1 x ray imaging as a backup during mri cardiac catheterization
Báo cáo khoa học: "Intra-fraction setup variability: IR optical localization vs. X-ray imaging in a hypofractionated patient population" doc
... report a Figure x -ray image quality Upper panels: X -ray images acquired on an anthropomorphic radio-equivalent phantom Lower panels: X -ray images acquired on a patient after treatment Spadea et al ... acquired before and after the irradiation Patient was also imaged trough X -ray imaging before and after the treatment Data were analyzed off line to measure the intra-fraction motion according to the ... regular basis did not allow us to acquire data at every fraction Details about the patient population are presented in Table Target definition and irradiation technique The treatment plan was calculated...
- 8
- 421
- 0
báo cáo hóa học:" Accuracy of biplane x-ray imaging combined with model-based tracking for measuring in-vivo patellofemoral joint motion" doc
... Table 1: Accuracy of the model-based technique for tracking the patella and femur was expressed in terms of bias and precision as mean ± standard deviation Bias Precision Axis Patella Femur Patella ... the data analysis software All authors read and approved the final manuscript References 10 Hsu HC, Luo ZP, Rand JA, An KN: Influence of lateral release on patellar tracking and patellofemoral ... this study, participated in the data collection and analysis, and drafted the manuscript SKK participated in the data collection and analysis ST participated in study design and data analysis RZ...
- 8
- 401
- 0
Báo cáo khoa học: "Predicting oak wood properties using X-ray inspection: representation, homogenisation and localisation. Part I: Digital X-ray imaging and representation by finite elements" ppsx
... 1) A- 2.3 Spatial and quantitative resolution 2.3.1 Spatial resolution Several protocols are available to evaluate the spatial resolution of an imaging system They are all equivalent [13] and attempt ... – X -ray imaging: A new digital X -ray imaging device was developed to describe the actual spatial organisation of tissues in one annual ring in the transverse plane – F.E representation: A complete ... deterministic approach based on a mechanical formulation where wood is considered as a natural heterogeneous material (figure 1) As a consequence, the individual properties and spatial organisation of...
- 10
- 199
- 0
Development of high speed video imaging as a process analytical technology (PAT) tool
... as a process analyzer that uses imaging and image analysis to obtain process related information A visiometric process analyzer quantifies inprocess material flow pattern by capturing and analyzing ... the gastrointestinal tract (Bechgaard and Ladefoged, 1978) Secondly, non-disintegrating tablets can stick to the mucosa of the gastrointestinal tract, releasing drug to a small area of mucosa and ... Compared to traditional tablets, multiparticulates have advantages of lower gastric irritation, more uniform gastric transit time and less variation in drug release profiles (Hogan, 1995) Ease...
- 208
- 348
- 0
Tài liệu Báo cáo khoa học: Destabilization of psychrotrophic RNase HI in a localized fashion as revealed by mutational and X-ray crystallographic analyses pdf
... extension: tailor-made genes using the polymerase chain reaction Biotechniques 8, 528–535 34 Kanaya S, Katsuda C, Kimura S, Nakai T, Kitakuni E, Nakamura H, Katayanagi K, Morikawa K & Ikehara M (1991) ... basis of a least-squares analysis The enthalpy (DHm) and entropy (DSm) changes for thermal denaturation at Tm were calculated by van’t Hoff analysis X -Ray diffraction data sets of the 6·-RNase HI ... Ishikawa K, Nakamura H, Morikawa K & Kanaya S (1993) Stabilization of Escherichia coli ribonuclease HI by cavity-filling mutations within a hydrophobic core Biochemistry 32, 6171–6178 Akasako A, Haruki...
- 11
- 648
- 0
Tài liệu Characterization of the Polymorphic Behavior of an Organic Compound Using a Dynamic Thermal and X-ray Powder Diffraction Technique pptx
... Evolved Gas Analysis Simultaneous TG/MS and TG/gas chromatography (GC)/MS analysis were performed on several samples A split was used to send a fraction of the evolved gases to a quadruple mass spectrometer ... was performed on several samples using a TA 2950 TGA with a platinum pan A nitrogen atmosphere was used for each trial Some analyses were performed on a Perkin Elmer-7 TGA with an aluminum pan ... water content have not been made in these data Evolved gas (EG) analysis of sample 49 indicated that water was the only significant volatile observed during heating to 120 °C Trace levels of carbon...
- 16
- 549
- 0
Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc
... 5¢-CACACTACACTGGGAAGCAGAGACTCCAGC-3¢ and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG3¢ The cDNA was subcloned into the EcoRV site of pBluescript SK(+) (Stratagene, La Jolla, CA, USA) and sequenced using an automated ... buffer, and the eluted samples were subjected to western blot analysis as described above The authors thank Drs Masato Yasui, Sadakazu Aiso and Masaaki Matsuoka for support; Dr Andrew P McMahon ... 5¢-AA GCTTCCGGAGGCTGCTAGAGAC-3¢ and 5¢-GGATC CAAGAACTGTGTATGTCTG-3¢ The 1.6-kbp fulllength Skn cDNA, whose termination codon was changed to a BamHI site, was inserted between the SalI and the BamHI...
