08 degeneration regeneration as a mechanism contributing to the effect of manual acupuncture induced injury on rat skeletal muscle
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc
... remains to be assessed One potential limitation of the process is the identification of those antigens that are the most relevant as targets, as the human auto-antigen-specific T cell repertoire ... development of splenomegaly and autoimmunity, demonstrating that disease symptoms in STAT5 mice are due to defective Treg cells [48] Another player in the IL-2 signaling cascades is the Jak3 kinase Jak3 ... mechanisms of its action on Treg cells We then move on to describe how this data can be translated to applications for human autoimmune diseases by using IL-2 as a therapeutic agent to restore Treg cell...
- 12
- 573
- 0
Tài liệu A thesis submitted to The University of Birmingham for the degree of Clinical Psychology Doctorate docx
... calculated as 82 It is unclear, but Fabiani et al (1996) and Fabiani et al (2000) appear to report the same participants Karwautz at al (2 008) and Wagner et al (2 008) report the same participants, ... exercises only Not an original article (i.e review, editorials, letters, conference abstracts) Data extraction In order to ease extraction of information from papers, a data extraction form was used to ... replication? Is there a control group? Is the design longitudinal? Sub-total Sample and measures Response rate satisfactory? Sampling source appropriate? Are participants sampled to minimise bias?...
- 171
- 709
- 0
Tài liệu Interest on Excess Reserves as a Monetary Policy Instrument: The Experience of Foreign Central Banks ppt
... of the gap between the Bank Rate and the SONIA rate, which has traded on average about basis points below the Bank Rate over this period, occasionally falling below the Bank Rate by as much as ... which was the main policy rate at the time, whereas the rate charged in the lending facility was 100 basis points above the official repo rate Since then, the rate paid on deposits has changed a number ... (Division of Monetary Affairs) and Spence Hilton (Federal Reserve Bank of New York), as well as from central bank colleagues at the Reserve Bank of Australia, the Bank of Canada, the Bank of England,...
- 49
- 653
- 0
Tài liệu Báo cáo khoa học: "A Practical Solution to the Problem of Automatic Word Sense Induction" doc
... words that are not among the top 30 first order associations to the ambiguous word These top 30 associations were computed fully automatically based on the log-likelihood ratio We used the procedure ... is capable of finding all the fine grained distinctions that are listed in manually created dictionaries such as the Longman Dictionary of Contemporary English (LDOCE), or in lexical databases ... in such a way that line crossings are avoided when connecting clusters As we can see, the dissimilarities among the top 30 associations to palm are all in the upper half of the scale and not...
- 4
- 536
- 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx
... ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R ... Fe(III)-nitrilotriacetic acid reductase activity in the absence of a competing metal substrate is set to 100% Relative activities are plotted as a function of increasing concentrations of either V(V) (as vanadate; ... name Sequence (5¢- to 3¢) OMCA-KO-F OMCA-KO-R OMCB-KO-F OMCB-KO-R OMCA-F OMCA-R OMCB-F OMCB-R OMCA-PBAD-F CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT...
- 11
- 731
- 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
... neurofibrillary degeneration Tau hyperphosphorylation occurs because of an imbalance in the activity of tau kinases and phosphatases [3] One particular tau kinase pertinent to metal dyshomeostasis in AD ... disrupt Ab–metal interactions may prevent more than Ab aggregation and plaque formation Tau The native function of the microtubule-associated protein tau is to maintain integrity of the cytoskeleton ... (1997) Abnormal phosphorylation of tau and the mechanism of Alzheimer neurofibrillary degeneration: sequestration of microtubule-associated proteins and and the disassembly of microtubules by the abnormal...
- 9
- 634
- 0
Báo cáo khoa học: "A Practical Solution to the Problem of Automatic Part-of-Speech Induction from Text" pdf
... Fortunately, the problem of data sparseness can be minimized by reducing the dimensionality of the matrix An appropriate algebraic method that has the capability to reduce the dimensionality of a ... to each value in the matrix.2 As usual, the one is added for smoothing purposes and to avoid problems with zero values We decided not to use a sophisticated association measure such as the log-likelihood ... with the resulting extremely sparse matrix is that most vectors are either orthogonal to each other or duplicates of some other vector, with the consequence that the dimensionality reduction that...
- 4
- 433
- 0
A further contribution to the study of the mortuary customs of the North American Indians docx
... Paskagoulas and Billoxis of Louisiana, may be considered as an example of burial in houses, although the author of the work was pleased to consider the receptacles as temples Les Paskagoulas et ... Captain Henning, an agent of the company who has long resided at Ounalaska In his transactions with the Indians he learned that tradition among the Aleuts assigned Kagamale, the island in question, ... day, and the near relatives of the deceased for several days thereafter As soon as able, the warrior friends of the deceased would go to a near tribe of their enemies and kill one or more of them...
