Báo cáo khoa học: Expression and characterization of soluble forms of the extracellular domains of the b, c and e subunits of the human muscle acetylcholine receptor pot

Expression and characterization of soluble forms of the extracellular domains of the b, c and e subunits of the human muscle acetylcholine receptor Kalliopi Kostelidou 1 , Nikolaos Trakas 1 , Marios Zouridakis 1,2 , Kalliopi Bitzopoulou 1,2 , Alexandros Sotiriadis 1 , Ira Gavra 1,2 and Socrates J. Tzartos 1,2 1 Department of Biochemistry, Hellenic Pasteur Institute, Athens, Greece 2 Department of Pharmacy, University of Patras, Greece The nicotinic acetylcholine receptor (AChR) is a mem- ber of the superfamily of ligand-gated ion channels, which also includes the glycine, c-aminobutyric acid A, and 5-HT 3 receptors [1]. Its physiological role is to mediate the fast chemical transmission of electrical signals in response to acetylcholine released from the nerve terminal to the end-plate. The muscle AChR is a transmembrane glycoprotein ( 290 kDa) located on the postsynaptic membrane of the neuromuscular junction and is composed of five Keywords acetylcholine receptor; extracellular domain; myasthenia gravis; protein expression Correspondence S. J. Tzartos, Department of Biochemistry, Hellenic Pasteur Institute, GR11521 Athens, Greece Fax: +30 210 6478842 Tel: +30 210 6478844 or +30 2610 969955 E-mail: tzartos@mail.pasteur.gr, tzartos@upatras.gr (Received 29 March 2006, revised 25 May 2006, accepted 7 June 2006) doi:10.1111/j.1742-4658.2006.05363.x The nicotinic acetylcholine receptor (AChR) is a ligand-gated ion channel found in muscles and neurons. Muscle AChR, formed by five homologous subunits (a 2 bcd or a 2 bce), is the major antigen in the autoimmune disease, myasthenia gravis (MG), in which pathogenic autoantibodies bind to, and inactivate, the AChR. The extracellular domain (ECD) of the human mus- cle a subunit has been heterologously expressed and extensively studied. Our aim was to obtain satisfactory amounts of the ECDs of the non-a sub- units of human muscle AChR for use as starting material for the determin- ation of the 3D structure of the receptor ECDs and for the characterization of the specificities of antibodies in sera from patients with MG. We expressed the N-terminal ECDs of the b (amino acids 1–221; b1–221), c (amino acids 1–218; c1–218), and e (amino acids 1–219; e1–219) subunits of human muscle AChR in the yeast, Pichia pastoris. b1–221 was expressed at  2mgÆL )1 culture, whereas c1–218 and e1–219 were expressed at 0.3– 0.8 mgÆL )1 culture. All three recombinant polypeptides were glycosylated and soluble; b1–221 was mainly in an apparently dimeric form, whereas c1–218 and e1–219 formed soluble oligomers. CD studies of b1–221 sugges- ted that it has considerable b -sheet secondary structure with a proportion of a-helix. Conformation-dependent mAbs against the ECDs of the b or c subunits specifically recognized b1–221 or c1–218, respectively, and poly- clonal rabbit antiserum raised against purified b1–221 bound to 125 I-labeled a-bungarotoxin-labeled human AChR. Moreover, immobilization of each ECD on Sepharose beads and incubation of the ECD–Sepharose matrices with MG sera caused a significant reduction in the concentrations of auto- antibodies in the sera, showing specific binding to the recombinant ECDs. These results suggest that the expressed proteins present some near-native conformational features and are thus suitable for our purposes. Abbreviations AChR, nicotinic acetylcholine receptor; ECD, extracellular domain; MG, myasthenia gravis; b1–221, amino acids 1–221 of the human AChR b subunit; c1–218, amino acids 1–218 of the human AChR c subunit; e1–219, amino acids 1–219 of the human AChR e subunit. FEBS Journal 273 (2006) 3557–3568 ª 2006 The Authors Journal compilation ª 2006 FEBS 3557 homologous subunits in the stoichiometry a 2 bcd (embryonic muscle) or a 2 bed (adult muscle), with the subunits arranged around a central ion pore [2,3]. Each mature subunit (after cleavage of the signal peptide) consists of three domains, an extracellular domain (ECD) (210–220 residues), a membrane-span- ning domain, and an intracellular domain [3]. The N-terminal ECD of each of the two a subunits con- tains the major part of the binding site for the cho- linergic ligands. The two sites are nonequivalent, one being formed at the interface between one a subunit and the c ⁄ e subunits and the other between the second a subunit and the d subunit [4]. The c ⁄ e and d subunits play a major role in shaping the ligand-binding sites and also in maintaining cooperative interactions between the a subunits [5–7]. The b subunit is an important determinant in receptor localization, as shown by studies on the properties of hybrid muscle AChRs, in which the muscle b subunit was replaced by its neuronal counterpart [8]. In addition to its physiological function, the muscle AChR is involved in the pathology of the autoimmune disease, myasthenia gravis (MG), being the main anti- gen against which MG autoantibodies are produced. These autoantibodies bind to AChR molecules at the neuromuscular junction, leading to their loss and the weakness and fatigability of the voluntary muscles, the main symptoms of MG [9]. A proportion of patients lacking autoantibodies against the AChR har- bors antibodies against the muscle-specific kinase, MuSK [10]. The pathophysiological importance of the AChR necessitates the solution of its 3D structure. Current knowledge of its structure is mainly based on data from electron images of the AChR found in large amounts in the electric organ of the marine ray, Torpedo californica [3]. The acquisition of the crystallo- graphic structure of the mollusc acetylcholine-binding protein [11] has provided an insight into the ligand- binding domain of nicotinic receptors. However, the fact that this protein is most closely related to the a7 subunit of the neuronal AChR (24% identity of amino acids) than each of the muscle AChR subunits (22% on average) necessitates the solution of the structure of the mammalian AChR molecule. A prerequisite for this is the availability of large amounts of native, sol- uble AChR molecules, a target that can be partially achieved by expression of the ECDs of the AChR sub- units in heterologous expression