- 14
- 499
- 0
Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx
... (5¢-GATCTCCTCTTCAGCTA CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindIII sites of pEGFP-NLS ... 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ (siNup358-2)] Transfection ... localization of HDAC4 orchestrates muscle differentiation Nucleic Acids Res 29, 3439–3447 22 Yasuhara N, Shibazaki N, Tanaka S, Nagai M, Kamikawa Y, Oe S, Asally M, Kamachi Y, Kondoh H & Yoneda...
- 12
- 454
- 0
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx
... A1 , hnRNP E1 ⁄ E2 hnRNP A1 ASF ⁄ SF2 hnRNP A1 UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA GAAGAAGCGGAGACAGCGACGAAGA AGAUCCAUUCGAUUAG unknown UAGUGAAUAGAGUUAGGCAGGGA ... cells Proc Natl Acad Sci USA 91, 7311–7315 32 Kamata M, Nitahara-Kasahara Y, Miyamoto Y, Yoneda Y & Aida Y (2005) Importin-alpha promotes passage through the nuclear pore complex of human immunodeficiency ... p300 ⁄ CBP coactivators J Virol 76, 9724–9734 HIV-1 alternative splicing regulation 34 Kuramitsu M, Hashizume C, Yamamoto N, Azuma A, Kamata M, Yamamoto N, Tanaka Y & Aida Y (2005) A novel role...
- 10
- 434
- 0
Báo cáo khoa học: Post-ischemic brain damage: targeting PARP-1 within the ischemic neurovascular units as a realistic avenue to stroke treatment pptx
... to basal PARP-1 activity as central to homeostatic regulation of endothelial function, whereas its hyperactivation appears causal to BBB damage and immune cell infiltration during ischemia PARP-1, ... generation and release of ROS from NADPH oxidase and mitochondria, sustained increase of the cytosolic Ca2+ concentration and finally nuclear translocation of mitogen-activated protein kinase kinase ... Authors Journal compilation ª 2008 FEBS F Moroni and A Chiarugi PARP-1 and the ischemic neurovascular unit Astrocyte PARP-1 Neuron Inflammatory mediators AIF PARP-1 M ina am ll asa P M PARP-1 B HM...
- 10
- 417
- 0
Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt
... sulfate X -ray diffraction data of the wt and M100K crystals were collected on an in-house beam using a MAR345 Image Plate detector The crystals were mounted in a capillary and datasets at 295 K and ... 0.4 A Significant deviations for main- and side-chain atoms in the ligand loop containing the K100 are however, observed To accommodate K100 as a ligand a number of main-chain atoms are displaced ... reduction potential of the latter form [25,52,53], and it was noted that conformer A of the M100K variant displayed a substantially increased heme ASA The lower reduction potential compared to the...
- 15
- 509
- 0
Báo cáo Y học: Determinants of the inhibition of a Taiwan habu venom metalloproteinase by its endogenous inhibitors revealed by X-ray crystallography and synthetic inhibitor analogues pdf
... They are generally called ADAMs (a disintegrin-like and metalloproteinase domain) with the same central catalytic domain as SVMPs and MMPs, especially at the active-site structure [21,22] A well ... proteinases are also shown Academia Sinica (Taipei, Taiwan) for assistance in the chemical synthesis of inhibitor analogues We thank Dr Yuch-Cheng Jean of the Synchrotron Radiation Research Center ... ultrafiltration and concentration was obtained from Millipore (Amicon bioseparation, Bedford, MA, USA) Preparation of inhibitor analogues and proteinase inhibition assays Inhibitor analogues were synthesized...
- 10
- 475
- 0
Báo cáo khoa học: X-ray structure of peptidyl-prolyl cis–trans isomerase A from Mycobacterium tuberculosis potx
... solution at 280 nm) using a Vivaspin concentrator (Vivascience) with a molecular cut-off of 10 kDa The purification was monitored by SDS and native PAGE (PhastSystemTM, Amersham Biosciences) Assay The ... 24 Altschul, S.F., Madden, T.L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W & Lipman, D.J (1997) Gapped BLAST and PSIBLAST: a new generation of protein database search programs Nucleic Acids ... molecular mass 19.2 kDa) was solved by molecular replacement, using the structure of human PpiA [14] as a search model A strong peak in the native Patterson map (Fig 2) assisted in the location...