- 108
- 604
- 0
Báo cáo khoa học: "Constituent-Based Morphological Parsing: A New Approach to the Problem of Word-Recognition" pdf
... possible to build a system which has a reasonable coverage of the morphological and phonological processes evident in the language At the same time, in order to cover the Warlpiri data the system ... Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra (man-ergative-aux kangaroo grass-obj shoot-past eat-infmitive-obj) 'The man is shooting the kangaroo while it is eating grass.' This example ... morphological processing to encode these notions We view the parsing system as a partial but general theory of morphological processing, and the work we have done on Warlpiri as a particular instantiation...
- 8
- 522
- 0
The road to reality a complete guide to the laws of the universe penrose, roger
... would regard mathematical objectivity as really what mathematical Platonism is all about To say that some mathematical assertion has a Platonic existence is merely to say that it is true in an objective ... less assured assertions referred to as postulates), which provided an excellent approximation to a particular aspect of the physical world That was the aspect of reality, well familiar to the ancient ... entities may relate to physical reality I recall that when at school, at the age of about 11, I was somewhat taken aback when the teacher asked the class what a fraction (such as 3) actually is! Various...
- 1,123
- 542
- 4
Báo cáo khoa học: "A Computational Approach to the Automation of Creative Naming" ppt
... knowledge, there is only one computational study in the literature that can be applied to the automatization of name generation Stock and Strapparava (2006) introduce an acronym ironic reanalyzer and ... “palatable” neologisms generated are eatalian (from the combination of eat and Italian), pastarant (pasta + restaurant) and peatza (pizza + eat) These three suggestions are amusing and have a nice ... between annotators, we calculated the majority class for each dimension With annotators, a majority class greater than or equal to means that the absolute majority of the annotators agreed on the same...
- 9
- 518
- 0
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt
... Nuclear DNA Chloroplast DNA Cyanidium caldarium Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana Nuclear DNA Chloroplast DNA Odontella sinensis Chloroplast DNA Prasinophyceae ... merolae Based on this they pointed out that the evolutionary history of the water oxidation domain in the red algae may be more complex as biochemical data suggests that the red alga C caldarium has ... M, Nakazato K & Shen J-R (1995) Isolation and characterization of a photosystem II complex from the red alga Cyanidium caldarium: association of cytochrome c-550 and a 12 kDa protein with the...
- 11
- 501
- 0
A Dissertation Presented to the Faculty of the Graduate School of Cornell University In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy potx
... the lattice it releases its extra electron Since the conduction band of GaAs is 0.19 eV below the conduction band of AlGaAs, negative charges fall toward the GaAs side but are attracted by the ... clamped graphene resonator thermal expansion along the length of the graphene will lead to out of plane motion For such an actuation scheme to work, the thermal time constant, 1/λ of the resonator ... investigation of many exotic properties of electrons in dimensions These GaAs/AlGaAs samples are the current state of the art in terms of charge carrier mobility in solid state systems As a comparison,...
- 140
- 510
- 0
Cinema 4D Training Introducing VRay: A short guide to the settings of VRayForC4D pptx
... is to use a VRayFastSSS2 material The parameters of which are available as an extension of the standard VRay Advanced material and as a standalone material called the VRayFastSSS2 material The ... use the SSS layer in the VRay Advanced material to make a semi accurate portrayal of a marble floor ‘VrayAdvancedMaterial’ and ‘VRayFastSSS2 Material’ SSS calculated as part of the refraction layer ... as the dark areas in the image Leave every other IR setting alone The first two parameters you come across are Min rate and Max rate These settings relate to the size of the IR map calculation...
- 35
- 1,091
- 4
a concise introduction to the theory of numbers- baker a.
... ,where Ax, A y, Az are rational for some A It had been noted, at least by the time of Bachet, that the chord joining any two rational points on the curve intersects the curve again at a rational ... point, and similarly that the tangent at a rational point intersects again at a rational point Thus, Fermat remarked, if there is a rational point on the curve other than the point at infinity, then, ... mathematician Diophantus of Alexandria at about the third century AD The Arithmetica was concerned only with the determination of particular rational or integer solutions of algebraic equations, but it...
- 54
- 527
- 0
Game Day: A Rollicking Journey to the Heart of College Football pptx
... which was a very good decision: he went on to play ten years of major league baseball His football background stayed with him, though, as he had a reputation as a hardass As a matter of fact, one ... Eric to this day and am glad to call him a friend I was so proud of him the day he was inducted into the Hall of Fame That tall, skinny kid at the car wash in Sealy went on to become one of the all-time ... Washington Redskins and Cleveland Browns of the NFL about to square off on a Saturday morning in Texas—and that I was either a star running back or linebacker Say what you want about visualization,...
- 255
- 305
- 0
a dissertation submitted to the faculty of the graduate school
... measurement noise as well as its impact to localization results For AOA measurements based on sensor array DOA (direction of arrival) estimation (e.g., an array of antennas, microphones, light sensors, ... Nevertheless, as many other radio based system, a 300 MHz clock is used in [121] for accurate timing 2.1.3 Angle of Arrival Another class of range-based localization is the use of angular estimates ... and calibration is essential In other words, the localization mechanism is highly preferred to function as an autonomous system that is free of in-field manual calibration and extensive environment...
- 188
- 887
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008