the tradition of bureaucratic elites as a privileged group

... suggested that the basal ganglia, the area of neurological degeneration in those with PD, are specifically involved in the control of dance movements Increased activity in the basal ganglia was observed ... compared to walking on clinical measures of balance and gait in the frail elderly They noted greater improvements in balance and complex gait tasks in the tango group as compared to the walking group ... for their assistance with this study This work was supported by a grant from the Marian Chace Foundation to Madeleine Hackney and a grant from the American Parkinson Disease Association to Gammon...

Ngày tải lên: 28/03/2014, 20:20

... was calculated as the mean of all items contributing to the construct Cronbach’s alpha was used to ascertain the reliability of each of the scales If reliability was lower than 0.7, an exploratory ... intention and behaviour, because the behaviour data were at a practice level, a summary measure of intention for each practice had to be calculated This was generated in two ways – by taking the mean ... the measurement of serum ferritin in the assessment of microcytic anaemia (ferritin), the measurement of serum follicle stimulating hormone (FSH) in the assessment of menopausal status, and the...

Ngày tải lên: 10/08/2014, 10:23

... program for MATLAB software (Natick, MA, USA) by an orthopedic researcher who was blinded to the treatment groups The average of the disc height index (DHI) was calculated as a ratio of the average ... COL 1A1 Forward: AGGGCCAAGACGAAGACATC 62 Reverse: AGATCACGTCATCGCACAACA RNA extraction and gene expression analyses Nine rabbits were euthanized weeks after either Link N or saline injection, and ... Reverse: GGAGAACATATGGTCCCAACGT GAPDH Forward: ACTCTGGCAAAGTGGATG 60 Reverse: TCCTGGAAGATGGTGATG expression of the Link N-treated discs was normalized to saline-treated discs Biochemical analysis...

Ngày tải lên: 12/08/2014, 17:22

... i ABSTRACT Since the application of Communicative Language Teaching approach to EFL teaching, process writing and collaborative learning have been greatly emphasized as typical features of teaching ... research questions are also clearly stated to act the parameter for the whole paper I.1 RATIONALE A vast body of research has studied writing portfolios as a form of assessment tool or in terms of ... reasons for choosing the topic, objectives, scope, tasks and significance of the study, the research method as well as an overview of the thesis Chapter two, Theoretical background, lays the theoretical...

Ngày tải lên: 16/07/2015, 07:45

... criteria for participation in a previous questionnaire survey [4] This was true, as their median number of maintenance care patients was about twice as high as that of the Swedish participants ... questionnaire, these are listed under A- F An additional, "neither of the above, please explain"alternative was also available (G), with the possibility to provide ones own alternative answer (Additional ... generally failed to provide a clear definition of maintenance care but that they rather described various aspects associated with it For this reason, we had to approach the analysis in a different way...

Ngày tải lên: 13/08/2014, 14:20

... until the air reaches its saturated state, when the air and water temperature reach the same value, called “adiabatic saturation temperature”, being the process known as “adiabatic saturation” ... where air and water are in contact, water will always tend to adiabatic saturation temperature, as in the case of the adiabatic tunnel described before To clarify what has been exposed before, the ... evaporated at that temperature Isolation Non-saturated air Saturated state had sat = h1 Tad sat RH = 100 % T1 RH1/ h1 Isolation Water suppy at Tad sat Figure Adiabatic saturation tunnel In the last...

Ngày tải lên: 05/09/2013, 16:10

... (1996) accepts the view of discipline as a synthesis presence of a number of complementary factors She also emphasizes the equal importance among the factors as well as pictures the general look of ... that is answerable to the writer’s later classification of four main types of learners: the enthusiasts, the oracular, the participator and the rebel Generally speaking, a learner’s role is place ... foreign languages in general as well as attitudes towards the specific language community and integrative orientation to language study The second is attitudes towards the language situation as a whole,...