- 7
- 408
- 0
Báo cáo khoa học: End-damage-specific proteins facilitate recruitment or stability of X-ray cross-complementing protein 1 at the sites of DNA single-strand break repair docx
... 32 Lan L, Nakajima S, Oohata Y, Takao M, Okano S, Masutani M, Wilson SH & Yasui A (2004) In situ analysis of repair processes for oxidative DNA damage in mammalian cells Proc Natl Acad Sci USA ... Removal by human apurinic ⁄ apyrimidinic endonuclease (Ape 1) and Escherichia coli exonuclease III of 3¢-phosphoglycolates from DNA treated with neocarzinostatin, calicheamicin, and gammaradiation ... XRCC1–DNA ligase IIIa heterodimer interacts with APE1 [24], Pol b [25] and PNK [26] it was proposed that XRCC1 serves as a docking plat5759 Mammalian DNA single-strand break repair form to accommodate...
- 11
- 299
- 0
Báo cáo khoa học: Natural-abundance isotope ratio mass spectrometry as a means of evaluating carbon redistribution during glucose–citrate cofermentation by Lactococcus lactis potx
... Diacetyl and a- acetolactate overproduction by Lactococcus lactis subsp lactis biovar diacetylactis mutants that are deficient in a- acetolatate decarboxylase and have low lactate dehydrogenase activity ... d13Cpyruvate and measured d13Clactate, d13Cacetate, d13Cacetoin, and d13Cdiacetyl (A) at constant [citrate] and variable [glucose], (B) at constant [glucose] and variable [citrate] The calculated ... discrepancy in the d13C values may indicate, however, that L lactis strain B7/ 2147 has diminished, rather than deleted, a- acetolactate decarboxylase activity because strains characterized as lacking...
- 9
- 336
- 0
Báo cáo khoa học: Structural function of C-terminal amidation of endomorphin Conformational comparison ofl-selective endomorphin-2 with its C-terminal free acid, studied by 1 H-NMR spectroscopy, molecular calculation, and X-ray crystallography pot
... conformational and interaction differences between C-terminal amidated and deamidated (carboxylated) peptides [4–6], assuming that C-terminal amidation is significantly associated with the bioactive ... Hz at supramaximal voltage Longitudinal contractions were recorded via an isometric transducer For the mouse vas deferens bioassay, the vas deferentia of a male ddY strain mouse were prepared ... foldings The results are given in Table As shown in Table 2, EM2 has a trans ⁄ cis rotamer ratio of about : in TFE and water (pH 2.7 and 5.2) The predominance of the trans rotamer has also been observed...
- 19
- 314
- 0
moving as a child part 1 conversation
... was just about a teenager, so I know Kristin: Well, I, I’ve only moved once, too, when I was a child and I was eight And that was pretty tough for me Pennsylvania: a state in America Joe: Yeah, ... Moving As A Child Part Conversation Kristin: Yeah comes a point: comes a time teenager: a person between 13 and 19 years old Joe: I mean, I’ve had some friends whose parents were in the Army and ... lived there And then I moved to Pennsylvania, rural Pennsylvania I mean, it was a complete… rural: area where there is a lot of farm land Kristin: Oh gosh culture shock: feeling uncomfortable when...
- 3
- 408
- 2
moving as a child part 1 ms
... is an army brat What is he? An army brat, he is an army brat Is he an army brat or a plumber? An army brat, he is an army brat Who is an army brat? Is Alex an army brat? Yes, he is Alex is an army ... were uncomfortable living in a rural area and a rural area has a lot of farmland, so living in a town that had a lot of farmland made them feel uncomfortable or made them feel like it was culture ... to was rural Did the town that they moved to have a lot of farmland? Yes, it did It was rural, which is the same thing as saying it had a lot of farmland Rural means it had a lot of farmland...
- 16
- 323
- 3
moving as a child part 1 pov
... Moving As A Child Part POV Lesson * * * * * Okay, so that is the story as if it is happening in the past; as if it has already happened Now let’s hear the story as if it is happening in ... story happening four years from now or, say, in four years Okay, here we go * * * * * In four years Alex’ll be twelve years old He’ll be an army brat His dad will join the Army Alex and his parents ... I am twelve years old I am an army brat My dad joined the Army before I was born My parents and I lived on the moon for two years Then, out of the blue, we moved to America Right off the bat,...
- 3
- 271
- 1
moving as a child part 1 vocabulary
... Now a county… This is a large area that has a city or cities within it For example: You have a city or cities and then you have a county that has the city or cities within it And then a state has ... conversation “Moving As A Child Part 1.” If you feel that you need to, go back and listen as many times as you need to, to make sure that you understand or have a basic understanding of the vocabulary ... Vocabulary Lesson Okay so getting back to the conversation… Joe is saying, “can actually be pretty traumatic to something like that as a kid.” To something such as that as a kid, or child And...
- 9
- 352
- 2
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008