2 6 mosaic generation by ems treatment of tg β actin mgfp heterozygote zebrafish in a time course experiment the yellow arrows show the progress of cell migration along the base to tip axis the red arrows show the similar expression patter
THE SPATIOTEMPORAL STUDY OF ZEBRAFISH INTESTINAL EPITHELIUM RENEWAL
... time course experiment The yellow arrows show the progress of cell migration along the base to tip axis The red arrows show the similar expression pattern of two adjacent sides of two villi mGFP, ... absent in amphibian too (Fig -8) Also similar to those of mammalian the renewal is along the base1 to- tip axis and the cells locating at the tip of the villus, which are old differentiated cells ... shed off (Ishizuya-Oka, 2007) Figure 1-8: Intestinal epithelium renewal in adult amphibian and mammalian intestine Similar to the mammalian intestine, the epithelial cells in amphibian intestine...
- 149
- 487
- 0
Báo cáo y học: "Discrepancy between the in vitro and in vivo effects of murine mesenchymal stem cells on T-cell proliferation and collagen-induced arthritis" doc
... for the treatment of several autoimmune diseases, prudence is called for in extrapolating in vitro and animal data to the human situation Abbreviations AC: accessory cell; BSA: bovine serum albumin; ... MSCs, making these molecules candidate mediators of T -cell inhibition The involvement of iNOS and COX-2 in inhibition of T -cell proliferation was demonstrated by the addition of inhibitors of these ... group and analyzed for the T -cell cytokines IL-2, IL-5, IL -6, IL-10, and IFN-g The injection of anti-CD3 antibody caused a profound increase in cytokine levels in the sera of these mice Treatment...
- 11
- 464
- 0
Retrovirology Research BioMed Central Open Access In vivo expression of the HBZ gene of HTLV-1 doc
... Kamihira S, Sugahara K, Tsuruda K, Minami S, Uemura A, Akamatsu N, Nagai H, Murata K, Hasegawa H, Hirakata Y, Takasaki Y, Tsukasaki K, Yamada Y: Proviral status of HTLV-1 integrated into the host genomic ... type I infection in Japan and Jamaica Int J Cancer 2008, 1:124(3) :61 4-21 Nakagawa M, Nakahara K, Maruyama Y, Kawabata M, Higuchi I, Kubota H, Izumo S, Arimura K, Osame M: Therapeutic trials in 200 ... suitable for evaluating HAM/TSP motor symptoms than the widely used EDSS [44] The laboratory data were examined by an investigator who was not involved in the patients' clinical care, and the neurologists...
- 11
- 393
- 0
Báo cáo y học: " The connection domain in reverse transcriptase facilitates the in vivo annealing of tRNALys3 to HIV-1 genomic RNA" potx
... times indicate an important role of the RT thumb domain in GagPol in tRNALys3 viral packaging tRNALys3 incorpora- tion into HIV-1 is not affected by deletion of the IN domain in GagPol, nor by ... tRNA Lys3 Figure annealing to viral genomic RNA tRNALys3 annealing to viral genomic RNA A Total viral RNA was used as the source of primer tRNALys3/viral RNA template in an in vitro reverse transcription ... tion The data in the right side of panel A indicate that Cterminal deletions of GagPol extending into the connection domain result in an 85% or greater decrease in the initiation of reverse transcription...
- 7
- 362
- 0
Báo cáo sinh học: "A dual function fusion protein of Herpes simplex virus type 1 thymidine kinase and firefly luciferase for noninvasive in vivo imaging of gene therapy in malignant glioma" ppsx
... glioma by serial optical imaging in vivo Noninvasive real time evaluation of localization, activity and persistence of a therapeutic gene in living animals may represent an important step towards ... activity of SU11248, a novel tyrosine kinase inhibitor targeting vascular endothelial growth factor and platelet-derived growth factor receptors: determination of a pharmacokinetic/ pharmacodynamic ... experiments and enzymatic assays SJ and AS carried out the immunohistochemical studies NGR and AS designed the experiments and evaluated the data All authors have read and approved the manuscript Acknowledgements...
