4 5 cre regulated recombination in a 24 hpt and b 7 dpf larval fish muscle cells arrows show the secondary colors β actin dtomato red β actin yfp yellow and β actin mcerulean blue scale bar 100 µm
The structure basis for burkholderia pseudomallei hcp induced multinucleated giant cell formation
... Gene CACATCCTCGCCTTCAA TCTCGAACTCTTCCATCATCT GTTCCATCGTTCACCAAGTG TTGCAGAAATGTGCTGAATG hcp1 rpoB 2.1.2 List of plasmids and < /b> bacterial strains Table 3: List of plasmids and < /b> strains Relevant characteristic(s )a < /b> ... and < /b> outbreak cases in < /b> new geographical regions, such as south and < /b> east Asia as well as parts of South America, Papua New Guinea, the Caribbean and < /b> Africa were reported 8, 17 21 There is also an ... in < /b> other bacteria Hcp has the ability to adhere to the surface of mammalian cells, and < /b> the functional consequence of this binding had been investigated in < /b> A < /b> hydrophila106 and < /b> meningitis-causing...
- 155
- 1,103
- 0
Báo cáo khoa học: "The interaction between different types of activated RAW 264.7 cells and macrophage inflammatory protein-1 alpha" potx
... reagent [1% sulfanilamide (Alfa Aesar)/0.1% N-(1-napthyl) ethylenediamine (International Laboratory USA) – each in < /b> 2 .5%< /b> H3PO4] in < /b> a < /b> 96-well plate at room temperature for 10 min, and < /b> the absorbance ... amplification by PCR, the forward primer for MIP- 1a < /b> was CTCCCAGCCAGGTGTCATT, and < /b> the reverse primer was GGCATTCAGTTCCAGGTCAG The forward primer for b- actin was CCGTGAAAAGATGACCCAG, and < /b> the reverse ... Sample absorbance was Page of measured with a < /b> Multiscan plate reader (Genios, Tencan) at a < /b> wavelength of 450< /b> nm The sample concentration was measured using a < /b> standard curve Real-time quantitative...
- 7
- 380
- 0
Báo cáo khoa học: Ascorbic acid-pretreated quartz enhances cyclo-oxygenase-2 expression in RAW 264.7 murine macrophages pdf
... (Fig 5B) was also significantly increased by incubation of the cells with AA-treated and < /b> untreated quartz, at all particle Fig NF-jB, pCREB and < /b> AP-1 nuclear translocation in < /b> quartz-treated RAW 264 .7 ... and < /b> multicomparison analysis NF-jB, pCREB and < /b> AP-1 nuclear translocation in < /b> RAW 264 .7 cells (Fig 5)< /b> In < /b> Fig 5A,< /b> B, data were checked with the F-test and < /b> analysed with analysis of variance and < /b> the ... concentrations of 15,< /b> 50< /b> and < /b> 100 lgÆmL)1, induced COX-2 synthesis in < /b> RAW 264 .7 cells (Fig 1A,< /b> black bars) as well as AA-treated quartz (Fig 1A,< /b> striped bars) The statistical analysis of variance showed...
- 14
- 253
- 0
Báo cáo y học: "Stable expression of a recombinant human antinucleosome antibody to investigate relationships between antibody sequence, binding properties, and pathogenicity" doc
... cells and < /b> treated with DNaseI before testing in < /b> the ELISA The addition of the COS -7 supernatant appears to have reinstated the binding of B3 VH /B3 3VL to dsDNA and < /b> also allows the binding of B3 VH /B3 VL ... Guth and < /b> colleagues [12] showed that arginine-to-serine mutations in < /b> VHCDR3 of SN5-18 ablate binding to chromatin The single arginine-to-serine mutation in < /b> B3 (R27aS)VL did not ablate binding to ... serine (R27aS) in < /b> B3 Vλ CDR1 resulted in < /b> a < /b> significant reduction in < /b> dsDNA binding, indicating the importance of this arginine at the binding site [ 15,< /b> 23] When an extra arginine was introduced into...
- 13
- 472
- 0
Báo cáo y học: "A randomized, double-blind study of AMG 108 (a fully human monoclonal antibody to IL 1R1) in patients with osteoarthritis of the knee" pdf
... neutropenia, and < /b> leukopenia in < /b> the other); patients in < /b> the 300-mg SC group (pancreatitis in < /b> one; and < /b> pneumonia and < /b> supraventricular tachycardia in < /b> the other); and < /b> patients in < /b> the placebo SC group (arthropod ... (arthropod bite and < /b> Staphylococcus infection in < /b> one; abdominal pain in < /b> the second; and < /b> coronary artery disease in < /b> the third) All serious infectious AEs have been listed as SAEs above and < /b> include: patient ... group, AMG 108 (100 mg/mL) or placebo was administered as two 1 .5-< /b> mL SC injections at approximately the same time of day and < /b> at least centimeters apart on the anterior abdominal wall Efficacy analyses...