Ngày tải lên: 07/09/2013, 13:06

... model Tables 10: The reasons for the approval the application of giving a text as a model in the future Table 11: The reasons for the disapproval of application of giving a text as a model in the ... students began to be regarded as thinker or creators of language, instead of the traditional views as empty to be regarded ad thinkers or creators of language, instead of the traditional view as empty ... had classes taking in the experiment 1 1A1 2 class (brainstorming- B group ) was the experimental group and 11 A1 3 class (giving a text as a model M group) was the control one As mentioned earlier...

Ngày tải lên: 18/12/2013, 10:08

... For a few moments, close your eyes and imagine you are in a theater In front of us is the stage To the left, Itzhak Perlman sits in his chair, near the conductor The orchestra has already played ... the first two movements of Beethoven's D Major Concerto The violin leads us to the third, and immediately announces the major theme Listen now as Itzhak Perlman performs with the Philharmonia ... Orchestra of London Carlo Maria Giulini is the conductor (MUSIC) Our program was written and produced by Paul Thompson I’m Steve Ember Join us again next week for the VOA Special English program THIS...

Ngày tải lên: 11/03/2014, 15:38

... as a substrate for localization of the labeled MYP Statistical analysis Data were expressed as the mean ± SEM Statistical analysis was performed using instat software (GraphPad Software) The ... testis at stage 1, and eggs In all of the samples analyzed, a large protein peak was observed at an elution position of 72 mL (peaks a, b, c, and d), where the estimated molecular mass was about ... normality of the distribution of data was evaluated using the Kolmogorov–Smirnov test The equality of the standard deviations of the groups was assessed with Bartlett’s test The Tukey–Kramer...

Ngày tải lên: 16/03/2014, 05:20

... aging A number of early explanations of aging, such as Orgel’s error catastrophe theory and the somatic mutation theory, were based on the idea that aging results from the accumulation of synthetic ... Mitochondrial free radical generation, oxidative stress, and aging Free Rad Biol Med 29, 222–230 44 Takasawa, M., Hayakawa, M., Sugiyama, S., Hattori, K., Ito, T & Ozawa, T (1993) Age-associated damage ... replicative advantage of human mtDNA carrying a point mutation that causes the MELAS encephalomyopathy Proc Natl Acad Sci USA 89, 11164–11168 49 Wallace, D.C (1997) Mitochondrial DNA in aging and disease...

Ngày tải lên: 17/03/2014, 23:20

... GTTGGTCTCGTCGCTCATCACATCACGAGG GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG ... GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 82898–82923 83581–83552 91489–91517 ... simultaneously with antitubulin (DM 1A) and anti-actin (lanes and 2) Other samples were stained with antineurofilament protein (lanes and 4) The volume of each sample was adjusted to load a similar amount...

Ngày tải lên: 23/03/2014, 05:22

... sends the data to a specific device or machine that then copies the data to the various people that are subscribers to the data For example, a user send their data to a multicast address and the ... estimated that only about 5–10% of the available fiber has been lit, and each fiber has several terabits/s of capacity The dot-com implosion has made this dark fiber and wavelengths of light in the ... was a landscape consisting of mountains, meadows, sky and clouds The floor was the distance from the subject's eyes to the virtual floor and the nearest column was 4.6 m away The resolution of...

Ngày tải lên: 19/06/2014, 10:20

... microglial NADPH oxidase maybe largely responsible for the oxidative damage observed in the AD brain Astrocytes and the NADPH oxidase Astrocytes are the most abundant glial cell type in the brain and ... Shimohama S, Tanino H, Kawakami N, Okamura N, Kodama H, Yamaguchi T, Hayakawa T, Nunomura A, Chiba S, Perry G, Smith MA, Fujimoto S: Activation of NADPH oxidase in Alzheimer's disease brains Biochem ... complex and the initiation of intracellular signaling events regulating oxidase assembly and activation has been described [31,32] The NADPH oxidase The phagocytic NADPH oxidase plays an essential...

