1 display the properties of an item as a list
Tài liệu 13 Days The Chronicle of an Escape from a German Prison doc
... heavily, as he always had a waiting -list and continuous work to for the prisoners As a man he was about as unfit for war as anyone could imagine, and yet they called him up eventually Being a ... we had been able to purchase through a tradesman, who was allowed into the barracks twice a week As nearly all great-coats and waterproofs had been taken away from prisoners at the time of their ... have heard it actually said by a German that he read it so as to get news of the war, the German papers containing nothing but stuff entirely favourable to the Fatherland There was an official report...
- 71
- 446
- 0
A Study on the Effects of Argentine Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly pptx
... for their assistance with this study This work was supported by a grant from the Marian Chace Foundation to Madeleine Hackney and a grant from the American Parkinson Disease Association to Gammon ... suggested that the basal ganglia, the area of neurological degeneration in those with PD, are specifically involved in the control of dance movements Increased activity in the basal ganglia was observed ... compared to walking on clinical measures of balance and gait in the frail elderly They noted greater improvements in balance and complex gait tasks in the tango group as compared to the walking group...
- 19
- 648
- 0
Báo cáo toán học: " Permutations which are the union of an increasing and a decreasing subsequence" doc
... separation meaning; for example, if R and W are red and white points we would have R W and W < R Furthermore, the green and blue points are increasing, the red and yellow points are decreasing, ... the blue points are increasing, and nor, by hypothesis, can both be white Further, neither can be red or green since R G and R and G are the maximal red and green points under “ ” Thus at least ... indeed yield a pair of increasing and decreasing subsequences whose union is σ The left-hand side of the equation in the lemma therefore counts the number of increasing, decreasing pairs (α, β)...
- 13
- 348
- 0
báo cáo khoa học: " Using the theory of planned behaviour as a process evaluation tool in randomised trials of knowledge translation strategies: A case study from UK primary care" pot
... was calculated as the mean of all items contributing to the construct Cronbach’s alpha was used to ascertain the reliability of each of the scales If reliability was lower than 0.7, an exploratory ... fidelity of implementation; mechanisms, mediators, and the process of change; acceptability) and often encompass a range of methods [17-19] There are few RCTs of professional behaviour change strategies ... intention and behaviour, because the behaviour data were at a practice level, a summary measure of intention for each practice had to be calculated This was generated in two ways – by taking the mean...
- 9
- 367
- 0
Báo cáo y học: "Unusual presentation of cactus spines in the flank of an elderly man: a case report" pdf
... manuscript was written by AS and critically evaluated by SF, LP, and RD All authors read and approved the final manuscript Acknowledgements We would like to thank Dr Daniel Merrick, MD and Dr Whitney ... interests The authors declare that they have no competing interests Authors' contributions AS, SF, LP, and RD analyzed and interpreted the patient data regarding the foreign body of the skin The manuscript ... dictates the tissue reaction, as some types of foreign bodies are more toxic and allergenic than others Organic matter, such as spines and splinters, is highly inflammatory, whereas glass, metal,...
- 4
- 327
- 0
Báo cáo y học: "The efficacy of Link N as a mediator of repair in a rabbit model of intervertebral disc degeneration" ppt
... preparation of the manuscript RP, TY and AH performed data acquisition and statistical analysis PJR participated in the design of the study and interpretation of the data, and revised the manuscript JA ... COL 1A1 Forward: AGGGCCAAGACGAAGACATC 62 Reverse: AGATCACGTCATCGCACAACA RNA extraction and gene expression analyses Nine rabbits were euthanized weeks after either Link N or saline injection, and ... animals such as rodents because of the small size and volume of their discs In addition, the NPs cells remain notochordal in the adult, unlike the human and many large animal models On the other...
- 9
- 402
- 0
A study on the bennefits of using portfolios as a means of assessment in the writing development for the third year stdents of english at hanoi pedagogical university no 2
... i ABSTRACT Since the application of Communicative Language Teaching approach to EFL teaching, process writing and collaborative learning have been greatly emphasized as typical features of teaching ... .46 APPENDICES v LIST OF ABBREVIATIONS CAE Certificate in Advanced English CEFR Common European Frame of Reference for Languages EFL English as a Foreign Language ESL English as a Second Language ... reasons for choosing the topic, objectives, scope, tasks and significance of the study, the research method as well as an overview of the thesis Chapter two, Theoretical background, lays the theoretical...