- 13
- 388
- 0
Stability and in vivo evaluation of pullulan acetate as a drug nanocarrier
... PANs was studied in the aqueous medium, and the acute toxicity of PANs was evaluated in mice Morever, EPI was loaded into PANs and its pharmacokinetics was also assessed in rats to compare to the ... Wistar rats The plasma levels over 48 h are shown in Figure and the PK parameters are summarized in Table The peak concentration of total EPI in plasma was 14 .65 mg/L at 1 min after injection and ... main pharmacokinetic parameters were calculated by DAS 1.0 (Anhui, China) program Bioavailability (BA) is a measurement of the rate and extent of a therapeutically active drug that reaches the systemic...
- 7
- 391
- 0
Tài liệu Báo cáo Y học: Identification and characterization of the Escherichia coli stress protein UP12, a putative in vivo substrate of GroEL pptx
... estimate the ratio between the amounts of UP12 and the total amount of protein in the extracts, a series of samples containing determined amounts of the purified UP12 were separated by SDS/PAGE along ... AE000 166 , accession no U000 96 [15]), was amplified by PCR using a 5¢ complementary deoxyoligonucleotide (5¢-CGCGGATCCATGTATAAGACAATCATTATGC-3¢) containing a BamHI site (underlined nucleotides) and a ... increases further during the late stationary phase As a result of this accumulation, the relative amount of UP12 in stationary cells is about 10 times higher than that observed at the beginning...
- 9
- 548
- 0
Báo cáo khoa học: In vivo production of catalase containing haem analogues pot
... Fe-PP-KatA and Ga-PP-KatA, showed one polypeptide band corresponding to KatA with an apparent molecular mass of 54 kDa (Fig 2) In the case of Ga-PP-KatA, an additional protein band of about 110 kDa ... cell and incorporated into vital haem proteins instead of haem [5] We show here that haem analogues are indeed taken up and can be incorporated into haem proteins, resulting in their inactivation ... incorporate these into catalase apo-protein in the cytoplasm to form substituted catalase This research was performed to find the explanation for the general toxicity of haem analogues, so that...
- 10
- 419
- 0
Báo cáo khoa học: A steady-state modeling approach to validate an in vivo mechanism of the GAL regulatory network in Saccharomyces cerevisiae ppt
... validate the mechanism of induction of GAL genes by galactose In each of the models, cytoplasmic Gal3p is activated by galactose Further, Gal4p dimerizes and interacts with the DNA to form the ... determined by the binding of the operator to either the dimer Gal4p (G4) alone, that is DNA-Gal4p, or the complex Gal4p– Gal80p–Gal3p, that is, DNA-Gal4p–Gal80p–Gal3p Therefore, the probability of ... of these individual elements, which are captured by parameters such as the binding constants and the extent of autoregulation The regulatory proteins may reside either in the nucleus or in the...
- 11
- 490
- 0
Báo cáo khoa học: Death inducer obliterator protein 1 in the context of DNA regulation Sequence analyses of distant homologues point to a novel functional role docx
... 0.75 are shown Black geometrical shapes are additional domains, as indicated ANOGA, Anopheles gambiae; ASHGOS, Ashbya gossypii; BRARE, Brachydanio rerio; CANDGLA, Candida glabrata; CIONA, Ciona intestinalis; ... constitute the minimal transcriptionally active fragment and are required simultaneously to maintain transcription The PHF3 protein was recovered in initial analyses and also contains a TFS2M domain showing ... isoforms and were searched against PFAM [22,23] and SMART [24] databases to automatically detect domains; they were further used as queries against NCBI databases using PSIBLAST [25, 26] Complete gene...
