Báo cáo khoa học: Expression and characterization of soluble forms of the extracellular domains of the b, c and e subunits of the human muscle acetylcholine receptor pot

... nonlipolytic hydrolase; Rv139 9c; tuber- culosis. The recent elucidation of the complete sequence of Myco- bacterium tuberculosis genome [1] has offered new perspec- tives for the search of novel drugs ... capture the hydrogen of the catalytic serine for an efficient nucleophilic attack of the substrate ester bond by the serine alcoholate. The shape of the titrati...

Ngày tải lên: 07/03/2014, 16:20

... pLac1-B was selected to characterize the recombinant laccase from A. niger . Immunodetection of the recombinant laccase and expression of the corresponding gene in A. niger Production of the r ecombinant ... was performed by Genome Express (Grenoble, France). Expression vectors Two expression vectors were constructed using a PCR cloning approach, and the cloned PCR p...

Ngày tải lên: 17/03/2014, 11:20

... sequence primers obtained from the core region sequence. The nucleotide sequence of the V. alginolyticus pepD gene has been deposited in the GenBank database (accession number DQ335448). Production ... role in PepD Oligonucleotide sequence (5¢-to-3¢) H80A Zinc binding GTGCTTCAAGCA GCGATCGACATGGTGCCAC D82A Catalytic GCACACATC GCCATGGTGCCACAAAAGAACG D119A Zinc binding CGCTCGGGGCA GCTA...

Ngày tải lên: 23/03/2014, 06:20

... UV-spectra of the nuclease-treated and untreated preparations revealed that both of them were contaminated with nucleic acids. Calculation of RNA content showed that the nuclease treatment reduced ... identified. Considering the long evolutionary distance between sponges and vertebrate lineages, the elucidation of the function of the 2-5A synthetase in these invertebr...

Ngày tải lên: 23/03/2014, 09:20

... in the presence of ascorbate are depicted in Fig. 7, panel A. Addition of ascorbate to the heme–Syn HO-1 complex commences the reaction, which is monitored by the steady decrease of the Soret and ... NADPH cytochrome P450 reduc- tase, forming detectable intermediates, the oxy-heme and verdoheme complexes. However, the overall reaction rate of heme conversion is relat...

Ngày tải lên: 23/03/2014, 20:22

... P2Y 1 and P2Y 2 receptors are both coupled to phospholipase C [8]. Whereas the presence of the P2Y 2 receptor in glioma C6 cells is generally accepted, the presence of the P2Y 1 receptor, which ... consisting of six measurements repeats from three experiments. Zero time represents the ATP concentra- tion in the culture medium containing serum, before the experi- me...

Ngày tải lên: 30/03/2014, 08:20

... we present the expression and charac- terization of the ECDs of the b, c and e subunits of the human muscle AChR. We describe their expression in a soluble, glycosylated form and in satisfactory amounts ... of the ECDs of the non-a sub- units of human muscle AChR for use as starting material for the determin- ation of the 3D structure...

Ngày tải lên: 30/03/2014, 10:20

... protein sequencing system showed that the elastase cleavage occurred at the boundary of the b-galactosidase region of the b-gal fusion protein. The amino acid sequence of the resulting puri- fied ... segment containing the second conserved cysteine, a secondary site contacting the target proteases includes residues adjacent to the fourth conserved cysteine ([18] cf. Fig...

Ngày tải lên: 31/03/2014, 01:20

... paracrine roles Zongwei Li, Hua Wei, Linzi Deng, Xiangfeng Cong and Xi Chen Research Center for Cardiac Regenerative Medicine, Chinese Academy of Medical Sciences & Peking Union Medical College, ... proliferation and type I and III collagen expression, exerting paracrine anti-fibrotic effects. However, researchers did not analyse the active compo- nents of the conditioned me...

Ngày tải lên: 18/02/2014, 04:20

... measured the accurate mature amino acid sequences of the four complex II subunits by RT-PCR and N-terminal sequencing. The nucleotide sequences of the four por- cine complex II subunits were ... were sequenced correctly (Fig. 4), with the exception of the 5¢-end and 3¢-end primer sequences from human mitochondrial com- plex II (see Experimental procedures). However...

Ngày tải lên: 19/02/2014, 02:20