2 5 schematic figure of ems treatment of a heterozygote reporter gene transgenic line
THE SPATIOTEMPORAL STUDY OF ZEBRAFISH INTESTINAL EPITHELIUM RENEWAL
... Huiqing, Anh Tuan, Zhou Li, Tina, Caixia, Grace, Joji, Xiaoqian, Xiaoyan, Zaho Ye, Yan Chuan, Divya, and Jianzhou; I am grateful for the chance to be a part of the department and lab Thank you ... has been demonstrated that Ascl2 plays a key role in the maintenance of adult ISCs, as gain and loss of function of the Ascl2 gene result in crypt hyperplasia and the disappearance of the Lgr5+ve ... develops along rostrocaudal axis Later in 2010, Wang et al studied the zebrafish intestinal characters along the rostrocaudal axis and tried to analyze both the morphological and molecular 15 Chapter...
- 149
- 487
- 0
Báo cáo y học: "Discrepancy between the in vitro and in vivo effects of murine mesenchymal stem cells on T-cell proliferation and collagen-induced arthritis" doc
... CellQuest® software Statistical analysis Quantitative polymerase chain reaction MSCs were generated from bone marrow cells of DBA/1 wild-type and DBA/1 IFN-gR KO mice After removal of nonadherent ... Data are expressed as the mean (standard error of the mean) Differences were analyzed by the Mann-Whitney U test A P value of not more than 0. 05 was considered significant Results Generation of ... the treatment of several autoimmune diseases, prudence is called for in extrapolating in vitro and animal data to the human situation Abbreviations AC: accessory cell; BSA: bovine serum albumin;...
- 11
- 464
- 0
Retrovirology Research BioMed Central Open Access In vivo expression of the HBZ gene of HTLV-1 doc
... 2008, 5: 34 Murata K, Hayashibara T, Sugahara K, Uemura A, Yamaguchi T, Harasawa H, Hasegawa H, Tsuruda K, Okazaki T, Koji T, Miyanishi T, Yamada Y, Kamihira S: A novel alternative splicing isoform ... sclerosis: an expanded disability status scale (EDSS) Neurology 1983, 33:1444-1 452 Kamihira S, Sugahara K, Tsuruda K, Minami S, Uemura A, Akamatsu N, Nagai H, Murata K, Hasegawa H, Hirakata Y, Takasaki ... infection in Japan and Jamaica Int J Cancer 2008, 1:124(3):614-21 Nakagawa M, Nakahara K, Maruyama Y, Kawabata M, Higuchi I, Kubota H, Izumo S, Arimura K, Osame M: Therapeutic trials in 200 patients...
- 11
- 393
- 0
Báo cáo y học: " The connection domain in reverse transcriptase facilitates the in vivo annealing of tRNALys3 to HIV-1 genomic RNA" potx
... RT are deleted ( 58 1 and ∆7 15) To measure the amount of tRNALys3 annealed in vivo to the viral RNA genome, total viral RNA was used as the source of primer/template in an in vitro reverse transcription ... that of BH10P-, but can be increased 4 5 fold by the additional presence of fulllength GagPol The fact that tRNALys3 annealing is only rescued by GagPol to approximately 50 55 % the level of that ... that RT plays a direct role in tRNALys3 annealing Early work indicated that the in vitro annealing of primer tRNATrp to AMV genomic RNA was promoted by the addition of AMV reverse transcriptase...
- 7
- 362
- 0
Báo cáo sinh học: "A dual function fusion protein of Herpes simplex virus type 1 thymidine kinase and firefly luciferase for noninvasive in vivo imaging of gene therapy in malignant glioma" ppsx
... optical imaging in vivo Noninvasive real time evaluation of localization, activity and persistence of a therapeutic gene in living animals may represent an important step towards optimization of gene ... experiments and enzymatic assays SJ and AS carried out the immunohistochemical studies NGR and AS designed the experiments and evaluated the data All authors have read and approved the manuscript Acknowledgements ... 10:23 25- 23 35 Rainov NG: A phase III clinical evaluation of herpes simplex virus type thymidine kinase and ganciclovir gene therapy as an adjuvant to surgical resection and radiation in adults...