- 7
- 658
- 0
Báo cáo khoa học: A mouse model for in vivo tracking of the major dust mite allergen Der p 2 after inhalation docx
... allergen was altered as a result of the in ammation in the lungs of sensitized animals Up to now there are few data available on the fate of an allergen after inhalation In this study, we tracked ... carrying the Sel-tag had an intact core sequence and maintained allergen-specific IgE-binding epitopes and the use of a Sel-tag enabled labelling with the gamma-emitting radionuclide 75Se at a ... whole-body autoradiogram the radioactivity pattern was similar to the result from the initial time- dependence experiment at the time point of 24 h Thus, the radioactivity was detected mainly in lungs,...
- 12
- 518
- 0
Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc
... amplification with primers 5¢-CACCAC CACCACCACCACGAAGCTGGAGATGATCGTGCT-3¢ (His-tag underlined) or 5¢-TGGAGCCACCCGCAGTTCG AAAAAGAAGCTGGAGATGATCGTGCT-3¢ (Strep-tag underlined) and 5¢-GCGGCATGCTCATCCAAAGAAGC ... 5¢-GCGGAGCTCATGGCCAC AAGCGCATCAGC-3¢ and 5¢-GTGGTGGTGGTGGTGG TGGAAATGGGTTTTTCCGTTCTGC-3¢ (His-tag underlined) or 5¢-TGGAGCCACCCGCAGTTCGAAAAAGAA GCTGGAGATGATCGTGCT-3¢ (Strep-tag underlined), then a secondary amplification ... with a C-terminal hexa-histidine tag (PSI-G-HisTerm), 5¢-GCGGAGCTCAT GGCCACAAGCGCATCAGC-3¢ and 5¢-GCGGCATGCT CAGTGGTGGTGGTGGTGGTGTCCAAAGAAGCTTG GGTCGTAT-3¢ (His-tag underlined); PSAG with a C-terminal...
- 9
- 422
- 0
Báo cáo khoa học: In vivo studies of altered expression patterns of p53 and proliferative control genes in chronic vitamin A deficiency and hypervitaminosis pot
... determined using the following primers (5¢-TGAGTGCA AGCGGTGTCTTA-3¢ (forward) and 5¢-TAGTGGTGA TGTGCCCATG-3¢ (reverse); primers for p21WAF1/CIF1: 5¢-ACAGCGATATCGAGACACTCA-3¢ (forward) and 5¢-GTGAGACACCAGAGTGCAAGA-3¢ ... 5¢-GTGAGACACCAGAGTGCAAGA-3¢ (reverse); primers for p53: 5¢-CACAGTCGGATATGAGCATC-3¢ (forward) and 5¢-GTCGTCCAGATACTCAGCAT-3¢ (reverse) and primers for cyclin D1: 5¢-TGTTCGTGGC CTCTAAGATGA-3¢ (forward) and ... explain the importance of keeping vitamin A of the incidence of cancer, cardiovascular disease, or death status within the normal range, because p53 tumor 21 from all causes [37] The failure of these...
- 9
- 508
- 0
Báo cáo Y học: In vivo activation of plasma membrane H+-ATPase hydrolytic activity by complex lipid-bound unsaturated fatty acids in Ustilago maydis docx
... (1981) Factors a ecting the inhibition of yeast plasma membrane ATPase by vanadate Biochim Biophys Acta 64 2, 173–181 36 Wach, A & Graber, P (1991) The plasma membrane H+-ATPase from yeast Effects of ... Vasco, Spain REFERENCES Nishi, T & Yagi, T (1992) A transient and rapid activation of plasma-membrane ATPase during the initial stages of osmoregulation in the salt-tolerant yeast Zygosaccharomyces ... although the particular fatty acid may be different for each species, activation of the plasma membrane H+-ATPase by increases in the unsaturation of the CLB-fatty acids is a physiological and relevant...
- 6
- 469
- 0
Báo cáo khoa học: A study of microRNAs in silico and in vivo: bioimaging of microRNA biogenesis and regulation doc
... [34] Also, miRNA21 is a potential therapeutic 2170 target for cancer treatment, as overexpression of antimiRNA21 in hepatocellular carcinoma and glioblastoma cells was shown to down-regulate the ... expression of primary miRNAs by binding them to the 5¢ terminal regulatory region of the miRNAs that participate in critical molecular and ⁄ or cellular processes during the developmental stage [14– 16] ... regulatory networks during developmental stages and the changes of these networks in disease and after application of a variety of therapeutic strategies Critically, 2172 the noninvasive imaging approach...
