find all real valued functions f x on the rationals such that 1 f x y y f x x f y f x f y x y xy for all x y 2 f x 2 f x 1 2 x for all x and 3 f 1 1 gt 0
Đề tài " On the nonnegativity of L(1/2, π) for SO2n+1 " potx
... York, 19 87 T Saito, The sign of the functional equation of the L-function of an orthogonal motive, Invent Math 12 0 (19 95), 11 9 14 2 F Shahidi, On certain L -functions, Amer J Math 10 3 (19 81) , 29 7 35 5 ... Math 35 (19 76), 29 9– 31 6 e ¨ [FQ 73] A Frohlich and J Queyrut, On the functional equation of the Artin L-function for characters of real representations, Invent Math 20 (19 73) , 12 5 13 8 [GJ 72] R Godement ... (necessarily simple) at s = Thus, π is of Spn type if and only if π is symplectic and L( , π) = 0; 2 π is of SO(2n + 1) type if and only if π is orthogonal; π is of SO(2n) type if and only if π is symplectic...
- 28
- 472
- 0
Báo cáo khoa học: The effects of a-secretase ADAM10 on the proteolysis of neuregulin-1 pot
... program 10 40 (to F. F.) FEBS Journal 27 6 ( 20 09 ) 15 68 15 80 ª 20 09 The Authors Journal compilation ª 20 09 FEBS 15 77 ADAM 10 and neuregulin -1 processing C Freese et al and from the NGFN integrated consortium ... incubation of cells for h, a band of approximately 60 kDa (N-terminal FEBS Journal 27 6 ( 20 09 ) 15 68 15 80 ª 20 09 The Authors Journal compilation ª 20 09 FEBS 15 69 ADAM 10 and neuregulin -1 processing C Freese ... Neuroimmunol 10 0, 23 3 24 2 FEBS Journal 27 6 ( 20 09 ) 15 68 15 80 ª 20 09 The Authors Journal compilation ª 20 09 FEBS C Freese et al 27 Viehover A, Miller RH, Park SK, Fischbach G & Vartanian T ( 20 01 ) Neuregulin:...
- 13
- 487
- 0
Báo cáo hóa học: "ON THE DIFFERENCE EQUATION xn+1 = axn − bxn /(cxn − dxn−1 )" pptx
... equivalently, x is a fixed point of f Definition 1. 1 (stability) (i) The equilibrium point x of (1. 2) is locally stable if for every > 0, there exists δ > such that for all x k , x k +1 , , x 1 , x0 ∈ ... of (1. 1): xn +1 = xn − xn , x n − x n 1 (5 .1) where the initial conditions x 1 , x0 are arbitrary real numbers with x 1 , x0 ∈ R/ {0} , and x 1 = x On the difference equation xn +1 = axn − bxn ... > such that for all x k , x k +1 , , x 1 , x0 ∈ I, with x k − x + x k +1 − x + · · · + x0 − x < γ, (1. 5) lim xn = x n→∞ (iii) The equilibrium point x of (1. 2) is global attractor if for all x k...
- 10
- 295
- 0
Playing, Laughing and Learning with Children on the Autism Spectrum - part 1 potx
... in 20 02 by Jessica Kingsley Publishers Ltd 11 6 Pentonville Road London N1 9JB, England and 29 West 35 th Street, 10 th fl New York, NY 10 0 01 - 22 99, USA www.jkp.com Copyright © Julia Moor 20 02 Second ... RJ 506 .A9 M66 20 02 616 8. 92 89 8 20 6 515 3 dc 21 20 02 0 21 5 21 British Library Cataloguing in Publication Data A CIP catalogue record for this book is available from the British Library ISBN 84 31 0 06 0 Printed ... touch of a feather very uncomfortable; others (like my son) find it fun to be tickled by it, and to use it to tickle me! Try the really big, brightly coloured plumes you find in sewing and craft...
