the importance of english language as a means of communication

Ngày tải lên: 16/07/2015, 07:45

... can cause shattering of rock fragments. Clay is produced by chemical weathering. In the case of rocks such as granite, when the clay-producing parts are weathered away the more resistant quartz ... differentiate the term from other members of its class. For example, a definition of a giraffe should include a classification, such as, A giraffe is an animal, and specific characteristics, such as, A ... by the plant roots is called the available water. The amount of water which is then retained by the soil is called the field capacity Here the clauses in italics define the kind of water: they...

Ngày tải lên: 05/03/2014, 20:20

... process may be described as holistic or “conceptually driven” (Brown) in that they focus on the overall meaning of a passage, and the application of schemata. Schemata are mental frameworks based ... to make in their skill. The time for the test was within fifteen minutes. During the test, the teacher worked as a cassette player and examiner. The marking was done with the same way of assessment ... that deal with a particular theme or emotion appear in a song. To do this task, teacher writes the name of the song on board and then ask students to write down any words they think can appear...

Ngày tải lên: 29/01/2014, 10:33

... Georgetown, Texas. 25. Brunk, U.T. & Terman, A. (1999) The mitochondrial-lysosomal axis theory of cellular aging. Understanding the Basis of Aging: the Roles of Mitochondria, Free Radicals, and Antioxidants (Cadenas, ... maintenance. Mitochondria are the main source of ROS formation, as well as the main target for free radical attack. The accumulation of defective mitochondria within aging cells suggests that some are not properly autophagocytosed. Aged ... explanations of aging, such as Orgel’s error catastrophe theory and the somatic mutation theory, were based on the idea that aging results from the accumulation of synthetic errors [26,27]. Adequate support for...

Ngày tải lên: 17/03/2014, 23:20

... Idem MAP2-for MAP2-rev GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC 91489–91517 92431–92404 NC_000067 Idem Tau-for Tau-rev GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC 78772–78800 79013–78981 NC_000077 Idem STOP-for STOP-rev AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG 210–237 657–631 NC_000073 ... Idem Doublecortin-for Doublecortin-rev CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG 705–728 967–943 NM_010025 Idem LIS1-for LIS1-rev CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG 1288–1303 1427–1407 NM_95116 Idem Tubulin a6 -for Tubulin a6 -rev AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 6854–6876 7646–7624 NC_000081 ... Quı ´ mica Biolo ´ gica, Facultad de Ciencias Quı ´ micas, Universidad Nacional de Co ´ rdoba, Argentina 2 Departamento de Biologı ´ a Molecular, Facultad de Ciencias Exactas, Fı ´ sico-Quı ´ micas...

Ngày tải lên: 23/03/2014, 05:22

... from the Marian Chace Foundation to Madeleine Hackney and a grant from the American Parkinson Disease Association to Gammon Earhart. References Argue, J. (2000) Parkinson’s disease and the art of ... Responses The tango group stated on the exit questionnaire what they liked best and least about the program. They greatly appreciated the camaraderie and socialization engendered by the program. Being ... press the wand backwards (arms still behind chair). e. Finger roll: As fast as you can, then as slow as you can; Rolling out to the sides of the wand, and back to center. Come up with your own plan! From...

Ngày tải lên: 28/03/2014, 20:20

... cell growth. What, then, is the role of the alternative pathways of pyruvate catabolism that lead t o the formation of t he C4 compounds, acetoin and diacetyl? The availability of citrate rather than of ... L. lactis strain B7/ 2147 has diminished, rather than deleted, a- acetolactate decarboxylase activity because strains characterized as lacking a- acetolactate decarboxylase [22] do not show a similar ... or the p roducts [11]. esoculg 5.0 etartic etavuryp etatcal α etatcaloteca- etamrof A oC-lyteca HDAN D AN + HDAN DAN + nioteca l y tecaid P-lyteca eta teca HDAN DAN + PDA PTA HDAN DAN + PTA PDA 1 2 4 a6 ,5 7 b6 3 8 9 31 21 01 ed y hedlatec a D A N + HD A N HDAN DAN + l o n a hte 11 HDAN D AN + l o id - 3 , 2 - n a tu b 7 Fig....

Ngày tải lên: 30/03/2014, 15:20

... complex and the initiation of intracellular signaling events regulating oxi- dase assembly and activation has been described [31,32]. The NADPH oxidase The phagocytic NADPH oxidase plays an essential ... production of these free radicals can damage tissue adjacent to the sites of inflammatory action; therefore, the activation of the NADPH oxidase is tightly controlled though regulated assembly of the ... Tanino H, Kawakami N, Okamura N, Kodama H, Yamaguchi T, Hayakawa T, Nunomura A, Chiba S, Perry G, Smith MA, Fujimoto S: Activation of NADPH oxidase in Alzheimer's dis- ease brains. Biochem...

