αb crystallin is a novel gliomagenic oncogene and bcl2l12 effector
Báo cáo khoa học: Kinetic studies on endo-b-galactosidase by a novel colorimetric assay and synthesis of N -acetyllactosamine-repeating oligosaccharide b-glycosides using its transglycosylation activity pptx
... GlcNAcb13Galb1-4GlcNAcb-pNP was measured by HPLC as described in the Analytical methods Materials and methods Analytical methods Materials Endo-b-galactosidases from E freundii and B fragilis were from Seikagaku ... UDP-GlcNAc and UDP-Gal were kind gifts from Yamasa Corporation (Choshi, Japan) All other chemicals were obtained from commercial sources Enzyme assay b-D-Galactosidase, b-D-glucosidase and b-NAHase activities ... the same way, compound was obtained in a 71% total yield (13.2 mg) based on the acceptor from and UDP-Gal H and 13C-NMR data of and are summarized in Table Preparation of GlcNAcb1-3Galb1-4GlcNAcb-pNP...
- 11
- 365
- 0
báo cáo hóa học: " Methyl salicylate 2-O-b-D-lactoside, a novel salicylic acid analogue, acts as an antiinflammatory agent on microglia and astrocytes" docx
... Cornacchia C, Mollica A, Iannitelli DAE, Cataldi A, Zara S, Nasuti C, Di Stefano A: Ibuprofen and Glutathione Conjugate as a Potential Therapeutic Agent for Treating Alzheimer’s Disease Arch Pharm ... the data and wrote the manuscript; XL performed cell culture, western blot analysis, ELISA assay and NO measurements; RL and LS helped in performing NO measurements All authors read and approved ... Neuroinflammation, represented by activated microglia and astrocytes, is a prominent pathological feature that contributes to neurodegeneration in AD In AD brain, activated microglia release a variety...
- 7
- 409
- 0
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"
... Yamaguchi H, Sasaki K, Satomi Y, Shimbara T, Kageyama H, Mondal MS, Toshinai K, Date Y, Gonzalez LJ, Shioda S, Takao T, Nakazato M, Minamino N Peptidomic identification and biological validation of ... 29 Chakraborty TR, Tkalych O, Nanno D, Garcia AL, Devi LA, Salton SR Quantification of Vgf- and pro-SAAS-derived peptides in endocrine tissues and the brain, and their regulation by diet and cold ... Cruz Biotech, CA) The assay was developed using a stabilized HRP substrate All samples were analyzed in the linear range of the ELISA using over-expressed human Vgf as a standard Assessment of...
- 8
- 499
- 0
Tài liệu Báo cáo khoa học: KIPase activity is a novel caspase-like activity associated with cell proliferation doc
... for caspases and 7; Ac-YVAD-AMC is a substrate for caspase 1; Ac-IETD-AMC is a substrate for caspase and 10; Ac-LEHD-AMC is a substrate for caspases 2, 4, and Ac-DVPD-AMC, Ac-DPSD-AMC and Ac-ESQD-AMC ... (RFU) and the standard deviation are plotted on the y-axis and the migration of protein standards of known molecular mass are shown above the relevant fractions Fig Caspase and KIPase activity ... duplicate The preferred substrate (bar A) for each was as follows: caspase 1, WEHD-AMC; caspase 2, VDVADAMC; caspase 3, DEVD-AMC; caspase 4, WEHD-AMC; caspase 5, WEHD-AMC, caspase 6, VEID-AMC; caspase...
- 8
- 442
- 0
Báo cáo khoa học: Xenopus Rbm9 is a novel interactor of XGld2 in the cytoplasmic polyadenylation complex pptx
... compilation ª 2008 FEBS C Papin et al Zealand), followed by affinity purification The antibody against Xenopus CPEB is an affinity-purified rabbit polyclonal antiserum [20] The RPA and AuroraA antibodies ... New England Biolabs (Ipswich, MA, USA) (9106S) The b-tubulin and HA antibodies were obtained from E7 (Iowa Hybridoma Bank, Iowa City, IA, USA) and 12CA5 (Abcam, Cambridge, MA, USA) hybridomas, respectively ... critical reading of the manuscript, and J M Donnay and G Herrada for technical assistance This work was supported by the Centre National de la Recherche Scientifique and the Association pour la Recherche...
