proteomic investigations of isolated micro compartments of c paradoxa and electron microscopy of cells grown under
Báo cáo lâm nghiệp: "Divergence among species and populations of Mediterranean pines in biomass allocation of seedlings grown under two watering regimes" pps
... histories, and presently occupy different ecological niches [4], with marked differences in water availability [14] The objectives of this research were to check for differences among closely related species ... halepensis and P canariensis, while the four Table II Proportion of the variance due to treatment, species and treatment by species interaction in the inter-speci c analysis and significance of the corresponding ... [36] Schlichting C. D., The evolution of phenotypic plasticity in plants, Annu Rev Ecol Syst 17 (1986) 667–693 [37] Schlichting C. D., Pigliucci M., Phenotypic evolution – A reaction norm perspective,...
- 11
- 431
- 0
Báo cáo khoa học: NMR investigations of subunit c of the ATP synthase from Propionigenium modestum in chloroform/methanol/water (4 : 4 : 1) pot
... & Altendorf, K (1995) The F0 complex of the Escherichia coli ATP synthase Investigation by electron spectroscopic imaging and immunoelectron microscopy Eur J Biochem 230, 58–67 12 Kaim, G., Wehrle, ... subunit c preparations (a) Amino-acid sequence of E coli subunit c and location of a helices in the structure in chloroform/methanol/water (4 : : 1) [23], amino-acid sequence of P modestum subunit c ... usage of different reference standards Secondary structure and global fold As indicated by helix-characteristic NOE connectivities [35], subunit c in chloroform/methanol/water (4 : : 1) consists of...
- 5
- 462
- 0
Báo cáo y học: "Proteomic analysis of mechanisms of hypoxia-induced apoptosis in trophoblastic cells"
... ATC ATC GC-3’ PTEN: sense, 5'-CCA ATG TTC AGT GGC GGA ACT-3; antisense, 5'-GAA CTT GTC TTC CCG TCG TGTG-3' GAPDH: sense, 5’-CAT GGA GAA GGC TGG GGC TC-3’, an- 38 tisense, 5’-CAC TGA CAC GTT GGC ... GCTGAGCCAGGCCCGCACTTGTTGA-3’ Morpholino oligomer 5’-CCTCTTACCTCAgTTACAATTTATA-3’ was used for the negative control JAR cells were seeded on 25 cm2 flasks and after 48 hours, when they had reached ... Neck Squamous Cell Carcinoma Using cDNA Microarray and PowerBlot Clin Cancer Res 2002; : 3910-3921 10 Spencer K., Yu CKH., Cowans NJ., Otigbah C. , Nicolades KH Prediction of pregnancy complications...
- 9
- 499
- 0
Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx
... level of a-synuclein in a-syn cells with respect to b-gal cells in the presence of catalase only (cat) or in the presence of catalase and 0.250 mm dopamine for 24 h (DA) Dopamine treatment significantly ... V-FITC were collected through a 575 and a 530 ⁄ 30 bandpass filter, respectively The percentage of apoptotic cells in each sample was determined based on the fraction of annexin V positive cells ... dopamine toxicity to speci c cellular processes such as cytoskeleton structure and regulation, mitochondrial function, energetic metabolism, protein synthesis and neuronal plasticity From the consequent...
- 11
- 775
- 0
Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt
... (5¢-GTGGCTGGAACAGGAGCGCCATATTTTACA ACTGATTCG) and F133A-rv (5¢-CGAATCAGTTGTAA AATATGGCGCTCCTGTTCCAGCCAC) The mutations were verified by DNA sequencing using the BigDye terminator cycle sequencing ... (5¢-GATTTTTGTGGCT GGAACAGGAAACCCATATTTTACAACTGATTCG) and F133N-rv (5¢-CGAATCAGTTGTAAAATATGGGT TTCCTGTTCCAGCCACAAAAAT), with the altered nucleotides shown in bold and underlined The F133A mutation was created ... between A + C, B + E and D + F, and (c) electrostatic forces in the central channel of the hexamer between B, C and F, and A, D and E The hydrophobic interactions between A and B (Fig 3A,B) are...