- 30
- 277
- 0
Báo cáo y học: "Identification of signaling components required for the prediction of cytokine release in RAW 264.7 macrophages" pdf
... test data are also included in < /b> the training set and < /b> the model-reduction procedure is repeated Additional details are provided in < /b> Additional data file Matlab code and < /b> the data can be obtained upon ... of the input data and < /b> the standard deviation of the population of output data The procedure is given below comment added In < /b> both cases, the natural logarithm was taken and < /b> data were averaged across ... 2 . 57 to 2 .53< /b> on the training data and < /b> from 2.88 to 2.49 on the test data) MIP-1α data are characterized by a < /b> high variance and < /b> data can simply be difficult to fit because of imprecision in < /b> the...
- 14
- 182
- 0
Báo cáo Y học: Complexation of ytterbium to human transferrin and its uptake by K562 cells pot
... absorbance at 242< /b> nm increased upon mixing Yb3+ with apo-Tf and < /b> the rise was more rapid with increasing the molar ratio of Yb3+ to apo-Tf (data not shown) The apparent rate constants were obtained ... visible (Fig 5B) ; Yb3+ binding to the C-lobe can thus be inferred These results suggested that Yb3+ bind to the protein and < /b> probably altered the conformation of the protein in < /b> a < /b> manner similar ... [34] Both UV and < /b> ICP-AES data suggested that two Yb3+ bind to apo-Tf in < /b> the specific iron binding site and < /b> two tyrosines are involved in < /b> binding of Yb3+ in < /b> both the N- and < /b> C-lobe as the case for...
- 9
- 385
- 0
báo cáo hóa học:"Interdependency of CEACAM-1, -3, -6, and -8 induced human neutrophil adhesion to endothelial cells" pdf
... washed, and < /b> Ca2+ free buffer containing IgG (panel A)< /b> , the CD66ae mAb and < /b> CD6 6b mAb (panel B) , the CD66ae mAb and < /b> CD66c mAb (panel C), the CD66ae mAb and < /b> CD66de mAb (panel D), the CD6 6b mAb and < /b> ... mAb, CD6 6b mAb, and < /b> CD66c mAb (panel B) , the CD66ae mAb, CD6 6b mAb, and < /b> CD66de mAb (panel C), the CD66ae mAb, CD66c mAb, and < /b> CD66de mAb (panel D), or the CD6 6b mAb, CD66c mAb, and < /b> CD66de mAb ... example, CEACAMs 1, 5,< /b> and < /b> are often expressed in < /b> ovarian, endometrial, cervical, breast, lung, and < /b> colon carcinomas, and < /b> may be useful as biomarkers in < /b> cancer [43- 47] A < /b> CEACAM5 expressing measles...
- 12
- 599
- 0
báo cáo hóa học: " Human brain endothelial cells endeavor to immunoregulate CD8 T cells via PD-1 ligand expression in multiple sclerosis" pdf
... T cells through an in < /b> vitro BBB model HBECs were plated to the upper chamber of a < /b> Boyden chamber and < /b> then inflamed Activated CD8 (A,< /b> B) and < /b> CD4 (C, D) T cells were added to the upper chamber and < /b> ... detectable both under basal conditions and < /b> following pro-inflammatory treatments (data not shown) Human brain endothelial cells partially block T cell migration through an in < /b> vitro model of the BBB via ... demonstrated that the ligation of PD-1 blocks the b1 and < /b> b2 integrin-mediated adhesion by human T cells induced with anti-CD3 [ 35]< /b> Therefore, based on these published data and < /b> our own novel data,...
- 12
- 294
- 0
Báo cáo y học: " Human embryonic stem cell (hES) derived dendritic cells are functionally normal and are susceptible to HIV-1 infection" pot
... differentiated from hES and < /b> FL derived CD34+ cells were stained with CD 1a < /b> and < /b> HLA-DR, CD 1a < /b> and < /b> B7 .1, and < /b> CD 1a < /b> and < /b> B7 .2 Results showed that hES derived DCs are positive for HLA-DR, B7 .1, and < /b> B7 .2 surface ... Antigen uptake by hES-DCs: Cultured hES and < /b> FL DCs were sorted based on CD 1a < /b> marker The cells were then incubated with Alexa-Dextran at 0°C and < /b> 37 C for hr and < /b> analyzed by FACS as described in < /b> ... AI50492 and < /b> AI 0 57 066 to R .A < /b> We thank Joseph Anderson for suggestions, William Wheat for help with MLR and < /b> antigen uptake assays, Sarah Akkina and < /b> Jennifer Quick for help with maintaining hES cells and...
