ω for integration with standard system the even and odd mode characteristic impedances ze and zo of the coupled section can be adjusted by altering the width of strip lines and gap between two coupled lines 12 therefore t
Tunable ferroelectric thin film devices for microwave applications
... capacitor The dielectric constant of thin film is calculated from the capacitance of the capacitor, and the loss factor of the thin film is estimated from the quality factor of the capacitor The two ... devices can be tuned continuously or switched between the two states The latter technique makes use of the magnetic hysteresis of the ferrite core to store a remanent permeability The switching ... ferroelectric thin film can be calculated given the geometry of the IDC, the thickness of the ferroelectric thin film, the thickness and 29 dielectric constant of the substrate, and the measured...
- 150
- 478
- 0
Vector sum phase shifter using a quadrature magic t for application in polarization control
... inherently good regardless of the amplitude of the either input ports Most importantly, the phase difference between the two resultant signals can be tuned by varying the gains of the two VGAs ... perform vector 18 summation at the two output ports for the signals fed from the sum- and deltaports Due to the quadrature phase arrangement, the amplitude balance between the two output ports is ... Therefore, both signals can be transmitted at the same frequency without interfering with each other When such systems are used, polarization alignment between the base station on earth and the...
- 144
- 238
- 0
Tài liệu Category 6 and 5e Dynamic Angle Right/Left Patch Panels pptx
... are current as of the date of publication of this document Because we are continuously improving our products, ADC reserves the right to change specifications without prior notice At any time, you ... product specifications by contacting our headquarters office in Minneapolis ADC Telecommunications, Inc views its patent portfolio as an important corporate asset and vigorously enforces its patents ... Spec Sheet Specifications Performance: Applications Supported: Front Interface: Rear Interface: Weight: Rack Mounting: Safety: Operating Temperature: Storage Temperature: EIA/TIA 568-B Category...
- 2
- 288
- 0
Tài liệu Báo cáo khoa học: The Alzheimer b-peptide shows temperature-dependent transitions between left-handed 31-helix, b-strand and random coil secondary structures doc
... due to the structural transition The temperature dependence of the transition can be studied, and if the populations of the structural entities can be determined, the parameters s and r can be ... have led to estimations of the propensity of the amino acids for the PII-helix [14] Using these results to predict the secondary structure of the Ab-peptide shows that the PII content of the full ... varying temperatures, the energy landscape close to the solution structure is explored and information on the structural transitions of the peptide is obtained The temperature-induced structural transitions...
- 12
- 287
- 0
transmission line matrix (tlm) in computational mechanics - d. de cogan, et al., (crc, 2006) ww
... electromagnetic theory Their most important property in this context is the introduction of a time-delay for signals travelling between points in the electrical network The distribution of mesh points in the ... constrained to be zero Imagine the link line in Figure 2.3 to be at the rightmost extremity of the system, with the boundary located at the mid-point, such that impulse f is leaving the system and ... independently of any other Any interaction occurs only when they meet This effectively time discretizes the problem, and further, the smallest time unit that can be considered is the interval between...
- 275
- 514
- 0
Báo cáo hóa học: " Efficient implementation of 90° phase shifter in FPGA" pptx
... http://asp.eurasipjournals.com/content/2011/1/32 simple bit shifting of the input signal X(n) to the right for a specific number of positions to get the various shifted signals which forms the input to the coefficient add/sub ... in the CSD is kept minimum for efficient hardware implementation The number of taps is varied till the desired response is obtained The number of filter taps after optimization is 27 and the ... architecture, it was tested with sinusoidal inputs of three different frequencies A 7, 13, and 20 MHz sine input was given at the input of the A/D Conclusion The Hilbert transformer design with...
- 5
- 303
- 0
Báo cáo nghiên cứu khoa học: " FAST CALCULATING FORMULAS OF CURRENT PASSING THROUGH GROUNDING SYSTEM OF HIGH VOLTAGE SUBSTATION WHEN LIGHTNING STRIKES AT THE GROUNDING WIRE OF TRANSMISSION LINE" pps
... where Z pTD is the elementary impedance of T -circuit equivalent to the right of the position that lightning strikes (Ω) Z th 02 is the Thevenin impedance of the grounding wire of transmission ... strikes to the second substation) (Ω) Z1 is the grounding system impedance of first substation (Ω) I is the lightning current value (kA) Case two: When lightning strikes at the k th pole on the ... ⎩ The two- terminals network with the characteristic matrix determined at (A.2) is transformed inversely into T -elements equivalent circuit as in Fig A.1 Fig A1 Equivalent Thevenin circuit Trang...