- 12
- 656
- 0
Tài liệu Báo cáo khoa học: Functional studies of active-site mutants from Drosophila melanogaster deoxyribonucleoside kinase Investigations of the putative catalytic glutamate–arginine pair and of residues responsible for substrate specificity docx
... 5¢-GCCTGCTGACCGACCCCGTCGAGAAG TGGCGC-3¢ E52D-rev: 5¢-GCGCCACTTCTCGACGGG GTCGGTCAGCAGGC-3¢ E52H-fwd: 5¢-GCCTGCTGAC CCACCCCGTCGAGAAGTGGCGC-3¢ E52H-rev: 5¢-GC GCCACTTCTCGACGGGGTGGGTCAGCAGGC-3¢ E52Qfwd: 5¢-GCCTGCTGACCCAGCCCGTCGAGAAGTGG ... 5¢-GCCTGCTGACCCAGCCCGTCGAGAAGTGG CGC-3¢ E52Q-rev: 5¢-GCGCCACTTCTCGACGGGCTG GGTCAGCAGGC-3¢ Y70W-fwd: 5¢-CTGCTGGAGCT GATGTGGAAAGATCCCAAGAAG-3¢ Y70W-rev: 5¢-CTT CTTGGGATCTTTCCACATCAGCTCCAGCAG-3¢ Q81Nfwd: ... 5¢-TGGGCCATGCCCTTTAACAGTTATGTCACG CTG-3¢ Q81N-rev: 5¢-CAGCGTGACATAACTGTTAAA GGGCATGGCCCA-3¢ R105H-fwd: 5¢-GCTAAAAATAA R105HTGGAGCACTCCATTTTTAGCGCTCGC-3¢ rev: 5¢-GCGAGCGCTAAAAATGGAGTGCTCCATTAT...
- 10
- 504
- 0
Tài liệu Báo cáo khoa học: Adaptive changes in the expression of nuclear and mitochondrial encoded subunits of cytochrome c oxidase and the catalytic activity during hypoxia pptx
... nuclear genome coded isoforms of CytOX V [10,32] The regulation of genes CytOX5a and CytOX5b, coding for the two isofoms Va and Vb, parallels that of genes CYC1 and CYC7, which encode iso-1 and ... iso-2 of yeast cytochrome c, respectively CytOX 5a and CYC1 are coexpressed under aerobic conditions (O2 > 0.5 lM), whereas CytOX 5b and CYC7 are co-expressed under hypoxic (O2 < 0.5 lM) and heme ... mitochondria from these cells (A), transcription rates as in PC12 cells (B) and macrophages (C) were shown (D) shows the levels of mtTFA in PC12 cells and macrophages grown under normoxia and...
- 9
- 554
- 0
Tài liệu Báo cáo khoa học: Isoprenoid biosynthesis via the methylerythritol phosphate pathway Mechanistic investigations of the 1-deoxy-D-xylulose 5-phosphate reductoisomerase ppt
... 3-H); 1 3C- NMR (50 MHz, CDCl3): d ¼ 19.80 (CH3); 20.62 (CH3); 20.71 (CH3); 62.67 (CH2); 68.02 (CH2); 71.95 (quaternary C, C- 2); 72.54 (CH, C- 3); 169.99 (CO); 170.85 (2 · CO) Isomerization of 2 -C- methyl-D-erythrose ... the influence of the concentrations of NADP+ and MEP 5, the substrates of the reverse reaction, and of NADPH and DXP 3, the products of the reaction, on the total amount of NADPH produced were ... [5-1 3C] MEP or [2-1 3C] MEP and NADP+, a decrease of the C- 5 (d ¼ 17.7 p.p.m.) or of the C- 2 (d ¼ 73.2 p.p.m.) signals from MEP was observed, accompanied by a concomitant appearance and following increase...
- 12
- 342
- 0
Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx
... enhancing effect of TS on LPS/IFN-induced NO production is caused by enhancement of iNOS protein induction Effects of a-T and its derivatives on the enhancement by TS of LPS/IFN-induced NO production ... N., Mayne, G .C. , Olejnicka, B., Negre-Salvayre, A., Stı´ cha, M., Coffey, R.J & Weber, C (2001) Induction of cancer cell apoptosis by a-tocopheryl succinate: molecular pathways and structural requirements ... PKCa was increased slightly by treatment with LPS/IFN Addition of 10 lM TS to the LPS/IFN-system enhanced the amount of PKCa However, we could not detect PKCb in control cells, and no change of...
- 6
- 494
- 0
Báo cáo khoa học: Increased expression of c-Fos by extracellular signal-regulated kinase activation under sustained oxidative stress elicits BimEL upregulation and hepatocyte apoptosis pot
... 5¢-CTCCCTGGTCTCTCATCTGTCCTTCCCA CC-3¢; Myb3 Se, 5¢-CCTCCTGAGGCTTCCATCTGGCG GCCGCGG-3¢) Mutations were confirmed by nucleotide sequencing Transfection and luciferase activity assays Cells were cotransfected ... Clara, CA, USA) (primers: AP-1 Se, 5¢-CCGTCAGCGGT GACTTGGATTCACAGAGAC-3¢; FOXO Se, 5¢-CAAGT CACTAGGGTACCCACGCCGGGGTGG-3¢; Myb1 Se, 5¢-GACCAAGATGGTCCATCGGTGGGACGACAG-3¢; Myb2 Se, 5¢-CTCCCTGGTCTCTCATCTGTCCTTCCCA ... The sequences of the forward and reverse primers were: Fw, 5¢-CCAGATCCCCACTTTTCATC-3¢; and Rv, 5¢-AAGAG AAATACCCACTGGAGGA-3¢ The sequence of the TaqMan fluorogenic probe was 5¢-TGCTGTCC-3¢ (Universal...