- 25
- 285
- 1
CẤU TẠO, QUY TRÌNH LẮP ĐẶT THIẾT BỊ MIỆNG GIẾNG 20”x 13.3/8” x 9.5/8” x 4.1/2” _Plv 5000 PSI CỦA VECTO
... e = 0, 1mm 34 0mm 24 5mm 11 4mm; chiều d y tương ứng loại ống : 20 mm; 18 mm; 16 mm; 10 ,2mm Cấu trúc cột ống thả độ sâu là: 20 ” → 4 50 m; 13 -3/ 8” → 13 00 m ; 9-5/8” → 32 0 0 m; 4 -1/ 2 → 35 00 m 4 .1 Kiểm toán ... dạng “CWCT-BT2” áp suất làm việc P lv 500 0PSI có chiều cao 35 -1/ 18”, đường kính đ y 28 -3 / 12 ” đầu có đường kính 10 - 13 /16 ” ; có hai cửa 2 -1/ 16” - Van cửa model “VG - 20 0 Vecto, cỡ 2 -1/ 16” nối mặt ... chống 13 -3/ 8” 6- Đầu bao ống chống 20 ” 7- Đế sàn 8- Ống chống 20 ” 9- Ống chống 13 -3/ 8” 10 - Ống chống 9-5/8” 11 - Nút 12 - Gioăng làm kín 13 - Đệm làm kín 13 7 Grayloc 14 - Bulông siết SV: Đỗ Văn Huy 43...
- 69
- 1,535
- 7
Báo cáo hóa học: " Research Article Integral-Type Operators from F p, q, s Spaces to Zygmund-Type Spaces on the Unit Ball Congli Yang1, 2" ppt
... |z |2 − n q /p − |z |2 μ |z| R2 g z 1 n q /p 3. 35 Note that 3 .18 and 3 .19 imply that lim μ |z| R2 g z |z| → 3. 36 Further, they also imply that 3 .1 and 3 .2 hold From this and Theorem 3 .1, it follows ... R2 g z 3 . 12 z∈B − |w |2 ≥ μ |w| R2 g w 1 n q /p − μ |w| Rg w |w |2 − |w |2 n q /p From 3 .1 and 3 . 12 , we see that 3 .2 holds ii If n q p, then, by Lemmas 2 .1 and 2. 2, we have F p, q, s ⊆ B1 , for ... implies that 3. 21 holds C ⇒ B Suppose that 3 .18 and 3 .19 hold for f ∈ F p, q, s By Lemmas 2 .1 and 2. 2, we have that μ |z| R2 Tg f z μ |z| Rf z Rg z ≤C f μ |z| Rg z F p,q,s C f f z R2 g z F p,q,s...
- 14
- 272
- 0
nghiên cứu tổng hợp bột màu vàng thân thiện với môi trường bi1-x-ycaxznyvo4-(x+y)2 trên nền bivo4
... 0 ,15 3 ,26 0 , 10 3, 68 0, 05 4 ,09 0, 00 4 , 23 0, 51 4 ,37 1, 08 4, 53 1, 71 4, 70 2, 42 4,89 3 ,22 NH4VO3 19 ,44 20 ,06 20 ,08 20 , 10 20 , 12 20 ,15 20 ,17 20 , 32 20, 21 20 , 23 20 ,25 20 ,27 20 ,96 21 , 69 22 ,47 23 , 31 24 ,22 ... 90, 00 90 ,38 M 13 3 ,08 8 5 ,19 56 5 ,0 935 11 , 704 4 90, 00 90, 00 90 ,38 M14 3, 08 9 5 ,19 56 5 ,0 935 11 , 704 4 90, 00 90, 00 90 ,38 M15 3, 08 9 5 ,19 56 5 ,0 935 11 , 704 4 90, 00 90, 00 90 ,38 M16 3, 08 8 5 ,19 56 5 ,0 935 11 , 704 4 ... 0, 05 Bi0,9Ca0 ,05 Zn0 ,05 VO3,95 M8 0, 06 0, 04 Bi0,9Ca0 ,06 Zn0 ,04 VO3,95 M9 0, 07 0, 03 Bi0,9Ca0 ,07 Zn0 ,03 VO3,95 M 10 0 ,08 0, 02 Bi0,9Ca0 ,08 Zn0 ,02 VO3,95 M 11 0, 09 0, 01 Bi0,9Ca0 ,09 Zn0 ,01 VO3,95 M 12 0 ,1 Bi0,9Ca0,1VO3,95...