- 9
- 261
- 0
Quy trình bảo dưỡng, sữa chữa ô tô con 4-7 chỗ. thiết kế trạm bảo dưỡng, sữa chữa theo tiêu chuẩn
... hỏng 35 < /b> Khắc phục S a < /b> ch a < /b> Thay phớt dầu Thay gioăng S a < /b> ch a < /b> S a < /b> van dầu S a < /b> b m dầu Thay dầu Thay b c Thay b c Thay lọc dầu S a < /b> ch a < /b> van tràn 2.2.3 HỆ THỐNG LÀM MÁT: Hình 2.3 Tổng quan hệ ... 55< /b> kG 35 < /b> – 45 < /b> kG 25 < /b> – 35 < /b> kG – 120 BTDC 650< /b> ± 50< /b> vg/phút 70 0 ± 50< /b> vg/phút 15.< /b> 0 kG/cm2 10.0 kG/cm2 0. 15 < /b> – 0. 25 < /b> mm 0. 25 < /b> – 0. 35 < /b> mm B o dưỡng : Kiểm tra nước làm mát - Không có cặn b n, gỉ đọng quanh ... tra, s a < /b> ch a < /b> thay xi lanh phanh chính, xi lanh phanh b nh xe, phân phối dầu, b u cường hoá phanh, má phanh, trống phanh, đđ a < /b> phanh, lò xo, ống dẫn dầu, dây cáp phanh Kiểm tra, điều chỉnh van...
- 118
- 4,283
- 55
8 cách đơn giản tăng tốc windows 7
... OK để hoàn tất Tăng tốc hiển thị Toolbar: Tính hiển thị thumbnail cu a < /b> các cư a < /b> sổ mở taskbar là một các tính hữu ích cu a < /b> Windows Thủ thuật dưới sẽ giúp bạn cải thiện ... là ThumbnailLivePreviewHoverTime - Kích đôi vào kho a < /b> mới tạo ra, tại mụcBase chọn kiểu Decimal, và thiết lập giá trị tại mục Value data Bạn có thể điền một giá trị b ́t kỳ, ... - Tại cư a < /b> sổ mới hiện ra, chọn tab Policies, a< /b> nh dấu vào tùy chọn ‘Enable write caching on the device’ (nếu tùy chọn này a< /b> được chọn trước đó, bạn có thể bỏ qua và...
- 19
- 440
- 0
cac nguyen to thuoc nhom 7
... thứ tự Cl 17 35 < /b> 53 85 < /b> 2s22p5 3s23p5 4s24p5 5s25p5 6s26p5 B n kính ngtử (Å) 0,64 0,99 1,14 1,33 1,40 N.lượng ion h a < /b> I1 17, 42 13,01 11,84 10, 45 < /b> 9 ,50< /b> Ái lực electron (eV) 3 ,58< /b> 3,81 3 ,56< /b> 3,29 - Độ ... HỢP CHẤT C A < /b> MANGAN Hợp chất Mn +7 Kali pemanaganat (KMnO4): tinh thể màu tím đen, dung dịch màu tím đỏ, độ tan biến đổi theo nhiệt độ Ngoài ra, thể tan amoniac lỏng, pyri in,< /b> rượu axeton Trên ... 34 NHÓM VIIB Mn – Tc - Re 35 < /b> ĐƠN CHẤT Mn – Tc - Re Đặc điểm Mn Tc Re 25 < /b> 43 75 < /b> 3d54s2 4d55s2 5d56s2 B n kính ngtử R (Å) 1,3 1,36 1, 37 N.lượng ion hóaI1(eV) 7, 43 7, 28 7, 79 Thế điên cực chuẩn E0 (eV)...
- 45
- 754
- 2
Essential guide to writing part 7
... be as exact as in < /b> Russell's paragraph (and < /b> usually will not be) But if you cannot outline a < /b> generally clear relationship, the paragraph is probably confused and < /b> confusing The fact that a < /b> paragraph ... way of sequencing ideas does exist Paragraph Flow Flow, those visible links which bind the sentences of a < /b> paragraph, can be established in < /b> two basic ways (They are compatible; a < /b> paragraph may ... employ both.) The first is to For more material and < /b> information, please visit www.tailieuduhoc.org 98 THE EXPOSITORY PARAGRAPH establish a < /b> master plan at the beginning of the paragraph and < /b> to introduce...