systems. Several stud- ies have been carried out on the expression of the muscle-type a subunit ECD in bacterial systems, in which the protein is expressed in large amounts, but is unglycosylated and forms inclusion bodies, requiring refolding to allow partial renaturation [12–14]. Other studies involved the expression of different subunits (whole subunits or ECDs) in mammalian systems, in which the protein has the correct structure, but is only produced in limited amounts because of the inherent difficulty in scaling up expression in cell culture or oocytes [15,16]. In this report, we present the expression and charac- terization of the ECDs of the b, c and e subunits of the human muscle AChR. We describe their expression in a soluble, glycosylated form and in satisfactory amounts using the yeast Pichia pastoris expression sys- tem, which combines the speed of bacterial systems with the advantages of eukaryotic expression systems (e.g. post-translational modification) and which had been successfully used in the past by our group to express the ECDs of human muscle a1 [17] and human neuronal a7 [18]. CD analysis of amino acids 1–221 of the human AChR b subunit (b1–221) showed that the protein has a b-structure with a contribution from a-helices. Two conformation-dependent mAbs (one anti-b and one anti-c) specifically bound to their cog- nate ECDs, whereas autoantibodies in MG sera, the binding of which is highly conformation-dependent [19,20], bound to all three ECDs. As all three ECDs were expressed in satisfactory amounts and were recognized by human MG autoanti- bodies, they may be suitable as starting material for preliminary biophysical and structural studies and for the study of MG. Results Rationale for the construction and testing of AChR ECD variants N-Terminal addition of the FLAG peptide (DY- KDDDDK) or addition of the first transmembrane amino acid of the mouse muscle a subunit, a proline, which is conserved in human AChR subunits, results in higher expression of the mouse muscle a ECD [21]. To test the effect of these additional epitopes ⁄ tags on the yield of the present proteins, we constructed a set of eight human c ECD variants (c, amino acids 1–218) with or without a proline at position 219 and ⁄ or the FLAG epitope and ⁄ or a 6-His tag (6-HIS) (Fig. 1A). We then performed small-scale cultures for each pro- tein and quantified the amounts of expressed protein in the culture supernatant using dot-blots and a series of supernatant dilutions. Expression varied depending on the presence of the different modifications (Fig. 1B). The yield of amino acids 1–218 of the human AChR c subunit (c1–218) without additional tags was taken as Soluble extracellular domains of AChR subunits K. Kostelidou et al. 3558 FEBS Journal 273 (2006) 3557–3568 ª 2006 The Authors Journal compilation ª 2006 FEBS the 100% reference ( 0.3 mgÆL )1 , see below). Addi- tion of the proline residue had no significant effect on expression (less than 10%). The presence of the FLAG tag increased expression of c1–218 by almost 20%, but did not improve expression of c1–219. The presence of the HIS tag alone reduced the expression of both con- structs by 30–40% (Fig. 1B, bars 2 and 6), and further addition of FLAG to c1–218HIS gave 100% expression (construct FLAG ⁄ c1–218HIS, bar 4). Strangely, when both epitopes were present on c1–219, no expression was observed (Fig. 1B, lane 8). We purified two c ECD variants, FLAG ⁄ c1–218HIS and c1–219HIS from 1-L cultures, obtaining  0.3 mgÆL )1 and 0.2 mgÆL )1 pro- tein, respectively. We then constructed b1–221HIS and FLAG ⁄ b1–221HIS and expressed, purified and quanti- fied them using 2-L cultures. The results showed that expression was increased threefold when the protein carried the FLAG tag (2 mgÆL )1 protein instead of 0.7 mgÆL )1 ). Expression and purification of the b, c and e ECDs As (a) the presence of the HIS tail on the constructs greatly facilitates purification, (b) its negative effect on the yield of c1–128 was considerably counteracted by the addition of the FLAG epitope, and (c) the pres- ence of the proline residue did not improve expression, we proceeded to large-scale expression of the b, c and e ECDs using constructs carrying both the FLAG and 6-HIS tags and no additional proline (i.e. FLAG ⁄ b1– 221HIS, FLAG⁄ c1–218HIS and FLAG⁄ e1–219HIS) (Fig. 2A). The yields ranged from 2 mgÆL )1 culture for FLAG ⁄ b1–221HIS to 0.3–0.8 mgÆL )1 for both FLAG ⁄ c1–218HIS and FLAG ⁄ e1–219HIS. The ECDs were purified using Ni 2+ ⁄ nitrilotriacetate affinity chroma- tography under native conditions. Typically, the pro- teins were eluted with 150 mm imidazole, although some protein was eluted at 100 mm (less than 10% of the total). Each protein migrated on SDS ⁄ PAGE with an apparent molecular mass of  35 kDa compared with the estimated molecular mass of  29 kDa, which was apparently due to the glycosylation of the product in the yeast cell (see below). The proteins were  90% pure, based on quantification of the protein bands on Coomassie Brilliant Blue-stained SDS ⁄ polyacrylamide gel (Fig. 2B). Deglycosylation of b1–221, c1–218 and e 1–219 Each recombinant protein carries at least one Asn- X-Ser motif (glycosylation pattern for eukaryotes), b1–221 at Asn141, c1–218 at Asn30 and Asn141, and amino acids 1–219 of the human AChR e subunit (e1– 219) at Asn66 and Asn141. To verify that the recom- binant proteins were glycosylated in the yeast cell (as suggested by the observed difference in the molecular mass of the purified proteins on SDS ⁄ PAGE), each protein was deglycosylated with peptide–N-glycosidase F. For each of the three proteins, this resulted in the appearance of a band migrating at the expected mass of  29 kDa (Fig. 2C), confirming that the proteins were glycosylated. Gel-filtration analysis of polypeptides To examine the solubility and oligomerization state of the recombinant polypeptides, we performed FPLC analysis in detergent-free solution (50 mm phosphate buffer, 300 mm NaCl, pH 8.0) in the presence of trace amounts of 125 I-labeled soluble 66-kDa and 29-kDa protein markers. To verify that the observed peaks on the FPLC coincided with the presence of our proteins, dot-blots were performed using anti-b (mAb 73) or anti-c (mAb 67) [22] (Fig. 3). As the expected molecu- lar mass of a