- 47
- 606
- 2
Tài liệu Báo cáo Y học: Studies on the nonmevalonate pathway of terpene biosynthesis The role of 2C-methyl-D -erythritol 2,4-cyclodiphosphate in plants docx
... INADEQUATEb 1, 10 2, 20 3, 30 4, 40 5, 50 d 6, 60 7, 70 8, 80 9, 90 d 10 , 10 0 11 , 11 0 12 , 12 0 13 , 13 0 14 , 14 0 15 , 15 0 16 , 16 0 17 , 17 0 18 , 18 0 19 , 19 0 20 , 20 0 13 1 . 23 12 3. 97 26 .77 39 . 72 13 4. 93 12 4 .22 26 .74 ... 26 .74 39 . 72 13 5 .33 12 4. 41 26 .68 40. 49 13 9. 51 1 20 .22 12 3. 35 25 .69 17 .68 16 .00 16 .04 16 . 52 42. 3 17 , 17 0 42. 5, 3. 5 42. 5 18 , 18 0 42. 5, 3. 5 42. 2 19 , 19 0 40. 7 42. 0 20 , 20 0 13 43. 3 42. 2 42. 2 42. 2 42. 0 a ... from [2 -14 C]2C-methyl- D -erythritol 13 13 1, 10 2, 20 3, 30 c 4, 40 5, 50 d 6, 60 7, 70 c 8, 80 9, 90 d 10 , 10 0 11 , 11 0 12 , 12 0 13 , 13 0 14 , 14 0 15 , 15 0 16 , 16 0 17 , 17 0 18 , 18 0 19 , 19 0 20 , 20 0...
- 9
- 572
- 0
Đề cương ôn tập kí sinh trùng thú y 2
... -Tb noãn - to x p kín trứng -tập trung x p lộn x n hoàn - Kích - 0 .11 1 -0 .15 mm -0 . 12 -0 .19 mm 0. 060thước 0. 063mm – 0. 07 0. 09mm - Với gia súc chết, mổ khám tìm sán trưởng thành sán non dựa vào bệnh ... lông xung quanh vùng bị bệnh bôi thuốc sau : Trypanxin % đểbôi 2- 3 lần /ng y ;bôi liên tục 3- 5 ng y ; Ditrifon 1- 2 % Hantox-spay sát vào nơi có mò Tiêm XQ nơi có mò : Trypanxin 1% liều 0, 5 ml/ ... P – dê cừu Fascinex: 10 - 12 mg/kg P Thạch Văn Mạnh TYD-K55 Vime-facsi (Rafosanide): 1ml / 30 -35 kg P – T, B, 1ml /15 - 20 kg P – D, C, thỏ (tiêm da, vùng cố, liều nhất, không tiêm 10 ml cho chỗ tiêm) -...
- 29
- 3,967
- 5
báo cáo hóa học: " In vitro and in vivo pre-clinical analysis of a F(ab’)2 fragment of panitumumab for molecular imaging and therapy of HER1-positive cancers" pot
... 2. 23 ± 0 .39 1. 79 ± 0. 31 1 .06 ± 0. 21 0. 8 ± 0 .26 Heart 3. 57 ± 1. 11 2. 06 ± 0 . 23 1. 86 ± 0 . 30 1. 20 ± 0. 21 0. 78 ± 0 . 12 Femur 2. 41 ± 0. 48 1. 78 ± 0. 41 1.67 ± 0 .24 1. 01 ± 0 .24 0. 75 ± 0 .22 Athymic mice bearing ... Research 2 01 1 , 1: 1 http://www.ejnmmires.com/content /1/ 1 /1 Page of 15 11 0 10 0 Percent Inhibition 90 80 70 60 50 40 30 20 10 - 10 0. 0 01 0. 01 0 .1 10 10 0 10 00 nM Competitor Figure Evaluation of panitumumab ... 0. 62 8. 01 ± 3. 65 3. 38 ± 0. 67 Spleen 5. 43 ± 1. 64 3. 61 ± 0. 87 3. 96 ± 1. 19 2. 63 ± 1. 12 2 .09 ± 0. 80 Kidneys 13 . 13 ± 2. 34 8 .27 ± 0. 84 6 .00 ± 1. 57 5 .22 ± 0. 94 2. 66 ± 0. 46 Lung 4. 40 ± 1. 14 2. 23 ± 0 .39 ...
- 15
- 452
- 0
Hướng dẫn Cài đặt OpenOffice.org 2.x part 3 pptx
... Environtment từ www.java.com Cài gói giao diện ngôn ngữ tiếng Việt, cần 10 Đăng xuất khỏi quản trị viên lệnh 'exit' 11 Thử ch y OpenOffice.org với lệnh: /opt/openoffice.org2 .0/ program/soffice ... nghiệm, tải gói deb từ ftp://ftp.linux.cz/pub/localization/OpenOffice.org/devel/6 80 Hướng dẫn cài đặt OpenOffice.org 2 .x Cài đặt Solaris Cài đặt Solaris Cài đặt Tải gói Ooo _2. 0. xxx_SOLARIS_install.tar.gz ... emerge search openoffice Tại thời điểm viết tài liệu có sẵn hai gói OpenOffice.org 2 .x cho hệ thống x8 6: appoffice/openoffice, gói nguồn để biên dịch hệ thống bạn; appoffice/openoffice-bin, gói ứng...