- 13
- 388
- 0
Stability and in vivo evaluation of pullulan acetate as a drug nanocarrier
... Li and Huang a b 350 0 3000 250 0 2000 150 0 1000 Wavenumber (cm−1) Figure 1. FT-IR spectra of PA (a) and pullulan (b) 50 0 Stability and in vivo evaluation of pullulan acetate 55 5 (2008) also ... with a UV detector at 232 nm The main pharmacokinetic parameters were calculated by DAS 1.0 (Anhui, China) program Bioavailability (BA) is a measurement of the rate and extent of a therapeutically ... 2009): ((AUC ) × Dose ) × 100% ((AUC ) × Dose ) A BA R = B B A where AUC is the area under the curve Statistical analysis All data are presented as a mean value with its standard deviation indicated...
- 7
- 391
- 0
Tài liệu Báo cáo Y học: Identification and characterization of the Escherichia coli stress protein UP12, a putative in vivo substrate of GroEL pptx
... accession no U00096 [ 15] ), was amplified by PCR using a 5 complementary deoxyoligonucleotide (5 -CGCGGATCCATGTATAAGACAATCATTATGC-3¢) containing a BamHI site (underlined nucleotides) and a 3¢ deoxyoligonucleotide ... deoxyoligonucleotide harboring a HindIII site (5 -CCCAA GCTTTTAACGCACAACCAGCACC-3¢) as primers with E coli genomic DNA as a template and Taq polymerase (Roche Molecular Biochemicals) Next, the purified ... accumulate at the early stationary phase, and its Ó FEBS 2002 steady-state level increases further during the late stationary phase As a result of this accumulation, the relative amount of UP12 in stationary...
- 9
- 548
- 0
Báo cáo khoa học: In vivo production of catalase containing haem analogues pot
... Ru-meso-KatA were all different and distinct from that of Fe-PP-KatA (Fig 3A, B) (maxima at 430, 54 4 and 57 7 nm for Co-PP-KatA, at 420, 55 1 and 59 0 nm for Sn-PP-KatA, at 421, 55 4, 57 4, 629 and 670 ... gallium-containing catalases are presented in Fig 3A, B Fe-PP-KatA showed a Soret peak at 406 nm and weak absorption bands at 50 4, 54 1 and 6 25 nm These features are characteristic for haemcontaining catalases ... polypeptide to form a gallium-substituted catalase protein (Ga-PP-KatA) Purification and characterization of Ga-PP-KatA The His6-tagged iron-containing (Fe-PP-KatA) and Ga-PP-KatA catalases were purified...
- 10
- 419
- 0
Báo cáo khoa học: A steady-state modeling approach to validate an in vivo mechanism of the GAL regulatory network in Saccharomyces cerevisiae ppt
... cytoplasmic signaling protein Proc Natl Acad Sci USA 99, 854 8– 855 3 12 Verma, M., Bhat, P.J & Venkatesh, K.V (2003) Quantitative analysis of GAL genetic switch of Saccharomyces cerevisiae reveals ... Expression of GAL genes in a mutant strain of Saccharomyces cerevisae lacking GAL80: Quantitative Model and Experimental Verification Biotechnol Appl Biochem 39, 89–97 20 Broach, A. R (1979) Galactose ... cytoplasm Gal3p Activated Gal3p Operator of genes with one binding site for Gal4p Operator of genes with two binding site for Gal4p Molar balance equations The following are the molar balance equations...
- 11
- 490
- 0
Báo cáo khoa học: Death inducer obliterator protein 1 in the context of DNA regulation Sequence analyses of distant homologues point to a novel functional role docx
... shown Black geometrical shapes are additional domains, as indicated ANOGA, Anopheles gambiae; ASHGOS, Ashbya gossypii; BRARE, Brachydanio rerio; CANDGLA, Candida glabrata; CIONA, Ciona intestinalis; ... Shearn A (1989) The ash-1, ash-2 and trithorax genes of Drosophila melanogaster are functionally related Genetics 121, 51 7 52 5 13 Mazo AM, Huang DH, Mozer BA & Dawid IB (1990) The trithorax gene, ... DIDO-related apoptosis occurs as a result of alterations in DNA regulation caused by chromatin instability Computational analyses Although all splice variants share common domains, long regions of...