- 14
- 502
- 0
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx
... CTTTTTAGAACGACATGCAGCTGAAGCTTCGTA CGC-3¢ and disRAS1rev CAAAACCATGTCATAT CAAGAGAGCAGGATCATTTTCAACAAATTATGC ATAGGCCACTAGGGATCTG-3¢ YEp351-SUT2 was constructed to contain SUT2 as the only open reading frame present ... CGCTGGCTTCCAAACCCTTATCGATACCGTCGA CCC-3¢ and SUT-GFPrev 5¢-AACAATTTCACACACA GGAAACAGCTATGACCATGATTACGCTATAGG GCGAATTGGGTA-3¢, respectively YEp351-SUT2 was linearized with SphI and co-transformed ... The cassette was amplified from the plasmid pUG27 [13] using the primers disSUT2fwd 5¢-TGACGCTCACCAAGCTATTGGTTT GTTTGGATCAATCGTCAGATATGAAGGCATAG GCCACTAGTGGATCTG-3¢ and disSUT2rev 5¢-TAT TAATATTCCTATATTTTACATAGGAGGAAATTA...
- 8
- 485
- 0
Báo cáo khoa học: hhLIM is a novel F-actin binding protein involved in actin cytoskeleton remodeling ppt
... F-actin in a direct manner Formation of higher order actin structures, such as bundles and cables, is crucial to stabilize the organization of transvacuolar strands and maintain overall cellular ... complementary (5¢-CACCGCAGTGCCATGGAAGGAGTTTC CACACGAATGTGGAAACTCCTTCCATGGCACTG-3¢) according to the manufacture’s protocol (Invitrogen, Carlsbad, CA, USA) Transfections with various DNA constructs ... mutations into each LIM domain: LIM1(10Cys fi Ser, 13Cys fi Ser):5¢-GGA GGCGCAAAATCTGGAGCCTCTGAAAAGACCGTCTA C-3¢; LIM2(120Cys fi Ser, 123Cys fi Ser): 5¢-GAGAGTCC GAGAAGTCCCCTCGATCTGGCAAGTCAGTCTATG-3¢...
- 11
- 347
- 0
What is a Mouse-Trap Car and How does it Work? pdf
... car that travels faster, farther and wastes less energy The most common area where surface friction will occur is between the axle and the chassis The interface between the axle and the chassis ... of all right triangles Ancient mathematicians found that all right triangles are proportional by ratios of their sides and angles These ratios times the angle are known as sine, cosine, and tangent ... chassis is called the bearing A plain bearing can be as simple as an axle turning in a drilled hole A bushing is a smooth sleeve placed in a hole that gives the axle a smother rubbing surface, which...
- 15
- 699
- 3
Báo cáo khoa học: Alpha 1-antichymotrypsin/SerpinA3 is a novel target of orphan nuclear receptor Nur77 potx
... 5¢-GACTCGCAGACAATGATGG TC-3¢ and 5¢-GCAAACTCATCATGGGCACC-3¢ The results were normalized with b-actin, for which the primers were 5¢-ATGGTGGGAATGGGTCAGAAG-3¢ and 5¢-CA CGCAGCTCATTGTAGAAGG-3¢ Another ... pcDNA3.1-GST-Nur77 plasmid pSilencer-shNur77 was prepared by overlapping strategy with primers 5¢-gacGGATCCgcagtccagccatgctccttt caagagaaggagcatg-3¢ (with BamHI), 5¢-cggAAGCTTtATC GATccaaaaaacagtccagccatgctccttctcttg-3¢ ... CCTCCAAAAAGCACACAGA-3¢ for St-182 and St-93/ -182, 5¢-AGAAATTATCATCTTTTCCAGTCCGAGA-3¢ for St-93 and St-93/-182, and 5¢-TGGTCTTGAACTCCT CGTGATCTGCCCA-3¢ for Lst-595 pcDNA3.1-Nur77 expression plasmid...
