4 4 tamoxifen a prodrug has little affinity for the estrogen receptor in contrast 4 hydroxytamoxifen the active metabolite of tamoxifen has 30 100 times more affinity with the estrogen receptor this hydroxylation reaction occurs in the
The structure basis for burkholderia pseudomallei hcp induced multinucleated giant cell formation
... melioidosis .30 In the cohort studies from Thailand and Australia, the decrease in average mortality rate (49 % in 1997 to 40 .5% in 2006 in Thailand, and 30% in 1989 to 9% in 2009 in Australia) have been attributed ... Singapore12 Pahang, Alor Setar, Malaysia13 Malaysia 14 No of cases 252 2217 693 135 145 Average annual incidence* 19.6 12.7 1.7 6.1 16 .4 19 42 .6 16.2 54 34 Average mortality rate (%) Adapted from Hassan ... that generates heavy rainfall and winds may cause a shift towards inhalation as the major route of infection.32 Ingestion as a mode of infection was observed in animals, through the discovery of...
- 155
- 1,103
- 0
Báo cáo khoa học: "The interaction between different types of activated RAW 264.7 cells and macrophage inflammatory protein-1 alpha" potx
... (Toyobo) For amplification by PCR, the forward primer for MIP- 1a was CTCCCAGCCAGGTGTCATT, and the reverse primer was GGCATTCAGTTCCAGGTCAG The forward primer for b-actin was CCGTGAAAAGATGACCCAG, and the ... manufacturer’s instructions Sample absorbance was Page of measured with a Multiscan plate reader (Genios, Tencan) at a wavelength of 45 0 nm The sample concentration was measured using a standard curve Real-time ... values The ΔΔCT values were compared with the control by raising two to the ΔΔCT power Statistical analysis Statistical analyses of data were conducted using oneway analysis of variance (ANOVA) Statistical...
- 7
- 380
- 0
Báo cáo khoa học: Ascorbic acid-pretreated quartz enhances cyclo-oxygenase-2 expression in RAW 264.7 murine macrophages pdf
... for AA as a cofactor involved in the early stages of quartz-induced pathology, and they represent the basis of the present study on the effect of AA on the quartz-induced in ammatory response in ... on the increased COX-2 expression triggered by AA-treated quartz in RAW 2 64. 7 macrophages Cells were incubated for h with AA-treated and untreated quartz in the presence of excess of the radical ... by RAW 2 64. 7 cells stimulated with 15 lgÆmL)1 AA-treated quartz was indeed significantly reduced in the presence of the ROS scavengers catalase and mannitol (Fig 6A) , indicating that AA treatment...
- 14
- 253
- 0
Báo cáo y học: "Stable expression of a recombinant human antinucleosome antibody to investigate relationships between antibody sequence, binding properties, and pathogenicity" doc
... produced antibodies based on the murine monoclonal anti-DNA antibody R 4A All these antibodies had the light chain of R 4A, but the heavy chains were variants of the R 4A VH sequence They found that the ... of DNA (perhaps ssDNA) These fragments may remain associated with the antibody or may gain access to the combining site and act as efficient competitors of binding to dsDNA The supernatants of ... the control half and incubated for hour at 37°C The plates were washed again with PBST Bound antibody was detected by adding goat antihuman IgG alkaline phosphatase conjugate and incubating for...
- 13
- 472
- 0
Báo cáo y học: "A randomized, double-blind study of AMG 108 (a fully human monoclonal antibody to IL 1R1) in patients with osteoarthritis of the knee" pdf
... blocking the activity of IL-1β may protect against structural changes in OA.[13, 14] Finally, IL-1 antagonists may also play a role in the pain of OA.[15] In a small study of patients with OA, IA injections ... (Part A, 98%; Part B, 83%) The mean age was 61 years for patients in both parts of the study The mean duration of OA at baseline of Part A was years for the AMG 108 group and 10 years for the ... (pneumonia); and patients in the placebo SC group (Staphylococcus infection in one; and abdominal pain in the other) Table Pharmacokinetic data after intravenous and subcutaneous administration of amg...
- 30
- 277
- 0
Báo cáo y học: "Identification of signaling components required for the prediction of cytokine release in RAW 264.7 macrophages" pdf
... repeated Additional details are provided in Additional data file Matlab code and the data can be obtained upon request Additional data files The following additional data are available with the ... Preparation and Analysis Laboratory, Alliance for Cellular Signaling) and Ronald Taussig (Cell Preparation and Analysis Laboratory, Alliance for Cellular Signaling, and Department of Pharmacology, ... using the same approach The overall minimal model is the combination of the minimal PP-model and the minimal residuals model The procedure for the identification of the minimal model containing...