- 8
- 451
- 0
Báo cáo y học: "Acute pressure overload of the right ventricle. Comparison of two models of right-left shunt. Pulmonary artery to left atrium and right atrium to left atrium: experimental study" doc
... inlet pressure, P o : outlet pressure, L: total length of the tube in the x direction (meters), R: is the radius Because of the anatomical contiguity between pulmonary artery and left atrium, the ... constitutes a risk factor for heart transplantation procedure because of the dysfunction of the right ventricle of the graft [9] Dysfunction of the right ventricle (RV) can occur in a number of ... data are available regarding the effects of a shunt not at the atrial level but from the pulmonary artery to the left atrium The purpose of this study was to examine the effects of right ventricle...
- 10
- 337
- 0
Broadband phase shifter design for phased array radar systems
... fixed antenna lattice, the radiation pattern is determined by the phase setting of the phase shifters and amplitude setting of the attenuators [15] Therefore, the phase error and the amplitude imbalance ... is the characteristic impedance of the system The phase shift can be obtained by changing ω0 of two all-pass networks and a phase shift peak will be obtained for each setting The advantage of the ... shift ripple and the bandwidth can be significantly improved For the two -section phase shifter, the bandwidth ratio increases to 4:1 for the same performance of the single -section phase shifter...
- 199
- 297
- 0
Transmission line and and waveguide
... TE Mode 33 TE mode solution can be obtained by solving Laplace’s equation: Solution for TE Mode 34 Solution for TE Mode 35 Constants 36 Solution for TE10 Mode 37 Attenuation 38 TM Mode 39 TM ... waveguide that can support TE, TM and TEM TEM Mode 20 TEM mode solution can be obtained by solving Laplace’s equation: The boundary condition for : There is no variation in x, the solution is: Electromagnetic ... condition: TEM Mode (Cont.) 49 Because the boundary conditions not vary with φ, the potential (ρ, φ) should not vary with φ, then kΦ = TEM Mode (Cont.) 50 Apply the boundary conditions give: Outline...
- 67
- 226
- 0
Báo cáo hóa học: " Research Article Blind Deconvolution in Nonminimum Phase Systems Using Cascade Structure" pptx
... phase system, the zeros locate in the interior and outer of the unit circle If all zeros of a system are in the interior of the unit circle of complex plane, the system is minimum phase Submitting ... illustrates the comparison results of the three algorithms It shows that the performances of PFD and NG are similar, and both of them are better than FD algorithm That is because the FD algorithm uses ... we know that the demixing model can be constructed by two parts: a causal filter F(z) and an anticausal scalar filter a(z−1 ) The two subfilters can exchange their positions because the filter a(z−1...
- 10
- 229
- 0
microwave circuit modeling using electromagnetic field simulation
... connection between elements and the control parameters for the simulation were stored in a text file called a netlist The netlist syntax was similar but unique for each software tool The mathematical ... complete circuits with a fieldsolver, what is the best strategy for integrating these tools into the design process? The best approach is to identify the key pieces of the problem that need the fieldsolver, ... projects fit the capabilities of the tool better Small projects run faster and tend to encourage some “what if” experimentation with the geometry And with a small project there is always a chance that...
- 488
- 730
- 0
Báo cáo sinh học: " Multivariate Bayesian analysis of Gaussian, right censored Gaussian, ordered categorical and binary traits using Gibbs sampling" pptx
... data pattern is generated independently of the random vector associated with the complete data The complete data are simulated as follows: First records at the normally distributed level of the ... reasonable to assume that the residuals of liabilities of the binary traits are independent, i.e the model associated with (2) is to be preferred The Gibbs sampler outlined for the model associated with ... 4.4.1 For the model associated with (2), the strategy is slightly different and is presented in Section 4.4.2 4.4.1 Model associated with (1) The fully conditional posterior distribution of the...
- 25
- 166
- 0
Supported group II transition metal catalysts in liquid phase reactions using borrowing hydrogen methodology 2
... Declaration I hereby declare that this thesis is my original work and it has been written by me in its entirety, under the supervision of Prof Stephan Jaenicke, (in the laboratory catalysis ... S5-04-04 and S5-02-02), Chemistry Department, National University of Singapore, between August 2008 and December 2 012 I have duly acknowledged all the sources of information which have been used in the ... the thesis This thesis has also not been submitted for any degree in any university previously The content of the thesis has been partly published in: H H Liu, G K Chuah, S Jaenicke*, N-alkylation...