- 7
- 658
- 0
Báo cáo khoa học: A mouse model for in vivo tracking of the major dust mite allergen Der p 2 after inhalation docx
... lung Autoradiograms of separated liver and thoracic lymph node proteins revealed a radioactive band of 25 kDa in liver and bands of 30 and 56 kDa in thoracic lymph nodes (Fig 5C) No radioactive ... that the clearance and further metabolism of the allergen was altered as a result of the inflammation in the lungs of sensitized animals Up to now there are few data available on the fate of an ... tracking after intratracheal (i.t.) administration of an airborne allergen relevant for human allergic disease The fate of Der p was followed both at the whole-body level by autoradiography and...
- 12
- 518
- 0
Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc
... amplification with primers 5 -CACCAC CACCACCACCACGAAGCTGGAGATGATCGTGCT-3¢ (His-tag underlined) or 5 -TGGAGCCACCCGCAGTTCG AAAAAGAAGCTGGAGATGATCGTGCT-3¢ (Strep-tag underlined) and 5 -GCGGCATGCTCATCCAAAGAAGC ... 5 -GCGGAGCTCATGGCCAC AAGCGCATCAGC-3¢ and 5 -GTGGTGGTGGTGGTGG TGGAAATGGGTTTTTCCGTTCTGC-3¢ (His-tag underlined) or 5 -TGGAGCCACCCGCAGTTCGAAAAAGAA GCTGGAGATGATCGTGCT-3¢ (Strep-tag underlined), then a secondary amplification ... designed as follows: PSAG with a C-terminal hexa-histidine tag (PSI-G-HisTerm), 5 -GCGGAGCTCAT GGCCACAAGCGCATCAGC-3¢ and 5 -GCGGCATGCT CAGTGGTGGTGGTGGTGGTGTCCAAAGAAGCTTG GGTCGTAT-3¢ (His-tag underlined);...
- 9
- 422
- 0
Báo cáo khoa học: In vivo studies of altered expression patterns of p53 and proliferative control genes in chronic vitamin A deficiency and hypervitaminosis pot
... following primers (5 -TGAGTGCA AGCGGTGTCTTA-3¢ (forward) and 5 -TAGTGGTGA TGTGCCCATG-3¢ (reverse); primers for p21WAF1/CIF1: 5 -ACAGCGATATCGAGACACTCA-3¢ (forward) and 5 -GTGAGACACCAGAGTGCAAGA-3¢ (reverse); ... primers for p53: 5 -CACAGTCGGATATGAGCATC-3¢ (forward) and 5 -GTCGTCCAGATACTCAGCAT-3¢ (reverse) and primers for cyclin D1: 5 -TGTTCGTGGC CTCTAAGATGA-3¢ (forward) and 5 -GCTTGACTCCA GAAGGGCTT-3¢ ... rRNA: 5 -GAGTATGGTCGCAAGGCTGAA-3¢ (forward) and 5 -GCCTCCAGCTTCCCTACACTT-3¢ (reverse) 18S Ó FEBS 2003 Vitamin A status and proliferative control genes (Eur J Biochem 270) 14 95 rRNA was simultaneously...
- 9
- 508
- 0
Báo cáo Y học: In vivo activation of plasma membrane H+-ATPase hydrolytic activity by complex lipid-bound unsaturated fatty acids in Ustilago maydis docx
... vivo activation by ethanol of plasma membrane ATPase of Saccharomyces cerevisiae App Env Microbiol 57 , 830–8 35 ´ Fernandes, A & Sa-Correia, I (2001) The activity of plasma membrane H+-ATPase is ... yeast plasma membrane ATPase by vanadate Biochim Biophys Acta 642, 173–181 36 Wach, A & Graber, P (1991) The plasma membrane H+-ATPase from yeast Effects of pH, vanadate and erythrosine B on ATP hydrolysis ... for each species, activation of the plasma membrane H+-ATPase by increases in the unsaturation of the CLB-fatty acids is a physiological and relevant effect in stress adaptation in plants and...
- 6
- 469
- 0
Báo cáo khoa học: A study of microRNAs in silico and in vivo: bioimaging of microRNA biogenesis and regulation doc
... elucidate the real function of miRNAs (Fig 1F) In general, the functional actions of miRNAs in mammalian cells, unlike plant cells, are associated with the translational inhibition of target mRNAs ... cancer treatment, as overexpression of antimiRNA21 in hepatocellular carcinoma and glioblastoma cells was shown to down-regulate the oncogenic miRNA21 [ 35] Based on the use of anti-miRNA21 as ... al Bioimaging of miRNA biogenesis and regulation Fig Schematic illustration of detection systems for imaging miRNA biogenesis and regulation (A) Steps of miRNA processing Precursor miRNA is generated...