Ngày tải lên: 19/06/2014, 22:20

... RESEARC H Open Access The applicability of normalisation process theory to speech and language therapy: a review of qualitative research on a speech and language intervention Deborah M James Abstract Background: ... prepared this article whilst employed as an academic speech and language therapist in Speech and Language Sciences at Newcastle University, UK. During that time she was a collaborating member of ... speech and language therapy at the end of the intervention, the belief that the expertise in the intervention remains with the speech and language therapist, and the limited role that parents place...

Ngày tải lên: 10/08/2014, 11:20

... interpreted the patient's data, devised the therapeutic plan, and wrote the manuscript. TI helped in planning the therapeutic plan and drafting the manu- script. All authors read and approved the ... was obtained from the patient for endovascular treatment. As an initial treat- ment option, hepatic venous balloon dilation was per- formed eight months after surgery. A transluminal angioplasty ... decreased unexpectedly to near the normal range, refractory ascites remained. Therefore, the patient under- went endovascular stent placement therapy seven weeks later. A self-expandable metallic...

Ngày tải lên: 11/08/2014, 12:20

Ngày tải lên: 12/08/2014, 17:22

... fitted as global parameters, whereas the maxi- mum response R max was fitted as a separate parameter for each binding sensorgram. The dissociation constant was obtained as K d ẳ k off k on . NMR All ... human GABA A receptor-associated protein (GABARAP) is a protein implicated in the trafficking of GABA A receptors to the plasma membrane [2,3]. Keywords calreticulin; GABA A receptor; GABARAP; phage ... Identification of calreticulin as a ligand of GABARAP by phage display screening of a peptide library Jeannine Mohrlu ă der 1,2 , Thomas Stangler 1,2 , Yvonne Hoffmann 1,2 , Katja Wiesehan 2 , Anja Mataruga 3 and...

Ngày tải lên: 16/03/2014, 05:20

... • Disease progressed on a hormonal agent and thus suitable for “withdrawal” from an endocrine agent as a therapeutic option (as opposed to a palliative option) ã Assessable lesions were ... elderly (age > 70 years), locally advanced or metastatic breast cancer; (2) disease deemed suitable for treatment by hormonal manipulation; (3) disease assessable by UICC criteria; (4) received ... relevance of “withdrawal therapy” as a form of hormonal manipulation for breast cancer. World Journal of Surgical Oncology 2011 9:101. Submit your next manuscript to BioMed Central and take full advantage...

Ngày tải lên: 09/08/2014, 02:21

... in the anatomical area of the right adnexa. Our patient had developed a pyosalpinx as a Sequela of labial fusion. At laparoscopy the right pyosalpinx was identified and resected, whereas the ... complications of this presentation are infections of the urinary tract and retention of urine in the vagina. We present the case of a post-menopausal woman with adnexal mass and abdominal pain ... Dissected labia majora. Post-operative appearance of the labia after the blunt dissection and separation. Figure 3. Pyosalpinx. Intra-operative image of the fallopian tube during laparoscopic...

Ngày tải lên: 10/08/2014, 22:20

... options: a local skin flap and a split skin graft [7-11]. The posterior scrotal and the perineal skin have a collateral lymphatic drainage and are usually available and can be used to generate flaps ... interests. Authors' contributions AA saw and operated on the patient. SS was the major contributor in the prep- aration and revision of the manuscript. Both authors have read and approved the final ... of the manuscript. Author Details Faculty of Medicine, Universiti Teknologi MARA, Level 11, Dean's Office, Selayang Hospital, Selayang-Kepong Road, Batu Caves, Selangor 68000, Malaysia References 1....

Ngày tải lên: 11/08/2014, 12:20

... Case report Open Access Serous labyrinthitis as a manifestation of cat scratch disease: a case report Ilias Kantas 1 *, Michael Katotomichelakis 2 , Marinos Vafiadis 1 , Zografia V Kaloutsa 1 and ... may occur. Many manifestations of the disease have been reported by different medical disciplines. Case presentation: A case of cat scratch disease in a 71-year-old Greek woman with an unusual clinical ... fixation. The direction of the fast phase of the nystagmus toward the site of the lesion along with the presence of a directional preponderance (83%) towards the side of the lesion showed an...

Ngày tải lên: 11/08/2014, 17:21

... Central Page 1 of 3 (page number not for citation purposes) Journal of Medical Case Reports Open Access Case report Bilateral macular hemorrhage as a complication of drug-induced anemia: a case ... severe neutropenia. Bone marrow aspirate was normocellular with hyperplasia of the erythrocytic lineage, with mega- loblastic and dysplasic elements. The granulocytic lineage showed hypocellularity and dysgranulopoiesis ... mat- uration asynchronism. The megakaryocytic lineage was preserved and there was a low-grade plasmacytosis of 6.2% of the total cells. These findings were compatible with drug-induced bone marrow...

Ngày tải lên: 11/08/2014, 19:21

Ngày tải lên: 13/08/2014, 13:21

Ngày tải lên: 13/08/2014, 16:20

Ngày tải lên: 13/08/2014, 23:20