000 (beyond the acceptable range by the codec) Two sliders can readily be used, one to change the amplitude and the other to change the frequency A different frequency can be generated by changing ... whereas the C6 2xx and C6 4xx belong to the family of the C6 x fixed-point processors The C6 711 is capable of both fixed- and floating- Code Composer Studio point processing The architecture and instruction ... installed CCS Verify that the linker command (.cmd) file, the project (.pjt) file, the library (.lib) file, the two C source ( .c) files, and the assembly (.asm) file have been added to the project The GEL...
- 32
- 473
- 1
Tài liệu DSP applications using C and the TMS320C6X DSK (P2) pptx
... processor The maximum level of the input signal to be converted is determined by the speci c ADC circuitry on the codec, which is V p-p with the onboard codec After the captured signal is processed, the ... at the frequency of the carrier signal + or - the frequency of the sideband signal, or at 1600 and 2400 Hz Load the GEL file AM.gel, increase the variable amp,< /b> and verify the baseband signal being ... “services” the necessary task dictated by ISR, then returns to the calling function waiting for the occurrence of a subsequent interrupt Within the function output_sample, the least signigficant bit...
- 28
- 369
- 0
Tài liệu Báo cáo khoa học: Structural and functional specificities of PDGF-C and PDGF-D, the novel members of the platelet-derived growth factors family docx
... proteolytic removal of the CUB domains and thereby activation of the growth factor domains PDGF -C and -D contain both the CUB and growth factor domains when they are secreted and proteolytic cleavage ... 2005 FEBS 5729 PDGF -C and -D, structure and function L J Reigstad et al PDGF-CC specifically interacts with PDGFR-aa and -ab, but not with -bb, and thereby resembles PDGFAB [8,41] PDGF-DD binds ... PDGF -C in the hearts after infection with coxsackievirus B3 (CVB3), but not in hearts of immunocompetent mice infected with CVB3 [67,109] In the immunodeficient mice, the CVB3 infection led to chronic...
- 19
- 557
- 0
Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx
... such as butylhydroxyl anisol (BHA) and ascorbic acid (AsA) on the enhancing effect of TS on LPS/IFN-induced NO production Unexpectedly, neither BHA nor AsA affected the TS-enhanced NO production ... has an amphiphilic structure of the polar carboxyl moiety and the hydrophobic isoprene moiety The enhancing effect of TS on LPS/IFN-induced NO production was inhibited by the coexistence of a-T, ... Packer, L (1993) Inhibition of NF-jB DNA binding activity by a-tocopheryl succinate Biochem Mol Biol Int 31, 693–700 22 Erl, W., Weber, C. , Wardemann, C & Weber, P .C (1997) a-Tocopheryl succinate...
- 6
- 494
- 0
Tài liệu Báo cáo Y học: Mutations in the docking site for cytochrome c on the Paracoccus heme aa3 oxidase Electron entry and kinetic phases of the reaction pptx
... the docked complex by a complete, systematic search J Biol Chem 274, 38051–38060 Michel, B & Bosshard, H.R (1984) Spectroscopic analysis of the interaction beween cytochrome c and cytochrome c oxidase ... of cytochrome c oxidase reveals two acidic residues involved in the binding of cytochrome c Biochim Biophys Acta 1230, 74–76 19 Ludwig, B (1986) Cytochrome c oxidase from Paracoccus denitrificans ... Hoganson, C. W., Babcock, G.T & Ferguson-Miller, S (1999) Definition of the interaction domain for cytochrome c on cytochrome c oxidase I Biochemical, spectral, and kinetic characterization of surface...
- 9
- 457
- 1
Báo cáo khoa học: Insights into substrate and product traffic in the Drosophila melanogaster acetylcholinesterase active site gorge by enlarging a back channel ppt
... Back channel of Drosophila acetylcholinesterase F Nachon et al A B Fig View of the back door region from the outside of DmAChE (residues and labels in green) and Torpedo californica acetylcholinesterase ... 000 ATCh (µM) Fig Activity of the wild-type (W) and mutated DmAChEs (Y, E, A) at different acetylthiocholine concentrations (pS curves) Theoretical curves were calculated according to the Scheme ... JP, Ravallec M, Devauchelle G & Cerutti M (1994) Biochemical characterization of Drosophila melanogaster acetylcholinesterase expressed by recombinant baculoviruses Biochem Biophys Res Commun 203,...
- 6
- 524
- 0
Báo cáo khoa học: Halogenated benzimidazoles and benzotriazoles as inhibitors of the NTPase/helicase activities of hepatitis C and related viruses ppt
... ATGGCGCCATTTTTCTTGAGACATGCC-3¢; reverse, 5¢-CTGGGATCCGTCCGAATCAGGTTCCTTC-3¢ (purchased from Sigma), and the pKK plasmid as a template [32] The resulting fragment was cloned into NcoI and BamHI sites of the ... Fig 3C The two most effective inhibitors of the HCV helicase activity, DRBT and TBBT (Table 1) differ significantly in their mechanisms of action Inhibition by DRBT was dramatically increased ... crystal structure of the complex of the catalytic subunit of Zea mays CK2 with TBBT [43], the latter is located in the CK2 active site normally occupied by the purine moieties of the natural substrates...
- 9
- 659
- 0
Báo cáo Y học: Identification of residues in the PXR ligand binding domain critical for species specific and constitutive activation docx
... designed: 5¢-TGAGATGTGCCAGCTGAGGTTCA-3¢ for I282Q (forward), 5¢-CAACGCCCAGCATACCCAGCAGT-3¢ for Q404H (forward), 5¢-CAACGCCCAGGCAACCCAG CAGT-3¢ for Q404A (forward), 5¢-TGAACCTCAGCT GGCACATCTA-3¢ for I282Q ... 5¢-TCGAGCTGTGTATACTGAGATTCA-3¢ for Q285I, 5¢-TCAATGCTCAGCAGACCCAGCGGC-3¢ for H407Q, 5¢-TCAATGCTCAGGCCACCCAGCG GC-3¢ for H407A The selection restriction site mutation was created by primer 5¢-GTAGCTGACTGGAGCATG ... na614 5¢-CTGCTTACTGGCTTATCGAA-3¢ (forward) and na1106 5¢-GGGTCAAGGAAGGCACGG-3¢ (reverse) The mutants were subcloned into the pCDNA3 vector (Invitrogen) General plasmid constructs The CYP3A4 luciferase...
- 9
- 552
- 0
Báo cáo khoa học: Isolation and characterization of an IgNAR variable domain specific for the human mitochondrial translocase receptor Tom70 potx
... Library construction 6980 (‹) CDR3 Library construction 7210 (‹) (fi) (fi) (fi) (‹) (‹) (‹) 7211 (‹) GTCTCGCGGCCCAGCCGGCCATGGCCGCAAGGGTGGACCAAACACC GTCTCGCGGCCCAGCCGGCCATGGCCGCATGGGTAGACCAAACACC CACGTTATCTGCGGCCGCTTTCACGGTTAATGCGGTGCC ... CACGTTATCTGCGGCCGCTTTCACGGTTAATGCGGTGCC CACGTTATCTGCGGCCGCTTTCACGGTTAATACGGTGCCAGCTCC GGTTAATACGGTGCCAGCTCCCYYMNNMNNMNNMNNMNNRYHRYH RYHRYHMNNMNNMNNMNNMNNMNNTGCTCCACACTTATACGTGCCACTG TTTCACGGTTAATACGGTGCCAGCTCCTTTCTCMNNMNNMNNMNNRYHR ... 5¢-TTTCACGGTTAA TGCGGTGCCAGCTCCCCAACTGTAATAAATACC AGACAAATTATATGCTCCaacCCTATACGTGCCA CTG-3¢); followed by secondary PCR using VNAR terminal oligonucleotide primers [17] to complete the framework and...
- 12
- 522
- 0
DISTRIBUTION AND PACKAGING OF STUDENT FINANCI AIDI,: SOMEr EVIDEN~C FROM THE SURVEY 0F THE HIGH SCHOOL CLASS.OF 1972 potx
... procedures, and instructions The difference between a statistic estimated from a sample and its corresponding census value is due to chance Sampling or chance variation is measured by the standard ... 55.3 percent of Federal aid over and above that expected by their representation in the population For 2-year public institutions and vocational schools, the exact opposite occurs; they receive ... in other nations.Th Center shall collect, collate, and, from time to time, report full and: coam plete statistics on the conditions of education in the United States; conduct, and~ ~ publish...
- 11
- 245
- 0
Tìm thêm: khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008