- 10
- 463
- 0
Báo cáo khoa học: In vivo degradation of nitric oxide synthase (NOS) and heat shock protein 90 (HSP90) by calpain is modulated by the formation of a NOS–HSP90 heterocomplex pot
... et al Table Levels of native and 15 kDa calpastatin species in brain and aorta of NMS and HMS rats treated with HSD for weeks The data reported are the arithmetical means ± standard deviation of ... was only partially B Fig Levels of calpain isoforms and calpain substrates in the aorta of NMS and HMS rats treated with HSD Aliquots (100 lg protein) of brain soluble material (A) and aorta ... Differential degradation of calpastatin by l and m-calpain in Ca2+ enriched human neuroblastoma LAN -5 cells FEBS Lett 4 75, 17–21 33 Sasaki T, Kishi M, Saito M, Tanaka T, Higuchi N, Kominami E, Katunuma...
- 11
- 344
- 0
báo cáo hóa học:" In vivo properties of the proangiogenic peptide QK" pdf
... were evaluated by analysis of variance (ANOVA) Statistical Analysis All data are presented as the mean value ± SEM Statistical differences were determined by one-way or two-way ANOVA and Bonferroni ... stimulating angiogenesis or angioma-genesis? Nat Med 2000, 6:1102-1103 Khurana R, Simons M, Martin JF, Zachary IC: Role of angiogenesis in cardiovascular disease: a critical appraisal Circulation 20 05, ... was performed where applicable A p value less than 0. 05 was considered to be significant All the statistical analysis and the evaluation of data were performed using GraphPad Prism version 5. 01...
- 10
- 679
- 0
Báo cáo hóa học: " In vivo evidence of htid suppressive activity on ErbB-2 in breast cancers over expressing the receptor" potx
... 5' -GTT GAC ATT CAA TCA AGC TGC-3'(sense) and 5' -CTG GGA TAT CAT GAG GTA AAC-3'(antisense), htid-I, 5' -GTT GAC ATT CAA TCA AGC TGC-3'(sense) and 3'-CCA GTG GAT CTT TTT CCA GAG -3'(antisense) and ... sample loading and the amount of input cDNA Amplification of HGPRT was performed using the primers 5' TGA CAC TGG CAA AAC AAT GCA-3' (sense) and 5' GGT CCT TTT CAC CAG CAA GCT-3' (antisense) at ... amplification, characterizes 20-30% of human breast cancers being casually linked to an aggressive clinical course of these tumors [17] and a variable percentage of extra-mammary tumors [18] These data are...
- 13
- 376
- 0
báo cáo hóa học:" Function of anterior talofibular and calcaneofibular ligaments during in-vivo motion of the ankle joint complex" docx
... medial-lateral direction Parallel, sagittal, coronal and axial images with a resolution of 51 2 × 51 2 pixels were taken, separated at mm intervals (a sample sagittal MR slice is shown on Figure 1a) ... rigorously validated and has an accuracy of 0.1 mm in translation and 0.18 degrees in rotation.[ 15] Measurement of apparent length of the ligaments The apparent lengths of the ligaments were defined as ... plantarflexion ATFL and CFL as measured at and at neutral Lengths the(PF), maximal dorsiflexion (DF) maximal Lengths of the ATFL and CFL as measured at maximal plantarflexion (PF), maximal dorsiflexion...
- 6
- 369
- 0
báo cáo hóa học:" In vivo evaluation of a vibration analysis technique for the per-operative monitoring of the fixation of hip prostheses" pdf
... appropriate software (Pimento 5. 2, LMS International, Haasrode, Belgium) The vibration analyser generates the excitation signal which is amplified and sent to the shaker The vibration analyser, ... left (stage B in Figure 6a) Case An oscillating behaviour of the FRF graph was observed during another per-operative hip arthroplasty procedure (stages 7, 8, and in Figures 7a and 7b) After a supplementary ... characterization of the primary stem-femur contact and the assessment of primary stem stability in the first place may help to improve the survival rate of THR Nowadays objective intra-operative...
- 10
- 542
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose