as a rule cattle have a heavy dose the welfare of cattle in beef production
báo cáo khoa học: " Whole-Organ analysis of calcium behaviour in the developing pistil of olive (Olea europaea L.) as a tool for the determination of key events in sexual plant " ppsx
... precipitates in the vacuoles of the stigma cells as well as in the intracellular spaces between them The stigmatic surface is the main place for signal exchange between pollen and stigma Ca2+ ions are ... present in the ovary, whereas the remaining ovules showed no labelling This localization pattern was observed in more than 80% of the ovaries at stage and in more than 95% of the ovaries at stage ... Ca2+ amounts were calculated according to the manufacturer’sprotocol and are given in μg per μl of the sample A standard curve was prepared using known amounts of the Ca 2+ standard included in...
- 12
- 529
- 0
báo cáo khoa học: " Worry as a window into the lives of people who use injection drugs: a factor analysis approach" pot
... for each variable and to determine if they are associated, we calculated their means and standard deviations These results are presented in Table with the individual variables placed according ... contributed the remaining 15% of variation Discussion This paper performed an exploratory factor analysis on data pertaining to a broad array of possible worries thought to characterize the daily life of ... worry about having a place to stay, being robbed (mean = 2.91), and contracting hepatitis C (mean = 2.89) Also shown in Table is a measure of inter-variable reliability known as Cronbach's alpha,...
- 6
- 333
- 0
A study on the images of objects in English idioms, proverbs and sayings
... to imply the meaning, that is to say, the cultural information that the literal meaning of this kind of idioms and image meaning express is the same, can translate each other For example: -Cùng ... unpacking according to the appropriate context may well bring such abstractions as wealth (rather than actual currency) and influence ( rather than actual speech ) to the listeners or readers mind ... theres a in When theres a will, theres a way) Those two kinds of recurrence are characteristic of nursery rhymes of the alliterative and rhyming babble of infants and of the repetitive syntax of...
- 52
- 846
- 11
A study on the use of portfolios in improving listening skill of second-year students at Hanoi University of Industry = Nghiên cứu về việc sử dụng hồ sơ bài tập
... half of the informants agree that improving autonomy in learning listening is another benefit of the application of portfolios The students state they are also able to apply portfolios in other ... language skills as writing, reading and speaking It is considered as a new teaching and learning method and 28.8% of them show the interest and curiosity in this new learning approach After the ... teaching and learning listening skill Qualitative method was used to analyze data obtained from the aforementioned data collection instruments This is a piece of action research and the findings...
- 65
- 1,118
- 4
A study on the translation of adverbs in harry potter and the philosophers stone from english into vietnamese
... However, translating from one language into another is no easy task Translation must take into account a number of constraints, including the context, the rules of grammar of the two languages, their ... another More specifically, translation is the replacement of textual material in one language (SL) by equivalent textual material in another language (TL) Benjamin in The Task of the Translator ... the point of view of above mentioned authors He defines that translation is rendering the meaning of a text into another language in the way that the author intended the text Briefly, the starting...
- 81
- 1,248
- 3
A STUDY ON THE USE OF SITCOMS IN TEACHING SPEAKING TO ENGLISH MAJOR STUDENTS AT VINH UNIVERSITY
... the data analysis in qualitative research involves the researcher in an inductive process of organizing data in categories and identifying patterns” The data in this study were analyzed as follows: ... Friends was a nominated in a lot of reputable awards It goes without saying that Friends is available on the internet and easy to download freely The scripts of the sitcoms are available on the internet ... Authenticity material in language teaching and motivation 2.1.1 Authenticity/ authentically material According to Freda Mishan “it is perhaps incumbents to deal at the outset with the issue of...
- 68
- 1,075
- 4
Báo cáo y học: "An Avian Connection as a Catalyst to the 1918-1919 Influenza Pandemic"
... infected animals A change in the NA amino sequence may allow a “back-door” to HA cleavage, leading to systemic infection This mutant NA will bind to plasminogen a normal precursor in the blood clotting ... pigs and humans Some of these human and avian influenza viruses might become adapted to pigs and circulate in that population The cocirculation of the viruses in swine, avian and human populations ... which in turn infects mammalian hosts These animals, usually pigs, act as a transformer or converters; creating a strain that can more readily infect humans Pigs can be infected with both avian and...
- 4
- 520
- 0
A STUDY ON THE USE OF CLASSROOM DISCIPLINE AS MOTIVATION FOR SECOND LANGUAGE ACQUISITION IN THE CONTEXT OF ENGLISH LANGUAGE TEAC
... is the learners and the teachers who play the primary role in managing a disciplined atmosphere in the classroom In the light of Communicative Language Teaching, where the roles of the learners ... and the same main point: the understanding of this relationship is exclusively vital for discipline to be satisfactorily maintained I.4 Factors affecting discipline and motivation in a language ... pedagogical theorists have their own sayings, which can be summarized in a nutshell that the factors affecting discipline and motivation in a language classroom include: the teacher’s roles, the...
- 41
- 886
- 12
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt
... AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGGGACACGATGC CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA ... BCRP CA9 BMP2 MT 2A CD237904 AL707095 AK095731 DKK1 BC037851 b-Actin GAAGAAGGGCCAGACGC CCTTCGCTGAGTTCCTGC ACATCAGCGGATACTACAGAG TTTGAATGGGCGAGTGATTG CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA ... ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT TCTCACTGGCCCTAAACTGG CTGATAGGGGTTGGGTGATG GCATTTCCATTTCCCTAAGCAC CAACACAATCCTGAGGCACA TCCCTTTGCCTCCTGTTGTT GTACTTGCGCTCAGGAGGAG 178 246...