- 14
- 182
- 0
Báo cáo Y học: Complexation of ytterbium to human transferrin and its uptake by K562 cells pot
... is a glycoprotein (80 kDa) present in blood plasma with a concentration of 35 lM It is only 30% saturated with iron in blood plasma and has the capacity for binding to other metal ions of therapeutic ... kinetics of Yb3+ binding to apo-Tf was studied with the stopped-flow technique The absorbance at 242 nm increased upon mixing Yb3+ with apo-Tf and the rise was more rapid with increasing the molar ratio ... twofold differences in rate constants The almost identical molar absorptivity of e1 and e and approximately the same slope of the k1 and k (Fig 3) suggeststhatthenatureofthefirstkineticphaseofthereaction...
- 9
- 385
- 0
báo cáo hóa học:"Interdependency of CEACAM-1, -3, -6, and -8 induced human neutrophil adhesion to endothelial cells" pdf
... activity, including lyn and hck, associated with CEACAM-1, CEACAM-6, and CEACAM-8, and src with CEACAM-1, suggests that these kinase activities may be involved in signal transduction via CEACAM family ... measles virus has entered phase I trials in ovarian cancer [48 ] CD66mAbs that recognize CEACAMs are also in clinical trials as part of conditioning regimens in allogeneic stem cell transplantation ... several other reports have also suggested that CEACAMs are capable of regulating the function of CD11/CD18 [ 24, 39 ,40 ], and induce an increase in intracytoplasmic calcium and an oxidative burst in neutrophils...
- 12
- 599
- 0
báo cáo hóa học: " Human brain endothelial cells endeavor to immunoregulate CD8 T cells via PD-1 ligand expression in multiple sclerosis" pdf
... fluorescence intensity in these samples was measured using a Synergy4 Biotek microplate reader The diffusion rate of the FITC-BSA, a measure of the permeability, was expressed as a percentage and calculated ... Burlington, ON, Canada) was incubated hour at room temperature and then overnight at 4 C Sections were then washed with PBS and incubated for 40 minutes with appropriate secondary antibodies: Alexa ... multifactorial cluster analysis in the staging of plaques in early multiple sclerosis Identification and characterization of the primary demyelinating lesion Brain 1997, 120: 146 1- 148 3 11 Babbe H, Roers A, ...
- 12
- 294
- 0
Báo cáo y học: " Human embryonic stem cell (hES) derived dendritic cells are functionally normal and are susceptible to HIV-1 infection" pot
... system has considerable potential in several areas of clinical and experimental medicine as they can reconstitute the entire blood system and can serve as primary targets in gene therapy in treating ... cells FACS analysis of differentiating DCs from hES and FL CD 34+ cells: CD 34+ cells were cultured in cytokine media and analyzed by FACS for CD 14 and CD 1a markers at different days by staining with ... derived DCs were also evaluated in parallel Blocking step was first performed by incubating the cells with the respective isotype sera control for 30 minutes at 4 C before staining with the respective...
- 9
- 261
- 0
Quy trình bảo dưỡng, sữa chữa ô tô con 4-7 chỗ. thiết kế trạm bảo dưỡng, sữa chữa theo tiêu chuẩn
... 35 Khắc phục S a ch a Thay phớt dầu Thay gioăng S a ch a S a van dầu S a bơm dầu Thay dầu Thay bạc Thay bạc Thay lọc dầu S a ch a van tràn 2.2.3 HỆ THỐNG LÀM MÁT: Hình 2.3 Tổng quan hệ thống làm ... bầu phanh hệ thống phanh xy lanh phanh hệ thống phanh dầu Kiểm tra mức dầu bầu ch a xy lanh phanh 48 Điều chỉnh khe hở tang trống, đ a phanh má phanh, hành trình hành trình tự bàn đạp phanh 49 Kiểm ... Fuel injection Hệ thống phun xăng điện tử M/T Mechaniccal transmission Hộp số thường MAX Maximum Tối a MIN Minimum Tối thiểu VVTi Variable Valve Timing with Thay đổi thời điểm phối khí – Intelligence...
- 118
- 4,275
- 54
8 cách đơn giản tăng tốc windows 7
... ThumbnailLivePreviewHoverTime - Kích đôi vào kho a mới tạo ra, tại mụcBase chọn kiểu Decimal, và thiết lập giá trị tại mục Value data Bạn có thể điền một giá trị bất kỳ, quá ... Enter - Tại cư a sổ System Configuration hiện ra, chọn tab Boot và nhấn vào nút Advanced Options… - a nh dấu vào mục Number of processors và chọn số nhân cu a cpu mà máy tính ... (Start/Run/Regedit) Sau đó, bạn tìm kh a HKEY_LOCAL_MACHINE \SOFTWARE \Microsoft\Windows NT \ CurrentVersion \ SystemeRestore Sau đó, tìm bên c a sổ bên phải giá trị DWORD mang tên RPGlobalInterval...