monomer of each of the three ECD pro- teins was  30–32 kDa, the results showed that b1–221 was probably eluted as a dimer with an apparent A B His His 1-219 FLAG 1-219 His 1-219 His FLAG 1-219 His FLAG 1-218 1-218 FLAG 1-218 His 1-218 0 20 40 60 80 100 120 140 1-218 1-218 HIS FLAG 1-218 FLAG 1-218HIS 1-219 1-219 HIS FLAG 1-219 FLAG 1-219HIS Recombinant polypeptide Yield % of 1-218 Fig. 1. Expression of the c ECD variants. (A) Schematic representa- tion of the various c ECD constructs. The drawings depict the poly- peptides with their tags ⁄ epitopes; the additional amino acid, proline, is shown as a black bar at the C-terminus of some c ECD(s). (B) Relative yields of the different c ECD constructs. All yields were expressed as a percentage of the yield of the non- tagged c1–218 construct, measured as the pixels for the positive dot-blots of the culture expressing c1–218. The results shown are the mean from five experiments. K. Kostelidou et al. Soluble extracellular domains of AChR subunits FEBS Journal 273 (2006) 3557–3568 ª 2006 The Authors Journal compilation ª 2006 FEBS 3559 A γ γ 1-218 His FLAG α r ot c af - ε ε 1-219 His FLAG α r ot c a f - β β 1-221 His FLAG α r o t ca f - C 64 3 3 64 33 +- esaGNP +-+ - 54 53 B 5 4 53 54 53 54 53 Fig. 2. Purification and deglycosylation of the AChR ECDs. (A) Schematic representation of the constructs used for expression of the b1–221, c1–218 and e1–219 ECDs of the human AChR in yeast P. pastoris. The arrowhead indicates the cleavage site of the a-factor peptide after secretion, and the circles indicate putative glycosylation sites (Asn-X-Ser motif). (B) SDS ⁄ PAGE of the proteins purified by Ni 2+ ⁄ nitrilotri- acetate metal affinity chromatography stained with Coomassie Brilliant Blue; the left lane in each panel contains molecular mass markers, and the right lane the test protein. (C) Deglycosylation of the b, c, and e ECDs using N-glycosidase F. Purified proteins (1 lg) were incubated for3hat37°C in the absence (lane 1) or presence (lane 2) of N-glycosidase F, then the mixture was analyzed by SDS ⁄ PAGE (12% gel) and western blotting using anti-FLAG mAb M2. The arrows indicate the bands corresponding to the glycosylated (upper) and deglycosylated (lower) forms of each protein. 66kDa 29kDa 158kDa 0 500 1000 1500 2000 0 500 1000 1500 2000 ml β 1-221 A B Absorbance Units (×10 –3 )Absorbance Units (×10 –3 ) 66kDa 29kDa 158kDa 20191817161514131211109876543210 20 19 1817 1615 14 131211 10 987 6 543210 ml γ γ 1-218 Fig. 3. Gel filtration analysis of the polypep- tides. (A) 2.0 mg b1–221 or (B) 2.0 mg c1–218 protein was run on a Superose-12 column (Amersham-Pharmacia) at a flow rate of 0.5 mLÆmin )1 , together with 125 I-labeled protein markers of known mole- cular mass (66 and 29 kDa). The fractions were screened for ECD protein by dot-blots using anti-b (mAb 73) or anti-c (mAb 67). The position of the 158-kDa (aldolase) marker is also shown (nonradioactive, obtained from a separate run). Soluble extracellular domains of AChR subunits K. Kostelidou et al. 3560 FEBS Journal 273 (2006) 3557–3568 ª 2006 The Authors Journal compilation ª 2006 FEBS molecular mass of 60–65 kDa (Fig. 3A), whereas c1–218 was mainly present as an oligomer (possibly trimers-pentamers) (Fig. 3B). e1–219 displayed a sim- ilar pattern to c1–218 (data not shown), indicative of an oligomeric state. Although these elution patterns are typical of the proteins produced, occasional prepa- rations showed a considerable percentage (10–20) of higher aggregates. CD spectra When the b subunit ECD was subjected to far-UV CD analysis to examine its secondary structure, the CD spectrum in 50 mm phosphate buffer containing 0.15 m NaCl, pH 8.0, was characterized by a positive Cotton effect in the 190–200 nm region (peak  196 nm) and a negative effect in the 200–240 nm region (Fig. 4), suggesting a major contribution from a b-sheet structure. However, the quite high negative dichroism intensity over a relatively wide region  215 nm is indicative of the presence of bands at 208 and 222 nm, characteristic of a contribution of a-heli- cal regions [23]. Binding of mAbs to the ECDs using ELISA ELISAs were performed using the conformation- dependent mAbs 73 (binds to an epitope on the extra- cellular side of the b subunit) [22] and 67 (binds to an epitope on the extracellular side of the c subunit) [22] and the nonconformation-dependent mAb M2 (anti- FLAG). As a negative control, mAb 25 [24] was used, which recognizes an epitope on Electrophorus electricus AChR, but not on mammalian AChR. Figure 5 shows that mAbs 73 and 67 specifically recognized their cog- nate proteins, whereas mAb 25 did not bind to any of the three polypeptides, as expected. The strong and specific binding of the mAbs to the appropriate ECD suggested the correct folding of at least b1–221 and c1–218. Owing to the unavailability of a conforma- tion-dependent e subunit mAb, only binding of anti- FLAG mAb was tested. Binding of the rabbit anti-b serum to recombinant b1–221 and human AChR Purified b1–221 was used to raise a rabbit anti-b ECD serum. After three immunizations, the antiserum was tested for its ability to bind to the antigen (b1–221) using ELISA. The results (Table 1) showed strong and specific binding to b1–221 ( 1.8 absorbance units), with relatively weak cross-reactivity with either a1–210 or yeast proteins ( 0.4 absorbance units). The anti- serum was then tested for its ability to bind to native human TE671 AChR [25] in RIA experiments. The high titer of the anti-(b ECD) serum for native AChR (870 nm, Fig. 6) further suggests that recombinant b1–221 retains some native-like conformational features. Binding of human MG antibodies to recombinant ECDs To further examine the structure of the ECDs pro- duced and their potential as tools for MG studies, we tested their capacity to bind the highly conformation- dependent AChR antibodies present in MG sera. We had previously identified MG patient sera in which the antibodies are mainly directed against the a subunit 195 200 205 210 215 220 225 230 235 240 245 250 -14 -12 -10 -8 -6 -4 -2 0 2 4 6 8 10 {θ}*10 –3 deg cm –2 dmol –1 Wavelength (nm) Fig. 4. Far-UV CD spectrum of b1–221. 