- 14
- 397
- 0
Báo cáo khoa học: S -Stereoselective piperazine-2-tert-butylcarboxamide hydrolase from Pseudomonas azotoformans IAM 1603 is a novel L-amino acid amidase doc
... 5¢-CGATCCAAGCTTTAAGGAGG AAtagGAAATGGAATTCATCGAAAAAATCCG-3¢ antisense primer, 5¢-TGCATCCATCTAGAGCATTCA GC-3¢ The amplified PCR product was digested with HindIII and XbaI, separated by agarose gel ... ethylenediaminetetraacetic acid and o-phenanthroline and/ or activated by divalent cations (Table 4) Comparison of the characteristics of LaaA with those of the other L-amino acid amidases suggests that LaaA is ... sulfate fractionation and DEAE-Toyopearl and ButylToyopearl column chromatographies (Table 2) The final Fig SDS/PAGE of LaaA Lane 1, molecular mass standards [phosphorylase b (94 kDa), BSA (67 kDa),...
- 11
- 283
- 0
Báo cáo khoa học: The Cockayne syndrome group B protein is a functional dimer docx
... N-terminal S- and HIS- tags and C-terminal HIS- and HSV-tags The fragments were over expressed in E coli and purified using Ni-NTA agarose (Qiagen, Valencia, CA, USA) CSB ATPase activity The ATPase activity ... and buffer A and dissolved in · SDS loading buffer, boiled and analyzed by SDS ⁄ PAGE and western using HA and HSV antibody [Y11 (1 : 2000), Santa Cruz Biotechnology, and HSV-tag monoclonal antibody ... CSB at this position (Fig 3, compare fractions 25 and 27) This suggests that CSB is only active as an ATPase when it is a dimer Also, we did not detect a peak in DNA-dependent ATPase activity at...
- 9
- 273
- 0
Báo cáo Y học: Bass hepcidin is a novel antimicrobial peptide induced by bacterial challenge pptx
... Briefly, DNA was double-digested with DraI and HpaI, incubated with T4 ligase (Promega) to create intramolecular ligations, and amplified with a primer pair 158F and 86R Amplification and sequence ... 90) is probably the translational start site because it is followed by a typical signal peptide motif with a basic residue (lysine) and a hydrophobic region (rich in valine and alanine) and matches ... Kel, A. E., Kel, O.V., Ignatieva, E.V., Ananko, E .A. , Podkolodnaya, O .A. , Kolpakov, F .A. , Podkolodny, N.L & Kolchanov, N .A (1998) Databases on transcriptional regulation: TRANSFAC, TRRD, and COMPEL...
- 6
- 366
- 0
Báo cáo khoa học: The Promyelocytic Leukemia Zinc Finger (PLZF ) gene is a novel transcriptional target of the CCAAT-DisplacementProtein (CUX1) repressor ppt
... primer (5¢-aaatgtcttgaccagccgtc-3¢) and Chip2dw primer (5¢-gaaacaaaggcctctcccag-3¢); Chip3up primer (5¢-gctttgcagtcagaatggtc-3¢) and Chip3dw primer (5¢-ctgagcactgactacgaaac-3¢) The Chip1up and Chip1dw ... Seattle, WA, USA) that targeted a conserved sequence in rat, mouse and human CUX1 was kindly provided by Dr Julian Downward [50] Two bases (in capitals) were further mutated (5¢-aagaaga acaGAccagaggattt-3¢) ... MG_U74Av2 GeneChips (Affymetrix, Santa Clara, CA, USA), followed by microarray analysis as described elsewhere [51] Microarray Analysis Suite 5.0 (MAS, Affymetrix) was used to quantify microarray...
- 13
- 359
- 0
microsomal epoxide hydrolase gene is a novel endogenous protectant against beta amyloid (1-42)-induced cognitive impairments in mice
... the nucleus basalis reduced ChAT in the cortex (Nabeshima and Nitta, 1994; Yamaguchi and Kawashima, 2001; Harkany et al., 1999), and enhanced AChE activity (Shin et al., 2005) In this connection, ... maze was made of black painted wood; each arm was 40 cm long, 12 cm high, cm wide at the bottom and 10 cm wide at the top The arms converged at an equilateral triangular central area that was ... behavioral test The behavioral study began on day after A i.c.v infusion, and carried out sequentially All mice were sacrificed immediately after behavioral tests For histological analysis, animals...