- 10
- 463
- 0
Báo cáo khoa học: In vivo degradation of nitric oxide synthase (NOS) and heat shock protein 90 (HSP90) by calpain is modulated by the formation of a NOS–HSP90 heterocomplex pot
... in brain, the natural inhibitor of calpain, calpastatin, was preferentially converted into still active 15 kDa fragments (Table 1), whereas, in aorta, the inhibitor was predominantly inactivated ... inactivated As both the inactivation and fragmentation of calpastatin are known to be produced by active calpain [32], these observations further indicate that calpain is activated in both tissues, although ... 2507 In vivo degradation of NOS and HSP90 by calpain M Averna et al Fig Identification of NOS–HSP90 association in rat brain and aorta (A) Aliquots (500 lg protein) of brain and aorta crude extract,...
- 11
- 344
- 0
báo cáo hóa học:" In vivo properties of the proangiogenic peptide QK" pdf
... ischemia and can be modulated by several growth factors, transcription factors and cytokines [3,4] In particular, the main regulator of neovascularization in adult life is the system of vascular ... concentration is reported as the final molar concentration in the organ bath Endothelium-independent vasorelaxation was tested after mechanical endothelium removal of the endothelial layer Surgical Induction ... hematoxylin and eosin [4] Quantitative analysis was done by counting the total number of endothelial cells, identified by lectin staining (see immunohistology), in the Matrigel plug in each of 20 randomly...
- 10
- 679
- 0
Báo cáo hóa học: " In vivo evidence of htid suppressive activity on ErbB-2 in breast cancers over expressing the receptor" potx
... 5'TGA CAC TGG CAA AAC AAT GCA-3' (sense) and 5'GGT CCT TTT CAC CAG CAA GCT-3' (antisense) at an annealing temperature of 62 °C Quantitative real -time RT-PCR analysis was performed using the ABI ... resulted in a faint stain of the cytoplasm and rarely in staining of the membrane of the tumor cells (Figure 3B) In the more advanced 30 weeks tumors the staining patterns changed with regard to both ... DNA concentration, the faster a significant increase in fluorescence resulting in a low Ct value The Ct value is proportional to the logarithm of the initial amount of the target DNA in the sample...
- 13
- 376
- 0
báo cáo hóa học:" Function of anterior talofibular and calcaneofibular ligaments during in-vivo motion of the ankle joint complex" docx
... Ostgaard HC, Arms S, Haugh L: Strain in the lateral ligaments of the ankle Foot Ankle 1988, 9(2):59 -63 Rasmussen O: Stability of the ankle joint Analysis of the function and traumatology of the ... flexion-extension arc of motion They demonstrated increased strain in the ATFL with increasing plantarflexion, inversion and internal rotation Strain in the CFL was found to increase in dorsiflexion and inversion ... that the ATFL acts as a primary restraint in inversion and plantarflexion, whereas the CFL tension was increased mainly in inversion and dorsiflexion The lowest maximum load -to- failure of ATFL among...
- 6
- 369
- 0
báo cáo hóa học:" In vivo evaluation of a vibration analysis technique for the per-operative monitoring of the fixation of hip prostheses" pdf
... for a trial reduction of the artificial joint In a later stage, the stem was removed, cement was introduced in the distal part of the femoral canal, the stem was re-introduced and after the cement ... may have been avoided in the case of an abnormal bone structure and a deformed endomedullary canal as the FRF analysis showed an abnormality and the surgeon was alerted to the situation in time ... stages and b FRF graphs corresponding to the insertion stages and canal and reinserting the prosthesis The FRF had a normal evolution during the reinsertion and the graphs corresponding to the final...
- 10
- 542
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25