0 0,5 1 1,5 2 2,5 β1-221 γ1-218 ε1-219 BSA Recombinant ECD A 450 n A t i - β nAti - γ nA t i-F GAL ta g e n e vi no c t o r l Fig. 5. mAb binding to b, c,ande ECDs using ELISA. ELISA plates were coated with one of the three ECDs or BSA as a control, and the binding of mAbs tested by ELISA as described in Experimental procedures (duplicate samples). mAb 73, checker-board bars; mAb 67, dark gray bars; FLAG mAb, light gray bars. mAb 25 (black bars) was used as the negative control. K. Kostelidou et al. Soluble extracellular domains of AChR subunits FEBS Journal 273 (2006) 3557–3568 ª 2006 The Authors Journal compilation ª 2006 FEBS 3561 (anti-a sera) and others with a very small proportion of antibodies against a (nonanti-a sera) [26]. We incu- bated five nonanti-a and one anti-a (82% antibodies against a) sera with a single ECD (b, c or e)–Seph- arose or BSA–Sepharose resin, then measured the nonbound AChR antibodies in the initial and final samples. If the AChR antibodies in the MG serum recognized and bound to the recombinant, immobi- lized proteins, there would be a reduction in the amount of antibodies in the sample incubated with the ECD–Sepharose, and this reduction should be propor- tional to the percentage of subunit-specific antibodies in each serum. The anti-a serum should display little or no reduction when incubated with any of the test ECDs. Table 2 shows that incubation of each of the five nonanti-a sera (samples 1–5) with different ECD– Sepharose resins resulted in different percentage reduc- tions in AChR antibody titers. In contrast, the anti-a serum (sample 6) did not show any significant reduc- tion in titer when incubated with any of the non-a ECDS, as expected, but 82% loss of antibodies when incubated with a ECD–Sepharose. Similar results were obtained even when much higher serum quantities were incubated with the ECD–Sepharose resins (data not shown), which suggests that the immunoadsor- bents in this experiment adsorbed all corresponding subunit antibodies. As the binding to the AChR of AChR antibodies in MG patient sera is highly confor- mation-dependent, our findings support the presence of native-like conformational features on all three recombinant ECDs. Discussion In this paper, we describe the expression of soluble forms of the ECDs of non-a subunits of the human muscle AChR, using the yeast P. pastoris system. We have successfully used this system for the human muscle a ECD (a1–210) [17] and human neuronal type a7 subunit (a7 1–208) [18]. Based on this experi- ence, we embarked on the expression of three of the four non-a ECDs, namely b, c and e. The expression of the d subunit ECD, which is currently under pro- gress, presents major difficulties, which require further investigation. Aiming to improve expression yields, we designed, constructed and tested different variants of the c ECD with and without a 6-HIS tail and ⁄ or the FLAG Table 1. Binding of the rabbit anti-(b ECD) serum to purified b1– 221 in ELISA tests. Results shown are the mean from two experi- ments. Recombinant human a ECD (a1–210) was used to test for nonspecific binding of the rabbit anti-(b ECD) serum to a protein related to b1–221, rather than to a totally unrelated protein, such as BSA. The purified b1–221 used for immunization was purified from a P. pastoris yeast culture and possibly contained traces of yeast culture components (e.g. peptides originating from yeast protein degradation and other metabolic by-products). To eliminate the pos- sibility that rabbit antibodies raised against such components could lead to spurious ELISA results, a control yeast supernatant sample was prepared as described in Experimental procedures. BSA was used as a negative control. Rabbit anti-(b ECD) serum (A 450 ) Normal rabbit serum (A 450 ) Purified b1–221 1.80 0.10 Purified a1–210 0.40 0.08 Yeast supernatant 0.39 0.10 BSA 0.05 0.04 0 200 400 600 800 1000 1200 0,001 0,01 0,1 Serum Volume (µl) Immunoprecipitated 125 I-α-Btx labeled human AChR (cpm) Fig. 6. Binding of the rabbit anti-(b ECD) serum to 125 I-a-bungaro- toxin-labeled native human AChR. Various amounts of the rabbit anti-(b ECD) serum were incubated with 14 fmol intact 125 I-a-bung- arotoxin-labeled human AChR, then bound receptor was precipita- ted with sheep anti-rabbit IgG, and radioactivity was measured. Samples were processed in duplicate, and the results shown are the mean of those of three experiments. The titer of b antibodies in the serum was calculated to be 870 n M. Table 2. Adsorption of AChR antibodies from human MG sera by immobilized ECDs. AChR antibody titer given in parentheses in n M. The reduction in total AChR antibodies present in MG sera observed after incubation of sera with b1–221, c1–218, or e1–219 immobilized on CNBr–Sepharose beads was measured by RIA using 125 I-a-bungarotoxin-labeled native AChR. Serum Reduction (%) in AChR antibodies in MG serum after incubation with immobilized ECDs a1–210 a b1–221 c1–218 e1–219 MG 1 (50) 3 ± 3 53 ± 6 31 ± 1 29 ± 8 MG 2 (163) 8 ± 4 4 ± 2 8 ± 2 27 ± 4 MG 3 (99) 1 ± 1 89 ± 11 5 ± 2 22 ± 5 MG 4 (11) 3 ± 1 19 ± 4 29 ± 5 12 ± 1 MG 5 (6) 6 ± 2 1 ± 1 39 ± 7 18 ± 1 MG 6 (5) 82 ± 4 2 ± 1 13 ± 4 6 ± 2 anti-a serum a Data from [26]. Soluble extracellular domains of AChR subunits K. Kostelidou et al. 3562 FEBS Journal 273 (2006) 3557–3568 ª 2006 The Authors Journal compilation ª 2006 FEBS epitope and ⁄ or the first transmembrane amino acid of the AChR c subunit (proline), which is found at this position in all human muscle subunits and has been shown to positively affect expression of the mouse AChR a subunit [21]. Our results showed that the addition of a Pro residue and the presence of common epitopes ⁄ tags used for purification influenced the expression yield. When the widely used 6-HIS tail was added to the C-terminus of c1–218, it reduced expres- sion almost twofold, whereas an N-terminal FLAG, a peptide sequence rich in charged residues, improved expression of c1–218 by 20% and that of c1–218HIS by 40% (Fig. 1B). The effect of the hydrophilic FLAG epitope was most dramatically seen with the b1–221 ECD, its addition leading to an almost threefold increase in expression. Although Yao et al. [21] showed that addition of a Pro to the mouse a ECD increased expression fourfold, no such effect was seen with the non-a human ECDs in our system. Aiming simultaneously at easy purification (achievable using the 6-HIS tail) and high yields, we used