- 54
- 168
- 0
Báo cáo hóa học: " A Novel Self-aligned and Maskless Process for Formation of Highly Uniform Arrays of Nanoholes and Nanopillars" pot
... 5a and b These metal nanoposts and nanoholes can be potentially applied into photonic crystals, and also for further processing using as metal masks Conclusions We have demonstrated a novel maskless ... produced a large area of highly uniform hexagonally packed gold nanoposts and nanoholes in gold thin film 123 using the uniform HCP nanoholes and nanopillars of photoresist for lift-off process, as ... nanospheres and applies them into the maturely developed photolithography system It is simple, fast, economical, and compatible with current photolithography sources and photoresists, and hence it can...
- 5
- 281
- 0
Báo cáo y học: "SHROOM3 is a novel candidate for heterotaxy identified by whole exome sequencing" pptx
... TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCGAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC t p.G60V ... Gorilla gorilla Pongo pygmaeus Macaca mulatta Callithrix jacchus TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC ... manuscript SL and TS evaluated and interpreted SNP microarray and aCGH data All authors read and approved the final manuscript for publication Acknowledgments We thank the heterotaxy patients and families...
- 36
- 446
- 0
Báo cáo y học: " MDM2 is a novel E3 ligase for HIV-1 Vif" pot
... research, and analyzed the data HH, KItoh, and JF designed the research, contributed vital new reagents, and analyzed the data TU analyzed the data, drafted the paper, and organized the research For ... research, performed research, contributed vital new reagents, analyzed data, and wrote the paper ATK designed research, analyzed data, wrote the paper, and organized the research KS, KIo, and ... resistance and immune escape More recently, Nathans et al have reported a small molecule that specifically antagonizes Vif function and inhibits viral replication by targeting the A3 G/Vif axis...
- 12
- 692
- 0
Báo cáo y học: " Identification of a novel resistance (E40F) and compensatory (K43E) substitution in HIV-1 reverse transcriptase" doc
... (5' GAA ATT TGT ACA TAG CTG GAA AAG G-3', nucleotides 2655–2679), 40F-RT2 5' GAA ATT TGT ACA TTG CTG GAA AAG G-3', nucleotides 2655–2679) and 40F-RT3new 5' GAA ATT TGT ACA TTT CTG GAA AAG GA-3', ... 2664–2688), 43E-RT (5' ACA GAG CTG GAA GAG GAA GGG AAA A- 3', nucleotides 2664–2688) and 43E- http://www.retrovirology.com/content/5/1/20 RTA (5' ACA TTT CTG GAA GAG GAA GGG AA-3', nucleotides 2664–2686) ... compensatory (K43E) amino acid change in HIV-1 RT Further studies are warranted to understand the mechanism of compensation For clinical management it is important to be aware of novel resistance patterns...
- 11
- 289
- 0
Endofin is a novel component in EGR EGFR oncogenic signaling
... calcium channels and the subsequent release of calcium (Ca2+) This release of Ca2+ allows EGFR to activate Ca2+-dependent pathways such as Ra (one) and NFκB pathways (Hofer et al., 1998; Sun and ... engagement of other signaling pathways such as JNK and MAPK pathways (Marais et al., 1998; McClellan et al., 1999) In addition to its function as a PKC activator, DAG is also suggested to be a ... multiple signaling pathways can be elicited from the activated EGFR The major signaling pathways activated by EGFR are the Ras/Raf/MEK/ERK, PI3K/PDK1/Akt, PLCγ/DAG/IP3 and JAK/STAT pathways All of...
- 135
- 225
- 0
Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"
... 1145-9 Tamura N, Ogawa Y, Chusho H, et al Cardiac fibrosis in mice lacking brain natriuretic peptide Proc Natl Acad Sci USA 2000; 97: 4239-44 Mukoyama M, Nakao K, Saito Y, et al Human brain natriuretic ... and EH Acknowledgments We would like to thank Dr Y Watanabe and Dr Y Izumi for collecting the samples, and Ms H Tobe, M Nakamura, and K Sugama for their technical assistance This work was supported ... 5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases -1323 to -1299) and antisense, 5’CCCCACCAAGCCAACACAGGATGGA -3’ (bases -919 to-895) were used to amplify a 429-bp product from genomic DNA (Fig 1A) The PCR products...
- 7
- 612
- 1
Tìm thêm: xác định các nguyên tắc biên soạn tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25