Ngày tải lên: 19/06/2014, 22:20

... htob erusaem ot desu saw )ASU ,tneligA( nevo nmuloc a dna ,)ASU ,tneligA( relpmasotua na ,)ASU ,tneligA( ressaged a ,)ASU ,tneligA( pmup a ,)ASU ,tneligA( rotceted VU yarra edoidotohp a gnidulcni ... LA1050-PV rof alumrof eninala dica onima eht yb ytilibaliavaoib fo tnemevorpmi ehT etadidnac gurdorp wen a rof yrotcafsitas erew amsalp ni noitartnecnoc fo ecnanetniam eht dna ,mrof evitca na ... noitartsinimda suonevartni retfa 2050-PV fo sretemarap citenikocamrahP elba T 562 star ni tnega VIH-itna wen a sa gurdorp dehcatta-dica onima eht fo ytilibaliavaoiB nwohs sah ,siht ot roirp demrofrep...

Ngày tải lên: 07/08/2014, 23:22

... International, Kanata, Ontario, Canada) was used as the ionizing radiation source The irradiator was calibrated with thermoluminescent dosimetry chips implanted in phantom mice The radiation ... radicals and thus reducing indirect DNA damage As a measure of radiation-induced DNA damage, we evaluated induction of nuclear foci of phosphorylated histone H2AX (γH2AX), which has been established ... manuscript AB assisted in drafting the manuscript, performed the in vitro work and molecular work, and assisted in the animal studies AS and AT performed the animal work and assisted in drafting the manuscript...

Ngày tải lên: 09/08/2014, 08:23

... with a ratio of patient’s plasma to normal plasma of 1:1) (Figure 1) Quantitative assays revealed a reduced level of factor VIII activity (1%) and the presence of factor VIII inhibitor measured at ... etiology of acquired hemophilia A remains unclear In approximately half of cases, factor VIII autoantibodies occur in patients without any identifiable cause, while the remaining cases may be associated ... patient data and was a major contributor in writing the manuscript JR analyzed the patient data and contributed in writing the manuscript RP and BE analyzed and interpreted the patient data and were...

Ngày tải lên: 11/08/2014, 03:20

... with a ratio of patient’s plasma to normal plasma of 1:1) (Figure 1) Quantitative assays revealed a reduced level of factor VIII activity (1%) and the presence of factor VIII inhibitor measured at ... etiology of acquired hemophilia A remains unclear In approximately half of cases, factor VIII autoantibodies occur in patients without any identifiable cause, while the remaining cases may be associated ... patient data and was a major contributor in writing the manuscript JR analyzed the patient data and contributed in writing the manuscript RP and BE analyzed and interpreted the patient data and were...

Ngày tải lên: 11/08/2014, 07:20

... contains two interactive scenarios for each of the topic areas of advanced cardiac life support, of acute leg swelling and of acute coronary syndrome The cases are detailed and well presented Each ... concentrate on basic life support and advanced cardiac life support algorithms Many clinicians may find these scenarios somewhat simplistic, but individuals who have recently completed the basic ... Critical Care April 2003 Vol No Scales Overall, I found the trauma scenarios to be well presented and educational More importantly, they were actually fun to work through, and seemed to be appreciated...

Ngày tải lên: 12/08/2014, 19:22

... them As an example, anaerobic bacteria and methanogenic archae form compact microbial granules that operate like an organ rather than a group Page 29 of 66 Kurakin Theoretical Biology and Medical ... of cellular constituents Second, in the same way as the pKa of an isolated amino acid and the pKa of the same amino acid embedded within protein matrix may differ dramatically, the redox behavior ... large-scale relaxation and restructuring Note that the adaptability of the whole is built upon and depends upon the adaptability of its individual parts and that the adaptations of a part or the...

Ngày tải lên: 13/08/2014, 16:20