the N-FLA- G ⁄ ECD ⁄ HIS-C constructs for the large-scale expres- sion of the proteins and found that b1–221 was consistently expressed at a concentration of 2 mgÆL )1 of culture and the c and e ECDs at a concentration of 0.3–0.8 mgÆL )1 . These yields are an improvement over the previous 0.1–0.2 mgÆL )1 expression of the a1–210 protein [17], which, however, was in the monomeric form, in contrast with the three recombinant proteins described here. Gel-filtration analysis showed that b1– 221 existed mainly as a dimer, whereas both c1–218 and e1–219 were mainly present as oligomers, possibly trimers–pentamers (Fig. 3). The state of the proteins was confirmed by dynamic light scattering experiments (data not shown); the proteins appeared polydisperse with an estimated diameter of 7.5–9.8 nm (b ECD) and 12.0–13.8 nm (c ECD), suggesting, respectively, a dimeric or an oligomeric structure and confirming the FPLC data, considering that the ‘height’ of the ECD of the AChR is  6 nm [3]. This difference in solubility between the c–e and the b ECDs might be attributed to the primary structure of the protein: in addition to the ‘standard’ cysteine pair (residues 128 and 142) [27], present in all AChR subunit ECDs, both c and e carry extra cysteine residues at residues 61, 105, and 115 (c) and 190 (e), which could be involved in the formation of intramolecular or intermolecular bonds, leading to oligomer formation. However, if ‘free’ cysteines were the only factors responsible for multimer formation, then the b ECD should exist as a monomer; as this was not the case, exposed hydrophobic regions, which are presumably present in the b ECD, may also con- tribute to intermolecular association of monomers. The results from a range of experiments suggested that the recombinant polypeptides are, at least to some extent, properly folded. Firstly, they were glycosylated, like native AChR [28] (Fig. 2C). Even though we lack direct evidence about the site and structure of the glycosylation sites on the ECDs, indirect evidence of correct glycosylation of our ECDs comes from our previous studies on the a ECD [17]: deglycosylation abolished a-bungarotoxin activity, strongly suggesting that glycosylation was at the right site and possibly of correct structure. Secondly, the CD spectrum of the b ECD indicated a folded protein consisting mainly of b-sheet (Fig. 4). The solved crystallographic structures of the molluscan Lymnaea stagnalis [11] and Bulli- nus truncatus [29] acetylcholine-binding proteins, which provide the prototypes for the AChR ligand-binding domain, show a predominance of b-sheet, and the CD spectra for these proteins largely resemble our spectra [29] and are also similar to those for mouse a1 expressed in mammalian cells [16] or yeast [21] and the Torpedo a ECD expressed in Escherichia coli [13]. These results suggest that the acetylcholine-binding proteins and the b ECD have similar structures and that the secondary structures of a non-a ECD (b) and the a ECD resemble one another, being largely com- posed of b-structure. Thirdly, conformation-dependent anti-b and anti-c (mAbs 73 and 67, respectively) bound specifically to their cognate ECD (Fig. 5), and a polyclonal serum raised against the b1–221 polypep- tide specifically bound to native AChR in RIA experi- ments (Fig. 6). Finally, AChR antibodies in different MG sera were specifically adsorbed by matrix-immobi- lized ECDs, with variable concentrations of AChR antibodies being retained on each ECD matrix (up to 89% of b antibodies for MG serum 3; Table 2). The presence of antibodies against several AChR subunits in a single serum (e.g. MG serum 1; Table 2) is inter- esting, although it was not unexpected because of pre- vious indirect information (e.g. from competition experiments between mAbs against different subunits and MG sera) [22]. The actual autoantigen in anti- AChR-mediated MG is still uncertain. It may be intact AChR, AChR subunit(s) or fragments, or an AChR cross-reactive molecule. The polyspecificity of the sera may either mean that the autoantigen is an intact AChR or that epitope spreading occurred after initial induction by a single AChR subunit or a cross-reactive molecule. The adsorption results also indicated the presence of a considerable percentage (29–39%) of c antibodies in three of the five tested nonanti-a MG sera (e.g. MG sera 1, 4 and 5; Table 2). The c subunit, present in the fetal isoform of the AChR, is replaced by the e subunit in adult muscle; however, this fetal K. Kostelidou et al. Soluble extracellular domains of AChR subunits FEBS Journal 273 (2006) 3557–3568 ª 2006 The Authors Journal compilation ª 2006 FEBS 3563 isoform is expressed in myoid cells in the thymus [30,31], and c expression persists into adulthood in mouse and bovine ocular fibers [32,33], justifying the presence of c antibodies in adult MG sera. The major- ity of AChR antibodies in MG sera are directed against various nonlinear, conformation-dependent epitopes on the extracellular part of the AChR mole- cule, a fact that has prevented their characterization using synthetic peptides or denatured recombinant polypeptides obtained using prokaryotic expression systems [20,34]. In addition, the immune responses against the non-a AChR subunits have not been exam- ined as carefully as those against the a subunit, even though the differential expression of the different sub- units may be highly significant in the pathogenesis of MG [35]. All four ECDs of the Torpedo AChRs have previ- ously been expressed as soluble proteins using baculo- virus-infected insect cells [36], and the proteins showed proper folding, but the amounts produced were insuffi- cient for crystallization trials. Moreover, the a ECDs of Torpedo and human AChR, which have been pro- duced as inclusion bodies in bacteria in quantities suf- ficient for structural studies [13,14], require denaturing conditions for solubilization of the protein and refold- ing and also do not undergo post-translational modifi- cations. In the present study, we obtained stable Pichia clones expressing satisfactory amounts of three non-a ECDs (b1–221, c1–218 and e1–219) which were in a soluble, secreted form and probably correctly folded, a fact that may permit preliminary crystalliza- tion trials. Crystallization trials require protein