- 9
- 556
- 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx
... ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG ... Synthetic oligonucleotides used in this study Oligonucleotide name Sequence (5¢- to 3¢) OMCA-KO-F OMCA-KO-R OMCB-KO-F OMCB-KO-R OMCA-F OMCA-R OMCB-F OMCB-R OMCA-PBAD-F CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT ... halfvelocity constant As we have determined the OmcA and OmcB concentrations present in omcB– and omcA– cells, respectively, and because omcA– omcB– double mutant cells completely lack Fe(III) reductase...
- 11
- 731
- 0
Báo cáo khoa học: Vanadium-induced apoptosis of HaCaT cells is mediated by c-fos and involves nuclear accumulation of clusterin pptx
... from confluent monolayers of HaCaT Neo and HaCaT c- fos cells and total proteins isolated from HaCaT cells and HaCaT cells expressing nCLU (C1 20) were analyzed for the expression of CLU or b-actin ... the effect of sCLU and Bcl-2 overexpression on VOSO4-induced apoptosis of HaCaT cells, DNA and proteins were isolated from floating and attached HaCaT NeoT, HaCaT sCLU and HaCaT Bcl-2 cells treated ... keratinocyte pooled cell lines Generation of the nCLU (C1 20) plasmid and nCLU (C1 20)-expressing HaCaT cells Using speci c primers: (C1 20, HindIII, forward, 5¢-CGAA TTCGCGGAAGCTTCATGTCTGTGGACT-3¢; and...
- 16
- 312
- 0
Báo cáo khoa học: Separation and characterization of caveolae subclasses in the plasma membrane of primary adipocytes; segregation of specific proteins and functions docx
... used biochemical analysis, fluorescence confocal microscopy and electron microscopy to identify the HD-caveolae as speci c sites of fatty acid uptake and conversion to triacylglycerol, including ... identification [5] of two morphologically distinct classes of caveolae at the plasma membrane ) canonical caveolae that are open to the extracellular space and caveolae lacking access from the cell ... transmission electron microscopy (A) VHDcaveolae (B) HD-caveolae (C) LD-caveolae proteins were detected in the HD-caveolae and LD-caveolae, particularly in the LD-caveolae, but there was no labelling coinciding...
- 12
- 460
- 0
Báo cáo khóa học: C-, 15N- and 31P-NMR studies of oxidized and reduced low molecular mass thioredoxin reductase and some mutant proteins docx
... reduction, and those of C( 6) and C( 7) are upeld shifted by a p -electron density increase coming from N(5) and N(10), respectively In contrast the chemical shifts of C( 2), C( 4a), C( 5a), C( 9a) and ... 109:5 dCi;sp ị dCi;sp ị 1ị where, Ci is C( 9a) or C( 10a) for the calculation of the endocyclic angle of N(5), d(Ci,sp3) and d(Ci,sp2) are the corresponding limit chemical shifts of carbon atom Ci ... wild-type TrxR E159Y mutant TrxR C1 38S mutant TrxR C1 38S mutant + PMA C( 2) C( 4) C( 4a) C( 5a) C( 6) C( 7) C( 7a) C( 8) C( 8a) C( 9) C( 9a) C( 10a) C( 10a) C( 10b) C( 10 c) C( 10d) C( 10e) N(1) N(3) N(5) N(10) 159.8...
- 16
- 378
- 0
Báo cáo khoa học: Bovine tryptases cDNA cloning, tissue specific expression and characterization of the lung isoform ppt
... GGCGATGGTTGCGCGAAGCCCAACCGGCCCGGCATCTACACCCGCGTCACCTCCTACCTGGACTGGATCCAC 792 CAGTACGTCCCCCAGGGGCCCtgagcctggtccccaggccgccccctgggtcagcggaggagctggccccca 864 ♦ cagtcccctcaacactgcttccggccgaggaggagaccttcccccaccttccccggccccctgtcccagtgc ... CAGTACGTCCCCCAGGGGCCCtgagcctggtccccaggccgccccctggtcagcggaggagctggccccctc 864 Q Y V P Q G P ♦ (245) tgtcccctcagcgctgcttccggcccgaggaggagaccttcccccaccttccctggccccctgcccaatgcc 936 cacccctggctgacccctctctgctgacccctccctgccctgaacccctgccccagccccctccccactagc ... cacccctggctgacccctctctgctgacccctccctgccctgaacccctgccccagccccctccccactagc 1008 tcagggcgctggcaggggctgctgacactcataaaaagcatggagagcag 1058 B -20 AGCAGCCTGGACCTGCCAAG -1 ATGCTCCATCTGCTGGCGCTCGCCCTCCTGCTGAGCCTGGTCTCCGCAGCCCCTGGCCAGGCCCTGCAGCGC...