- 19
- 440
- 0
cac nguyen to thuoc nhom 7
... 2K2MnO4 + 2H2O 43 HỢP CHẤT C A MANGAN Hợp chất Mn +7 Kali pemanaganat (KMnO4): tinh thể màu tím đen, dung dịch màu tím đỏ, độ tan biến đổi theo nhiệt độ Ngoài ra, thể tan amoniac lỏng, pyri in, ... MnO2 + 6NaOHđ hipomanganat 0 42 HỢP CHẤT C A MANGAN Hợp chất Mn +4 : MnO2 Khi nấu chảy với kiềm hay oxit bazơ mạnh, tạo muối t 0C manganit: MnO2 + 2NaOH → Na2MnO3 + H2O Ở nhiệt độ cao, MnO2 ... nóng, tan axit kiềm axit lưỡng tính: + Khi tan dung dịch axit: C t→ MnCl2 + Cl2 + 2H2O MnO2 + 4HCl C t→ 2Mn2(SO4)3 + O2 + 6H2O 4MnO2 + 6H2SO4 + Khi tan dung dịch kiềm đặc: C t→ Na3MnO4 + Na3[Mn(OH)6]...
- 45
- 754
- 2
Essential guide to writing part 7
... sentence, as in the second paragraph of this passage (italics added): Approaching the lake from the south, spread out, high up in a great V, was a flock of Canada geese They did not land but continued ... both.) The first is to For more material and information, please visit www.tailieuduhoc.org 98 THE EXPOSITORY PARAGRAPH establish a master plan at the beginning of the paragraph and to introduce each ... a passage answering the claim that metaphor has no place in prose: For more material and information, please visit www.tailieuduhoc.org IO2 THE EXPOSITORY PARAGRAPH The truth seems that metaphor...
- 15
- 371
- 0
British English A to Z - past 7
... running make a meal of See make heavy weather of make game of, Inf make hay of Inf Make short work of Also throw into confusion make fun of Inf overthrow make heavy weather of see comment Inf Applies ... arterial road make, v.t Bring a price in an auction sale Fetch is used in the same way make a balls of Vulgar Slang See also balls, make a dead set at, Inf make a (the) four up For instance, at bridge ... interchangeably in Britain, though mantelpiece is now more common marching papers Inf Also marching orders Inf walking papers marg(e), n Inf Each country has its own way of abbreviating oleomargarine...
- 29
- 443
- 0
Đề thi HKI Toán 7-Năm 2010.2011 I m«n to¸n - líp 7
... Lớp 7A: 35cây + Lớp 7B: 25 + Lớp 7C: 15cây Vẽ hình viết giải thiết, kết luận đúng: 0.5đ a) Chứng minh đợc tam giác ABC = tam giác ADE 0.75đ b) Chứng minh đợc DE//BC c) Chứng minh đợc AF=AC CFEF ... Thời gian làm bài: 90 phút Câu 1: Mỗi câu trả lời đợc 0.25đ câu đáp án Đ S đ s Câu 2: Mỗi ý đợc 0.25đ câu a b c d đáp án a c d b Tự luận: THPT: Mỗi câu 0.5đ a 20 b -36 c Tìm x: Mỗi câu 0.5đ a x=...
- 2
- 447
- 0
Tài liệu The Insider’s Guide to PR: Chapter 7 A GLOSSARY OF PR SPEAK doc
... Media: channel for the communication of information including newspapers, magazines, radio, TV, mobile phones and the internet • News Conference: the live dissemination of news information by an ... example, you can promote a barcode printer in the printing media, packaging media and food retailing media • Viral campaign: a communications campaign which is designed to exploit the potential ... journals are read for business and professional reasons, for example Electronics Week is read by electronics engineers • Teaser: a promotion that is intended to arouse interest in the main campaign...
- 2
- 490
- 0
Tài liệu Thêm Dropbox vào menu Send To trong Windows 7, XP và Vista ppt
... Vista Đầu tiên, copy đường link sau vào Windows Explorer mục Search menu Start %APPDATA%\Microsoft\Windows\SendTo Nếu bạn có dropbox Favorites, phải chuột vào folder chuyển tới folder Send To Khi ... bạn lưu chia sẻ liệu Nếu bạn muốn dễ dàng truy cập ứng dụng này, bạn thêm vào menu Send To menu context Thêm Dropbox vào mục Send To Windows Vista Đầu tiên, copy đường link sau vào Windows Explorer ... hệ điều hành Windows XP, vào Control Panel > Folder Options > Show hidden files and folders Chuyển tới C:\Documents and Settings\[User Name]\SendTo (User Name tên máy tính bạn) tạo shortcut cho...
- 8
- 385
- 0
Tài liệu Human Resources Development Division Head Office, 7, Bhikaiji Cama Place, New Delhi -110607 docx
... Republic of Tanzania (formerly Tanganyika and Zanzibar), Zambia, Malawi, Zaire, Ethiopia and Vietnam with the intention of permanently settling in India Provided that a candidate belonging to categories ... January, 1962 with the intention of permanently settling in India or v) a person of Indian origin who has migrated from Pakistan, Burma, Sri Lanka, East African countries of Kenya, Uganda, the United ... minimum of 60% marks( in Minimum 03 years of experience in the Law aggregate) Division/International Banking Division of PSU/Bank For Other Law Graduates Minimum 05 years of experience in the Law...
- 17
- 347
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25