- 13
- 563
- 0
Relational Cloud: A Database-as-a-Service for the Cloud potx
... the capacity of a single machine, and (2) to enable more granular placement and load balance on the back-end machines compared to placing entire databases 236 The current partitioning strategy ... Damiani, S D C di Vimercati, S Jajodia, S Paraboschi, and P Samarati Balancing Confidentiality and Efficiency in Untrusted Relational DBMS CCS, 2003 [7] S Das, D Agrawal, and A E Abbadi ElasTraS: ... Soror, U F Minhas, A Aboulnaga, K Salem, P Kokosielis, and S Kamath Automatic virtual machine configuration for database workloads ACM Trans Database Syst., 35(1), 2010 [17] G Soundararajan, D Lupei,...
- 6
- 568
- 0
Báo cáo Y học: The S100A8/A9 protein as a partner for the cytosolic factors of NADPH oxidase activation in neutrophils doc
... p47phox and Rac was maintained at a value of 4, i.e a nonsaturating concentration with respect to p47phox and Rac2 (cf Fig 3A) The concentration of flavocytochrome b was maintained at a fixed value, and ... SDS/PAGE Coomassie blue staining of the gel shows an enrichment of the DEAEI fraction in the two components of the S10 0A8 /A9 protein with molecular masses of kDa and 23 kDa and the disappearance of ... Rac2, MgSO4 and an optimal amount of arachidonic acid determined for each assay of oxidase activation [12] The rate of O2– production by the activated NADPH oxidase was calculated from the rate...
- 10
- 396
- 0
A Study on the Effects of Argentine Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly pptx
... into the floor,’’ ‘‘reach their ears toward the ceiling,’’ ‘‘their spine is a ‘‘pearl necklace’’ and thus ‘‘imagine your tail bone is like a heavy amulet at the end of the pearl necklace and falling ... Argentine tango lessons compared to walking on clinical measures of balance and gait in the frail elderly They noted greater improvements in balance and complex gait tasks in the tango group as ... on all measures of balance, falls and gait Moreover, upon terminating the program the Parkinson Tango group was more confident about balance than the Parkinson Exercise group In psychosocial terms,...
- 19
- 648
- 0
Báo cáo khoa học: A novel plant protein disulfide isomerase family homologous to animal P5 – molecular cloning and characterization as a functional protein for folding of soybean seed-storage proteins docx
... ACACacG ACACttG ACACaaG + + + + ) ) ) ) ) )140 )1100 )1596 )1632 )140 )1100 )1596 )1632 )1874 CAaaTG CAagTG CAaaTG CAaaTG CAaaTG CActTG CAttTG CAgtTG TGAGTCA + )23 TGCAAAG + )270 CATGCA + )1509 AACCCA ... putative signal peptide was constructed as follows The DNA fragment was amplified from GmPDIM cDNA by PCR using the primers 5¢-GACGACGACAAGATGC ACGCACTCTATGGAGC-3¢ and 5¢-GAGGAGAAGC CCGGTTCATAGCTCATCCTTGCTTGAAG-3¢ ... Quantification of mRNA was performed by real-time RT-PCR with a Thermal Cycler DiceÔ Real Time System (TaKaRa Bio Inc.) The forward primer 5¢-CGGAACCAAAACATGC TAACATTTTC[FAM]G-3¢ (Invitrogen, Carlsbad, CA,...
- 12
- 348
- 0
A study on the use of neuber's rule in fatigue crack
... overcome the damage accumulation problem have resulted in nonlinear damage theories, use of prestrained and periodicaily overloaded material data, and the use of rnodified baseline damage parameters ... The objective of this thesis is to anaiyze the applicability of Neuber's rule in the local strain approach The layout of the thesis is as follows Chapter contains a review of research regarding ... Post Graduate Scholarship, The Canadian Space Agency for the award of a supplement to the NSERC scholarship, Carleton University for the award of a teaching and research assistantship, and to the...
- 164
- 592
- 0
Báo cáo hóa học: " Could sound be used as a strategy for reducing symptoms of perceived motion sickness?" docx
... also participated in the analysis of the results and preparation of the manuscript AS participated in the experimental trials, were responsible for the statistical analysis and participated in ... the drafting of the manuscript TL participated in the drafting of the study and the final preparations before submission TF Participated in the design and preparations of the study TF also participated ... participated in the analysis and drafting of the manuscript All authors have read and approved the manuscript Acknowledgements The authors would like to thank Professor Björn Gerdle, Linköping University,...
- 9
- 609
- 0
báo cáo hóa học:" Enhancing the efficacy of cisplatin in ovarian cancer treatment – could arsenic have a role" potx
... Chemotherapy The most active chemotherapy agents in ovarian cancer are the platinum analogues, cisplatin and carboplatin The antitumor activity of cisplatin (cis-diamminedichloroplatinum (II)) was ... cisplatin Survival was better with platinum alone and with platinum-containing combinations [25] An additional class of drug, the taxanes, was discovered and came to play a role in the front-line ... and following initial front-line CRS, intravenous administration of cisplatin or carboplatin together with a taxane, either paclitaxel or docetaxel, has become the standard therapy for patients...
- 7
- 504
- 0
Báo cáo khoa học: "NaCl plus chitosan as a dietary salt to prevent the development of hypertension in spontaneously hypertensive rats" ppt
... method Angiotensin I and II were measured with a rat angiotensin I and II EIA kits (Phoenix Pharmaceuticals, USA) according to the manufacturer’s instructions Urine was assayed for creatinine by a ... once per week at the same time during the day After the stabilization of the animals in o a warm box at 37 C for 15 min, the tail systolic blood pressure was measured with a non-invasive blood ... may be explained by the decrease of blood pressure due to the increase of angiotensin I or the decrease of angiotensin II production [7,9,16,24] Since urea is a final product in protein metabolism...
- 6
- 406
- 1
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008