- 11
- 527
- 0
Báo cáo khoa học: Comparative proteomic analysis identifies proteins associated with the development and progression of colorectal carcinoma pot
... genesis and progression of CRC L Zhao et al evaluate the correlation between clinicopathological characteristics of CRC and expression of these target proteins, in order to better understand the mechanisms ... and progression of CRC Fig Immunohistochemical staining of RhoGDI, S100A9 and LASP-1 in normal colorectal mucosa, nmCRC and mCRC Immunoreactivity to RhoGDI, S100A9 and LASP-1 staining was localized ... by celecoxib in colorectal cancer cells Cancer Epidemiol Biomarkers Prev 15, 1598–1606 Skandarajah AR, Moritz RL, Tjandra JJ & Simpson RJ (2005) Proteomic analysis of colorectal cancer: discovering...
- 10
- 366
- 0
Báo cáo khoa học: Proteomic characterization of lipid raft proteins in amyotrophic lateral sclerosis mouse spinal cord pot
... (Molecular probes), washed, and then mounted using vectashield-mounting medium Fluorescence microscopy was carried out using a Leica DM IRBE laser scanning confocal microscope with a · 100 objective ... QSTAR XL under the control of analyst qs software (ABI/MDS Sciex, Foster City, CA, USA) Each cycle typically consisted of one s MS survey scan from 350 to 1600 (m ⁄ z) and two s MS ⁄ MS scans with ... Asara JM, Christofk HR, Freimark LM & Cantley LC (2008) A label-free quantification method by MS ⁄ MS Lipid raft proteomics of ALS TIC compared to SILAC and spectral counting in a proteomics screen...
- 16
- 281
- 0
Báo cáo khoa học: Platination of telomeric sequences and nuclease hypersensitive elements of human c-myc and PDGF-A promoters and their ability to form G-quadruplexes Viktor Viglasky potx
... of telomerase activity by cisplatin in human testicular cancer cells Eur J Cancer 3, 638–644 19 Ishibashi T & Lippard SJ (1998) Telomere loss in cells treated with cisplatin Proc Natl Acad Sci ... affinity of the platinum complex to attack N7 of the quinines The schemes in (B) and (C) represent Tel-1 and c- MYC oligomers, respectively The c- MYC oligomer contains three guanine residues located ... image processing was used to determine an objective curve consisting of the darkest points of the electrophoretic records of the deformed electrophoretic band representing the dependence of DNA...
- 9
- 324
- 0
![Báo cáo khoa học: Investigation of the interaction between the atypical agonist c[YpwFG] and MOR docx](https://media.store123doc.com/images/document/14/rc/ht/small_57MlXT7HZ5.jpg)
Báo cáo khoa học: Investigation of the interaction between the atypical agonist c[YpwFG] and MOR docx
... description of the binding mode and the electronic and steric properties of the c[ YpwFG] ligand Results Synthesis and pharmacological characterization of the cyclopeptides c[ YpwFXaa] We synthesized compound ... occur in a receptor upon ligand binding, a more detailed description of the binding mode of the ligand, and, in the case of QM methods, a complete description of reaction mechanisms and electronic ... S1 Spectroscopic characterization of compounds 3, and Fig S1 1H-NMR spectra of compounds 3, and Figs S2–S4 ROESY analyses of compounds 3, and 8, respectively Fig S5 Side and top views of compounds...
- 23
- 308
- 0
Báo cáo khoa học: Differential involvement of protein kinase C alpha and epsilon in the regulated secretion of soluble amyloid precursor protein docx
... translocation takes place we subjected the cells to immunocytochemical analysis and confocal microscopy PKCa (Fig 2) and PKCe (Fig 3) were detected predominantly in the cytoplasm of untreated cells; ... downregulation of PKCa reduces the sensitivity of the cells to direct PKC activation Higher concentrations of PMA are necessary to elicit a significant secretion of sAPPa in SYa4 cells, perhaps necessary ... increasing concentrations of carbachol did not elicit a significant release of sAPPa, in contrast to parallel experiments conducted on SYwt and SYa4 cells which responded to carbachol with a concentration-dependent...
- 8
- 458
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008