sam- ples of concentration  10 mgÆmL )1 , purity of at least 95%, and monodispersity. Based on the yields of our yeast cultures (0.5–2 mgÆL )1 ), a medium-scale expres- sion would suffice to provide material that, after puri- fication and gel filtration, should be sufficiently concentrated. The risk in this case would be the puta- tive formation of aggregates that would render the sample unusable for downstream processing, especially for the recombinant c1–218 and e1–219, which were already in the form of oligomers; this approach, how- ever, could possibly be applicable to b1–221, which is dimeric, stable on concentration (data not shown), and exhibits the highest expression yield. For the c and e ECDS, improvement in their solubility is required before attempts at structural trials. We are working towards this by constructing mutant forms of the proteins. Nevertheless, these polypeptides, together with the already produced a1–210 [17], were all specif- ically recognized by human AChR antibodies in MG sera, allowing their immediate use for the detailed study of the specificities of the antibodies in MG sera and the development of antigen-specific therapeutic approaches. Experimental procedures Bacterial and yeast strains, growth conditions, plasmids and DNA manipulations The E. coli K-12 strain TOP10F¢ (Invitrogen, San Diego, CA, USA) was used for replication of plasmid DNA. Clo- ning of the ORFs encoding the b1–221, c1–218 and e1–219 ECDs was performed by standard techniques [37]. Luria– Bertani broth and agar were used for amplification of transformed bacteria. Ampicillin (100 lgÆmL )1 ) was used in liquid or solid media. The vector pPIC9 (Invitrogen) was used to clone the ORFs in-frame with a leader sequence allowing secretion of the produced protein after cleavage of the secretion signal. An oligonucleotide, 5¢-GTAGATTACAAGGATG ACGATGACAAAG-3¢ encoding the FLAG sequence, DYKDDDDK, was introduced into the vector between the unique SnaBI and EcoRI sites. This allowed the subsequent in-frame cloning of our PCR products with a 5¢-EcoRI site in such a way that the cloned ORF was expressed as a polypeptide carrying the FLAG peptide at its N-terminus. The resulting plasmid was named pPIC9 ⁄ FLAG. Cloning using PCR We used PCR to amplify the extracellular region of each of the b, c and e subunits, using the plasmid templates, pcDNA3.1 ⁄ Beta, pcDNA3.1 ⁄ Gamma and pcDNA3.1 ⁄ Epsilon (cDNA clones of the human b, c and e AChR sub- units in pcDNA3.1 respectively; all kindly provided by D. Beeson, University of Oxford, UK) [38]. PCR was per- formed on the appropriate template for each subunit on a Perkin-Elmer (Boston, MA, USA) thermal cycler; 5 min denaturation at 94 °C was followed by 25 cycles of 94 °C for 20 s, 58 °C for 30 s, and 72 °C for 90 s, and a final 5-min extension step at 72 °C. The reaction mix consisted of 10 ng template, 50 mm each dNTP, 20 pmol each pri- mer, and 1 U Taq DNA polymerase in a volume of 50 lL 10-fold diluted reaction buffer (Promega, Madison, WI, USA). For b1–221, the forward primer was 5¢-GCG GA ATTCTCGGAGGCGGAGGGTCGAC-3¢ and the reverse primer 5¢-ATAGTTTA GCGGCCGCTCAATGGTGATGG TGATGGTGCTTGCGGCGGATGATGAG-3¢. For the c1–218 variants (some with an additional C-terminal Pro giving c1–219), the forward primer 5¢-GGTGTA GA ATTCCGGAACCAGGAGGAG CGC-3¢ was used in all cases, together with the reverse primer (a) 5¢-ATA GTTTA GCGGCCGCTTACTTGCGCTGGATGATGAG CAGG-3¢ for c1–218, (b) 5¢-ATAGTTTA GCGGCCGC TTAGTGATGGTGATGGTGATGCTTGCGCTGGATG Soluble extracellular domains of AChR subunits K. Kostelidou et al. 3564 FEBS Journal 273 (2006) 3557–3568 ª 2006 The Authors Journal compilation ª 2006 FEBS AGCAGG-3¢ for c1–218HIS (c1–218 with a 6-HIS tag at its 3¢ en d t o facilitate purification), (c) 5¢-ATAG TTTA GCGGCCGCTTAGGGCTTGCGCTGGATGAGCA GG-3¢ for c1–219, or (d) 5¢-ATAGTTTA GCGGCC GCTTAGTGATGGTGATGGTGATGGGGCTTGCGCT GGATGAGCAGG-3¢ for c1–219HIS. For the e1–219 variants (e1–220 with additional Pro), the forward pri- mer 5¢-GGTGTA GAATTCAAGAACGAGGAACTGCG-3¢ was combined with (a) 5¢-ATAGTTTAGCGGCCG CTTACTTCCGGCGGATGATGAGCGAG-3¢ for e1–219, (b) 5¢-ATAGTTTAGCGGCCGCTTAGTGATGGTGATG GTGATGCTTCCGGCGGATGATGAGCGAG-3¢ for e1– 219HIS, (c) 5¢-ATAGTTTAGCGGCCGCTTACGGCTT CCGGCGGATGATGAGCGAG-3¢ for e1–220, or (d) 5¢- ATAGTTTAGCGGCCGCTTAGTGATGGTGATGGTGA TGCGGCTTCCGGCG-GATGATGAGCGAG-3¢ for e1– 220HIS (underlined EcoRI and NotI). The PCR products were purified (Qiagen PCR clean-up kit; Qiagen, Hilden, Germany), EcoRI–NotI digested, repurified, and cloned into the EcoRI–NotI-digested pPIC9 or pPIC9 ⁄ FLAG plas- mid. Each PCR product was cloned into both plasmids. Sequencing was used to verify the identity of the inserts. Yeast transformation and dot-blot screening of positive clones Plasmids (10 lg) encoding the b1–221 ECD (with or with- out the FLAG epitope) and the various c1–218 and e1–219 ECDs were linearized using SacI (for b1–221) or SalIor SacI (for c1–218 and e1–219) and electroporated into freshly made competent GS115 P. pastoris cells. Selection of positive transformants (cells able to grow in the absence of histidine) was achieved by plating on regeneration dextrose plates (1 m sorbitol, 2% dextrose, 1.34% yeast nitrogen base, 4 · 10 )5 % biotin, 0.005% l-glutamic acid, l-lysine, l-methionine, l-leucine, and l-isoleucine, 2% agar) without histidine. Small-scale cultures of single colonies were tested after growth overnight in 3 mL BMGY medium (1% yeast extract, 2% peptone, 100 mm potassium phosphate, pH 6.0, 1.34% yeast nitrogen base, 4 · 10 )5 % biotin, 1% glycerol) and resuspension of the cells in 3 mL BMMY medium to induce expression (BMMY medium is identical with BMGY, but contains 0.5% methanol instead of glycerol) (day 0). Methanol was added to 0.5% every 24 h to main- tain induction, and 0.75 mL liquid medium was removed every 24 h after day 0 to test for the expression and secre- tion of the produced protein. The cleared supernatant was tested on dot-blots using mAb 73, mAb 67, or anti-FLAG mAb M2 (Sigma, St Louis, MO, USA) to test for the expression of b, c or all ECDs, respectively. After the initial screening, phosphate buffers with a pH of 6.5 or 7.0 were also tested, and the pH 7.0 buffer was finally adopted for large-scale expression. Expression levels of the different c or e variants were estimated by quantification of the positive signal on dot-blots of culture supernatant (at serial dilu- tions) using imagej software (http.//rsb.info.nih.gov/ij/). Large-scale expression and purification of proteins The best expressing clone was selected for each protein. A 0.1-mL sample of a small overnight culture of 20 mL BMGY medium was used to inoculate 1 L fresh BMGY medium. After growing to an A 600 of 3 ( 18–20 h), the cells were spun down, washed, and resuspended in 3 L BMMY medium to induce expression. On day two, the cul- tures were cleared of cells by centrifugation for 20 min at 2500 g (Jouan 11175372 M4 rotor), and the supernatant concentrated using a Millipore (Bedford, MA, USA) ultra- filtration system (filter cut-off 10 kDa); these steps and all subsequent steps were performed at 4 °C. The concentrate was dialyzed overnight against 50 mm phosphate buffer, 2 m NaCl, pH 8.0, for the c and e ECDs or 50 mm phos- phate buffer, 0.5 m NaCl, pH 8.0, for the b ECD before binding of the protein to 1.5 mL pre-equilibrated Ni 2+ ⁄ ni- trilotriacetate ⁄ agarose (Qiagen). The protein was purified under native conditions following the manufacturer’s instructions. Eluates were analyzed by SDS ⁄ PAGE (12% gel) and Coomassie blue staining or western blotting using mAb 73 (for the b ECD) or anti-(FLAG M2) (Sigma). The purity of the protein was estimated from Coomassie Brilli- ant Blue-stained gels and quantification of the bands using imagej software, and protein concentration was determined using the Bradford method (Bio-Rad, Hercules, CA, USA). In vitro deglycosylation A sample (1 lg) of purified protein was deglycosylated by incubation for 3 h at 37 °C with 1000 U N-glycosidase F (New England Biolabs, Frankfurt, Germany) in a final vol- ume of 50 lL under the conditions recommended by the manufacturer for a nondenatured protein. The protein was then precipitated by the addition of 200 lL methanol ⁄ acet- one (1 : 1, v ⁄ v), incubation at )20 °C for 20 min, centrifu- gation for 15 min, and resuspension in 15 lL distilled water. The samples were analyzed by SDS ⁄ PAGE and western blotting using FLAG mAb M2. FPLC analysis of polypeptides To determine the size of b1–221, c1–218 or e1–219, FPLC analysis on a Superose-12 column (Amersham-Pharmacia, Munich, Germany) was performed in 50 mm sodium phos- phate buffer ⁄ 300 mm NaCl, pH 8.0, at a flow rate of 0.5 mLÆmin )1 . Samples of each fraction (normally 1 and 10 lL of each 0.5-mL fraction) were tested for the presence of the specific protein by dot-blotting with FLAG mAb M2. K. Kostelidou et al. Soluble extracellular domains of AChR subunits FEBS Journal 273 (2006) 3557–3568 ª 2006 The Authors Journal compilation ª 2006 FEBS 3565 Radioactive labeling of protein markers and a-bungarotoxin a-Bungarotoxin (24 lg) or 2 lg either bovine erythrocyte carbonic anhydrase ( 29 000 Da) or BSA ( 66 200 Da) (both from Fluka; Sigma-Aldrich, Athens, Greece) was labeled, respectively, with 2 mCi or 0.1 mCi 125 I, using the chloramine T method [39], loaded on to a G50-Fine column (Amersham-Pharmacia), and the labeled protein collected and stored at )20 °C. Approximately 100 000 c.p.m. of each of the 125 I-labeled protein markers was loaded on every FPLC run as size markers. Preparation of rabbit anti-(b subunit) serum An 8-week-old female New Zealand White rabbit was injec- ted subcutaneously with  0.5 mg purified b1–221 protein in 50% (v ⁄ v) complete Freund’s adjuvant, followed by three injections at monthly intervals in 50% incomplete Freund’s adjuvant. One week after the last injection, anti- serum was collected, aliquoted, and stored at )20 °C in the presence of 0.05% sodium azide. Use of experimental ani- mals abides by law 2015/27-2-1992 of the Greek Republic and Presidential Decree 160/3-5-1991 in accordance with directive 86/609EOK of the Council of Europe for protec- tion of vertebrates/animals used for experimental or other research purposes. CD spectra CD spectra were measured at 20 °C using a Jasco model J-715 spectropolarimeter (located at NCSR, Demokritos, Athens, Greece) in semi-automatic slit adjustment mode. The scan speed was set at 50 nmÆmin )1 , the response time at 2 s, and the scan range at 180–260 nm. Optical activity was expressed as the mean residue ellipticity (Q), in degree- sÆcm 2 Ædmol )1 , based on a mean residue weight of 115 for the b ECD polypeptide. The derived spectrum represents the mean of eight scans and was corrected for light scatter- ing by buffer subtraction. The protein concentration was optimized as 0.2 mgÆmL )1 , and the quartz cell path length was 1 mm. All samples were optically homogeneous. ELISA ELISA plates (Maxi-Sorb; Nun Roskilde, Denmark) were coated, as described previously [14], using 0.25 lg purified recombinant protein (b1–221, c1–218 or e1–219) per well. Control wells were coated with BSA (0.25 lg). Additional control wells were coated with 0.25 lg a ECD (a1–210) or 100 lL yeast culture supernatant prepared as follows: 100 mL of a culture of P. pastoris GS115 strain was spun, and the supernatant filtered, concentrated 40-fold, and dia- lyzed against 50 mm phosphate buffer, pH 8.0. The plates were washed with phosphate-buffered saline, pH 7.5 (NaCl ⁄ P i ) and blocked for 30 min at 37 °C with blocking solution (5% nonfat milk in NaCl ⁄ P i ), then incu- bated for 1 h at 25 °C with primary antibody in blocking solution; mAbs were used at a 1 : 100 dilution (the concen- tration of the undiluted mAb ‘stock solution’ was 0.1– 0.5 mgÆmL )1 ), and the rabbit antiserum was used at dilu- tions of 1 : 100–1 : 10 000. After three washes with block- ing solution, the plates were incubated for 1 h at 25 °C with secondary antibody [horseradish peroxidase-conju- gated rabbit anti-rat IgG (Dako, Glostrup, Denmark) in the case of the mAbs and sheep anti-rabbit IgG (Dako)] at a 1 : 500 dilution in blocking solution. No secondary anti- body was used when the FLAG mAb M2 was used, as the antibody was supplied in its horseradish peroxidase-conju- gated form (Sigma). The ELISA plate was developed using 3,3¢,5,5¢-tetramethylbenzidine ready-to-use substrate (MBI- Fermentas, St Leon-Rot, Germany), stopping the reaction with 0.2 m H 2 SO 4 . The plate was read at 450 nm on a microtiter plate reader. Preparation of ECD–Sepharose beads ECD (0.25 mg) mixed with BSA (1.25 