- 15
- 371
- 0
British English A to Z - past 7
... Americans mash, n mashed potatoes Inf Occasionally, creamed potatoes in < /b> Britain A < /b> pub used to present sausages and < /b> mash in < /b> the public bar at three shillings and < /b> sausages and < /b> creamed potatoes in < /b> the ... price in < /b> an auction sale Fetch is used in < /b> the same way make a < /b> balls of Vulgar Slang See also balls, make a < /b> dead set at, Inf make a < /b> (the) four up For instance, at bridge or tennis doubles bring Inf ... form-master has about the same functions as a < /b> home-room teacher In < /b> all these uses, teacher is gaining in < /b> popularity 222 match match, n Two sides (teams) play a < /b> match, rather than a < /b> game, in < /b> Britain...
- 29
- 443
- 0
Đề thi HKI Toán 7-Năm 2010.2011 I m«n to¸n - líp 7
... viết giải thiết, kết luận đúng: 0 .5< /b> a)< /b> Chứng minh đợc tam giác ABC = tam giác ADE 0. 75 < /b> b) Chứng minh đợc DE//BC c) Chứng minh đợc AF=AC CFEF 0. 75 < /b> 0 .5< /b> ... Thời gian làm b i: 90 phút Câu 1: Mỗi câu trả lời đợc 0. 25< /b> câu đáp án Đ S đ s Câu 2: Mỗi ý đợc 0. 25< /b> câu a < /b> b c d đáp án a < /b> c d b Tự luận: THPT: Mỗi câu 0 .5< /b> a < /b> 20 b -36 c Tìm x: Mỗi câu 0 .5< /b> a < /b> x= ... 28 b x=9 c x= 16 x= Gọi ẩn viết đợc tỷ lệ thức: 1đ - áp dụng tính chất dãy tỉ số có kết đúng: 1đ + Lớp 7A:< /b> 35cây + Lớp 7B: 25 < /b> + Lớp 7C: 15cây Vẽ hình viết giải thiết, kết luận đúng: 0 .5< /b> a)< /b> Chứng...
- 2
- 447
- 0
Tài liệu The Insider’s Guide to PR: Chapter 7 A GLOSSARY OF PR SPEAK doc
... newsletters and < /b> intranets • Logo: A < /b> graphic or symbol owned by and < /b> representing a < /b> company or brand • Media Relations: communicating with the media by pro-actively speaking to journalists and < /b> sending ... they would tackle a < /b> given brief • Press Pack/Kit: a < /b> branded pack handed out to the media by an organisation It normally contains background material, photographs, illustrations and < /b> news releases ... example, you can promote a < /b> barcode printer in < /b> the printing media, packaging media and < /b> food retailing media • Viral campaign: a < /b> communications campaign which is designed to exploit the potential...
- 2
- 490
- 0
Tài liệu Thêm Dropbox vào menu Send To trong Windows 7, XP và Vista ppt
... link sau vào Windows Explorer mục Search menu Start %APPDATA%\Microsoft\Windows\SendTo Nếu b n có dropbox Favorites, phải chuột vào folder chuyển tới folder Send To Khi b n dán folder này, b n ... Trong hệ điều hành Windows XP, vào Control Panel > Folder Options > Show hidden files and < /b> folders Chuyển tới C:\Documents and < /b> Settings\[User Name]\SendTo (User Name tên máy tính b n) tạo shortcut ... folder, b n chuyển tới folder Dropbox Nếu b n có folder chia sẻ folder Dropbox, b n thêm chúng vào menu Send To với phương pháp tương tự giống ví dụ, thêm folder Dropbox chia sẻ Thêm Dropbox vào...
- 8
- 385
- 0
Tài liệu Human Resources Development Division Head Office, 7, Bhikaiji Cama Place, New Delhi -110607 docx
... 0 75 5< /b> - 255< /b> 76 15 < /b> 4th Floor, Deendayal Bhawan, Ashok Nagar,Janpath, Bhubaneshwar- 75 1< /b> 009 0 674 - 253< /b> 4 2 57 Fax-0 674 - 253< /b> 450< /b> 6 PNB House, Bank Square, Sector 17 B Chandigarh - 1600 17 Tel No 0 172 - 270 3 077 , ... Road, Raheja Towers(East Wing) Bengaluru, Karnataka -56< /b> 0001 Tel.-08 050< /b> 950< /b> 76 , 255< /b> 96926 Fax-080- 255< /b> 84 951< /b> PNB Building, Arera Hills, Opposite Old Jail,Bhopal462011Tel No 0 75 5< /b> – 255< /b> 3689, 255< /b> 56 75 ;< /b> Fax ... Republic of Tanzania (formerly Tanganyika and < /b> Zanzibar), Zambia, Malawi, Zaire, Ethiopia and < /b> Vietnam with the intention of permanently settling in < /b> India Provided that a < /b> candidate belonging to categories...
- 17
- 347
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008