- 65
- 893
- 7
The phenomenon of evaporative cooling from a humid surface as an alternative method for air-conditioning
... stillness of the air film, reaching really high heat-transfer areas in compact distributions [7] As the main resistance to heat-transfer can be found in the air on the dry face of the system, the advantage ... stream and transfer it to the secondary air in the evaporative cooling process They can be made either of metal or plastic and must easily conduct heat, maintain the two streams separated and ... before, which are made of ceramic material, another device mainly made of wet textile band has been designed, manufactured and characterised It is basically a cotton band of 25 cm width and 1600 cm...
- 28
- 652
- 0
An investigation into the effects of brainstorming and giving a text as model on phan dinh phung high school student's attitude and writing ability
... ideas, students reading a model and vocabulary and organization Actual writing task analyzing the model Actual writing task Table 2: The steps of a writing lesson of the experimental group and ... model Tables 10: The reasons for the approval the application of giving a text as a model in the future Table 11: The reasons for the disapproval of application of giving a text as a model in the ... criteria On seeing that a group has two or three ideas written down, the teacher ask them on the board Then teacher ask the other groups to add on the board any thoughts or ideas that they may have...
- 60
- 717
- 0
Tài liệu Báo cáo khoa học: Understanding the binding properties of an unusual metal-binding protein ) a study of bacterial frataxin pdf
... ratios: at a : Fe2+ ⁄ protein ratio, the resonances of Arg20, Asp22 and Asp23 disappeared, and the resonance of Leu21 shifted At a : ratio, the resonances of residues 19 and 44 also disappeared, ... spectrum of CyaY, but the most striking consequence of the addition was the total disappearance of specific resonances without the concomitant appearance of other signals in other parts of the spectrum ... ⁄ iron ratio were again those of Arg20, Leu21, Asp22 and Asp23 At a : ratio, the above resonances disappeared completely, together with those of the amides of residues 29, 30 and 31 At a : protein...
- 12
- 704
- 0
Báo cáo hóa học: " Quantification of the effects of an alpha-2 adrenergic agonist on reflex properties in spinal cord injury using a system identification technique" pptx
... seated and secured in an adjustable chair with the ankle strapped to the footrest and the thigh and trunk strapped to the chair The seat and footrest were adjusted to align the ankle axis of rotation ... and the best measure was considered as maximum voluntary contraction Range of motion Range of motion was determined with the subject's ankle attached to the motor The ankle range of motion was ... and writing the manuscript DC referred the patients and participated in interpreting data, and WZR participated in interpreting data and writing the manuscript All authors read and approved the...
- 7
- 465
- 0
Science Report: "Determining the value of an exchange energy of corn as feed for chickens by direct methods" pps
... 79.40% range The analysis result also showed that the variation of water content of maize between 10.90 49 The determination of apparent metabolizable energy (AME) - 13.31 %, in the standard range ... the GE value was the samples of LCH9 variety (2.64%) The less the coefficient of variation was, the more stable the GE value of corn variety was, and vice versa Our result in measuring the GE ... A. A., Figuerelo A. N., Racanicci A. M.C., Gaiotto J.B and Sorbara J.O.B.(2004) Determination of the energetic value of corn, soybean and micron zed full fat soybean for newly hatched chicks Brazilian...
- 7
- 285
- 0
Báo cáo y học: "Immunomodulatory properties of mesenchymal stem cells: a review based on an interdisciplinary meeting held at the Kennedy Institute" potx
... ensure that bioassays include animal based, cellular and biochemical systems A model of vasculogenesis in a SCID mouse was presented as an example Conclusion The potential antiproliferative and immunodulatory ... On the other hand, MSCs may also actively participate in initiating AD [3], they have the potential to favour spread of melanoma metastases [4] and, although mostly immune privileged, they may ... KW, MacKenzie TC, Shaaban AF, Radu A, Moseley AM, Deans R, Marshak DR, Flake AW: Human mesenchymal stem cells engraft and demonstrate site-specific differentiation after in utero transplantation...
- 10
- 559
- 0
báo cáo khoa học:" Psychometric properties of an instrument for assessing the experience of patients treated with inhaled insulin: the Inhaled Insulin Treatment Questionnaire (IITQ)" pdf
... version of the IITQ the authors discussed these discrepancies with the translators in order to arrive at an IITQ translation that was as close as possible to the meaning of the original English ... Maryland, USA Authors’ contributions RRR and MP conceived of the study, participated in the design of the study, and drafted the manuscript MP performed the statistical analysis RRR and MP read and ... rapid-acting insulin aspart as an adjunct to basal insulin therapy Subjects in the second study were adults with type diabetes randomized to treatment with mealtime TI 2-3 times a day and basal...