mg, as carrier) were bound to 0.25 g CNBr-activated Sepharose beads (Pharma- cia, Munich, Germany) according to the manufacturer’s protocol as described previously [26]. The beads were then diluted in NaCl ⁄ P i ⁄ 2% BSA ⁄ 0.05% NaN 3 so that 120 lL of the mixture contained 1 lg recombinant protein. Control beads were prepared using 1.5 mg BSA. Use of the ECD–Sepharose matrix for binding AChR antibodies in MG sera Depending on the AChR antibody titer, different dilutions of sera were prepared: the MG sera were diluted 1 : 10 (for serum titer 5 nm) to 1 : 500 (for titer 290 nm) supplemented with normal human serum to a final serum dilution of 1 : 10. This guaranteed that the amount present in the untreated sample would immunoprecipitate  50% of the labeled AChR. A 40-lL portion of the dilution was incuba- ted for 2 h at 4 °C with 120 lL Sepharose–ECD or Seph- arose–BSA matrix (final volume 160 lL), and then duplicate 40-lL samples of supernatant (containing 1 lL serum) were tested in the RIA described below. RIA for MG sera or rabbit anti-(b1–221) serum We tested the ability of MG sera to precipitate a-bungaro- toxin-labeled human AChR prepared from either TE671 cells or a mixture of CN21 ⁄ TE671 cells (CN21 cells express the e and c AChR subunits at a ratio of approximately 2 : 1 [40], whereas TE671 cells express only the c subunit AChR [25]). The TE671-derived AChR was used when sera Soluble extracellular domains of AChR subunits K. Kostelidou et al. 3566 FEBS Journal 273 (2006) 3557–3568 ª 2006 The Authors Journal compilation ª 2006 FEBS [...]... specificity in myasthenia gravis Ann NY Acad Sci 505, 106–120 35 Ragheb S & Lisak R (2003) Differences between the e and c subunits of the acetylcholine receptor (AChR) may be significant in autoimmune myasthenia gravis Ann NY Acad Sci 998, 336–338 36 Tierney ML & Unwin N (2000) Electron microscopic evidence for the assembly of soluble pentameric extracellular domains of the nicotinic acetylcholine receptor J... Pathogenetic significance of fetal-type acetylcholine receptors on thymic myoid cells in myasthenia gravis Dev Immunol 2, 69–75 31 Missias AC, Chu GC, Klocke BJ, Sanes JR & Merlie JP (1996) Maturation of the acetylcholine receptor in skeletal muscle: Regulation of the AChR c- to -e switch Dev Biol 179, 223–238 32 Schluep M, Willcox N, Vincent A, Dhoot GK & Newsom-Davis J (1987) Acetylcholine receptors in human. .. (2005) Refined structure of the nicotinic acet˚ ylcholine receptor at 4 A resolution J Mol Biol 346, 967–989 Soluble extracellular domains of AChR subunits 4 Blount P & Merlie JP (1989) Molecular basis of the two nonequivalent ligand binding sites of the muscle nicotinic acetylcholine receptor Neuron 3, 349–357 5 Sine S & Claudio T (1991) Gamma- and delta -subunits regulate the affinity and the cooperativity... acetylcholine receptor a-subunit Development of an antigen-speci c therapeutic strategy J Neuroimmunol 159, 183–191 27 Green W & Wanamaker P (1997) The role of the cysteine loop in acetylcholine receptor assembly J Biol Chem 272, 20945–20953 3568 28 Anderson DJ & Blobel G (1981) In vitro synthesis, glycosylation and membrane insertion of the four subunits of Torpedo acetylcholine receptor Proc Natl Acad Sci... Expression and renaturation of the N-terminal extracellular domain of Torpedo nicotinic acetylcholine receptor a-subunit J Biol Chem 273, 32393–32399 13 Alexeev T, Krivoshein A, Shevalier A, Kudelina I, Telyakova O, Vincent A, Utkin Y, Hucho F & Tsetlin V (1999) Physicochemical and immunological studies of the N-terminal domain of the Torpedo acetylcholine receptor a-subunit expressed in Escherichia coli... Anna Kokla for excellent technical assistance, and Dr D Beeson (University of Oxford) for the cDNA clones References 1 Karlin A (2002) Emerging structure of the nicotinic acetylcholine receptors Nat Rev Neurosci 3, 102–114 2 Le Novere N, Corringer PJ & Changeux JP (2002) The diversity of subunit composition in nAChRs: evolutionary origins, physiologic and pharmacologic consequences J Neurobiol 53, 447–456... radioactivity was counted on a c- counter If the antibodies bound specifically to the test ECD protein, a reduction in the amount of antibodies would be detected in the MG serum sample incubated with ECD–Sepharose (sample 1) compared with the same sample incubated with BSA–Sepharose (sample 2) This reduction should be proportional to the fraction of autoantibodies reactive with the subunit The percentage immunoadsorption... (1990) Expression of functional mouse muscle acetylcholine receptors in Chinese hamster ovary cells J Neurosci 10, 2771–2779 16 West AP, Bjorkman PJ, Dougherty DA & Lester HA (1997) Expression and circular dichroism studies of the extracellular domain of the a subunit of the nicotinic acetylcholine receptor J Biol Chem 272, 25468–25473 FEBS Journal 273 (2006) 3557–3568 ª 2006 The Authors Journal compilation... Kostelidou et al had been preincubated with c1 –218–Sepharose beads, and the mixed AChR was used when the sera were preincubated with the other ECD–Sepharose beads Human AChR (14 fmol) was labeled for 4 h at 4 C with 50 000 c. p.m 125 I-a-bungarotoxin ( 70 fmol) in a volume of 20 lL, then 40 lL of the ‘treated’ MG serum (preincubated with either ECD–Sepharose or BSA–Sepharose) was added The mixtures were... cooperativity of ligand binding to the acetylcholine receptor J Biol Chem 266, 19369–19377 6 Sine S, Bren N & Quiram PA (1998) Molecular dissection of subunit interfaces in the nicotinic acetylcholine receptor J Physiol (Paris) 92, 101–105 7 Krusek J & Vyskocil F (2003) Different degree of cooperativity in adult, embryonic and mutated mouse muscle nicotinic receptors Biochim Biophys Acta 1646, 119–130 8 Wheeler . we present the expression and charac- terization of the ECDs of the b, c and e subunits of the human muscle AChR. We describe their expression in a soluble, glycosylated form and in satisfactory amounts. on the yield of c1 –128 was considerably counteracted by the addition of the FLAG epitope, and (c) the pres- ence of the proline residue did not improve expression, we proceeded to large-scale expression. in higher expression of the mouse muscle a ECD [21]. To test the effect of these additional epitopes ⁄ tags on the yield of the present proteins, we constructed a set of eight human c ECD variants