- 2
- 324
- 1
Supported group II transition metal catalysts in liquid phase reactions using borrowing hydrogen methodology 1
... on the surface and tend to sinter at the high temperature The final step in the preparation of supported nanoparticle heterogeneous catalysts is the transformation of the precatalyst to the active ... reduction of substituted nitroaromatics They suggested that nitrobenzene interacts with the catalyst surface through the nitro group, and the silver clusters play an important role in the H2 activation ... third step is necessarily exothermic to approximately the same extent as the first step is endothermic The third step can therefore help to drive the first step This type of transformation has been...
- 221
- 658
- 0
Sự khác biệt giữa LEFT JOIN , RIGHT JOIN , INNERJOIN
... Hansen, Ola Svendson, Tove Svendson, Stephen Svendson, Stephen Pettersen, Kari Product Printer Table Chair Ví dụ: RIGHT JOIN Cú pháp: SELECT c t_ 1, c t_ 2, c t_ 3 FROM bảng_1 RIGHT JOIN bảng_2 ON bảng_1.khoá_chính ... Li t kê t t m t hàng đ t tên người đ t hàng (nếu có): SELECT Employees.Name, Orders.Product FROM Employees RIGHT JOIN Orders ON Employees.Employee_ID = Orders.Employee_ID RIGHT JOIN trả t t dòng ... dòng bảng Orders, dòng không t nh k t trả về: Name Hansen, Ola Svendson, Stephen Svendson, Stephen Ví dụ: LEFT JOIN Cú pháp: SELECT c t_ 1, c t_ 2, c t_ 3 FROM bảng_1 LEFT JOIN bảng_2 ON bảng_1.khoá_chính...
- 3
- 13,035
- 29
Báo cáo khoa học: An engineered right-handed coiled coil domain imparts extreme thermostability to the KcsA channel docx
... extreme thermostability to the KcsA channel Table DNA sequence of the synthesized rhcc gene ACCGTTATCATCGACGACCGTTACGAATCTCTGAAAAACCTGATCACCCTGCGTGCGGACCGTCTGGAAATGATTATCAACGACAACGTTTCTACCATCCTGGCGTCAATT ... used as target candidates and our algorithm easily identified the RHCC as better candidates The robustness of our computational algorithm was later confirmed by the extreme thermostability of the selected ... form This is very similar to that of wtKcsA (Fig 4B) Taken together, these two results indicate that the gross biophysical nature of KcsA is not altered by the addition of RHCC Thermostability...
- 11
- 395
- 0
Báo cáo khoa học: "Left-to-Right Target Generation for Hierarchical Phrase-based Translation" doc
... experimented in Section 5, the use of the target-normalized form reduced the grammar size, but still outperformed a phrase-based system Furthermore, the target-normalized form coupled with our top ... contains at most two non-terminals The form can be regarded as a phrase translation pair with at most two holes instantiated with other phrases The hierarchically combined phrases provide a sort ... popped and the rule with the foreign word pan [1, 11] is looked up from the chart structure The stack structure for the newly created hypothesis is updated by pushing non-terminal spans [4, 11] and...
- 8
- 232
- 0
Báo cáo khoa học: "DETERMINISTIC LEFT TO RIGHT PARSING OF TREE ADJOINING LANGUAGES*" ppt
... pushdowns, the stacks are piled up from left to right II stands for the bottom of a stack, s~ is the top element of the top stack, Sx is the bottom element of the top stack, tl is the top element of the ... GOTOright and GOTOloot The program driving the LR parser first determines the state i currently on top of the top stack and the current input token at Then it consults the ACTION table entry for state ... bottom stack and tm is the bottom element of the bottom stack The initial configuration of the parser is set to: (110, al- an$) where is the start state and ax • a , $ is the input string to be...
- 8
- 218
- 0
From business strategy to IT action right decisions for a better bottom line
... growth obscures the fact that better management scrutiny of both projects and the lights-on budgets can make the result even better, and perhaps even move the scenario into the sweet spot of both ... not be articulated throughout the company The issue for management is to identify and understand that constraint, and allocate IT resources within that number to the best and highest-impact activities ... it can take to support those intentions We often see companies that a good job of connecting their IT planning to business strategy but then fail to implement the best projects The culture forces...
- 354
- 577
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25