- 8
- 309
- 0
Báo cáo y học: "Characterization of the HIV-1 RNA associated proteome identifies Matrin 3 as a nuclear cofactor of Rev function" ppsx
... siRNA- mediated knockdown of MATR3 Pools of siRNAs were obtained from Dharmacon: MATR3 siGENOME SmartPool (UAGAUGAACUGAGUCGUUA, GACCAGGCCAGUAACAUUU, ACCCA GUGCUUGAUUAUGA, CCAGUGAGAGUUCAUUU AU), ... data AM conceived and coordinated the study, analyzed the data and wrote the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they have ... experiments and analyzed the data JG participated in the real-time PCR AK participated in the characterization of the cell clones DK participated in the knockdown experiments MPM produced and analyzed the...
- 15
- 470
- 0
Báo cáo y học: " HIV-1 Rev oligomerization is not obligatory in the presence of an extra basic domain" doc
... localization was predominantly nuclear and nucleolar while the M4 mutant localized mainly to the cytoplasm with a weak nucleolar and nucleoplasmic staining (Figure 2, panels a and b) The addition ... Leica PowerScan software attached The figures were created using the program Adobe Photoshop version 3.0 The bands of the western blot analysis were scanned using an Agfa Snapscan 600 flatbed scanner ... The rev coding region from pcrevM4 was amplified using the primer pairs tcgaagctagtcgacatctcctatg / cggggtaccgcctccttctttagctcc (PCR A) and cggggtaccggaatggcaggaagaagc / ctccagttggtagagagagcag...
- 8
- 316
- 0
Stock price reaction to the announcement of a reverse stock split, an investigation as a function of the rationale provided
... Descriptive Statistics (includes all cases) 178 Table A6 : Summary of Descriptive Statistics for AREs and CARs 179 Table A7 : ARE and CAR Means and Standard Deviations for No Rationale and Rationale Groups ... requirement SmallCap companies may receive an additional 180 day grace period to achieve compliance Hence, a National Market company may transfer to the Nasdaq SmallCap Market, provided all other listing ... Table A1 4: Listing of Companies in Final Sample Under Their Respective Stock Exchange Listing 187 ix Table A1 5: ARE and CAR Means and Standard Deviations by Stock Exchange Listing 188 Table A1 6:...
- 217
- 227
- 0
The Heart of an Assassin
... Bertot Table of Contents Chapter1 -The Call Chapter2 -An Assassin’s Attorney and Accountant Chapter3 -The Giordano Family Chapter4 -The Costellino Family Chapter5 -The Arrival Chapter6-Help From A Stranger ... it as Tim Goldman An Assassin’s Attorney and Accountant David Spencer had known Jack Ferrari for over four years Jack hired David to take care of his finances and to be his advisor on legal matters ... used as an office The entire house was kept in a very neat and orderly manner Some might call it the ideal bachelor pad However, the stranger had never had a visitor, and it was the solitude and...
- 18
- 374
- 0
A STUDY ON THE USE OF CLASSROOM DISCIPLINE AS MOTIVATION FOR SECOND LANGUAGE ACQUISITION IN THE CONTEXT OF ENGLISH LANGUAGE TEAC
... all, a teacher can be addressed as a manager, an instructor, a resource, a guide, an evaluator, an organizer who helps facilitate and accelerate the learning process In this light, a number of ... foreign languages in general as well as attitudes towards the specific language community and integrative orientation to language study The second is attitudes towards the language situation as a whole, ... which the learners’s community and the target language community view each other.” 1.6.2 Accommodation Theory Accommodation Theory provides an explanation of language-learner language variability...
- 41
- 886
- 12
- the purpose of an objective on a resume
- finding the order of an element in a factor group
- the nature of teaching english as a foreign language
- what is the origin of english language as a means of communication in nigeria
- to determine the position of the image of an object in a mirror
- explain the function of operating system as a resource manager
- the importance of english language as a means of communication
- alphabetize the properties of each rule in a css file
- 1 detecting the availability of an accelerometer
- the tradition of bureaucratic elites as a privileged group
- § 4 the proper subject of the right of unilateral secession as a criterion for statehood
- the emergence of clinical psychology as a profession
- work with the properties of an object
- quot with the very best of intentions quot the development of nursing process as a way of knowing
- 1€ detecting the availability of an accelerometer
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25