- 5
- 389
- 0
Báo cáo y học: "α α Upregulated hypoxia inducible factor-1α and -2α pathway in rheumatoid arthritis and osteoarthritis" pps
... 0. 00 0 .00 60. 00 50. 00 50. 00 60. 00 75th percentile 10 .00 0. 00 90. 00 90. 00 75 .00 80. 00 Maximum 20 .00 10 .00 80. 00 80. 00 Mean 5.45 1. 81 63. 53 55 .29 50. 91 50. 91 Standard deviation 9 .11 3. 94 29 . 12 32 . 50 ... synovium Normal (n = 22 ) OA (n = 34 ) RA (n = 22 ) HIF -1 HIF -2 HIF -1 HIF -2 HIF -1 HIF -2 Minimum 0. 00 0 .00 20 .00 0. 00 10 .00 10 .00 25 th percentile 0. 00 0 .00 40. 00 30 .00 35 .00 25 .00 Median 0. 00 ...
- 9
- 391
- 0
Báo cáo y học: "The proinflammatory cytokines IL-1β and TNF-α induce the expression of Synoviolin, an E3 ubiquitin ligase, in mouse synovial fibroblasts via the Erk1/2-ETS1 pathway" ppt
... under the following conditions: 95°C for 15 minutes (94°C for 30 seconds, 55°C for 30 seconds, and 72 C for 30 seconds) for 40 cycles and 72 C for minutes Samples were run in triplicate, and relative ... rheumaPage of 10 (page number not for citation purposes) Arthritis Research & Therapy 24 25 26 27 28 29 30 31 32 33 34 35 36 37 Vol No Gao et al toid arthritis: up-regulation by interleukin-1beta and ... proinflammatory cytokines by synovial macrophages and fibroblasts is one reason for synovial cell hyperproliferation We therefore hypothesized that some of these cytokines may also be responsible for the...
- 10
- 405
- 0
Báo cáo y học: "Action of fibroblast growth factor-2 on the intervertebral disc" docx
... for grading the 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 gross morphology of the human intervertebral disc Spine 19 90, 15 : 411 - 415 Patel KP, Sandy JD, Akeda K, Miyamoto K, Chujo ... Binding of FGF2 to FGFR1 increases proliferation of chondrocytes, whereas binding of FGF2 to FGFR3 inhibits proliferation and therefore promotes differentiation [54-56] The upregulation of FGFR1 with ... therapies Expert Rev Mol Med 20 01 , 20 01 : 1 - 10 Iannone F, Lapadula G: The pathophysiology of osteoarthritis Aging Clin Exp Res 20 03 , 15 :36 4 -3 72 Le Maitre CL, Freemont AJ, Hoyland JA: Localization of degradative...
- 12
- 584
- 0
Báo cáo y học: " HIV-1 neutralization by monoclonal antibody against conserved region 2 and patterns of epitope exposure on the surface of native viruses" pot
... DQ 411 8 53 P195 50 AY669 7 30 AB 03 7 858 P05877 ABY26 917 AY669 700 AAT675 32 21 9 22 0 2 21 22 2 22 3 22 4 22 5 22 6 22 7 22 8 22 9 23 0 2 31 23 2 23 3 23 4 23 5 23 6 23 7 23 8 23 9 24 0 D C2E 21 8 E P I P I H Y C T P A G Y A I L K ... 50 6 .25 13 .75 9.89 6 .25 20 .6 5.4 IIIB B > 50 8 .06 > 25 4 .2 2 .08 27 .69 22 .8 92BR 02 5 C 10 . 01 15 10 38 .16 5 .08 29 .44 DU174 C 19 .87 1. 5 1. 25 10 33 . 13 24 .19 32 . 74 92UG 02 4 D 29 .78 21 . 25 20 6 .25 31 . 54 ... 5. 41 29 .27 NPO3 AE 12 .8 > 25 6.47 3. 79 32 . 47 13 .2 29. 73 CM244 AE 17 .5 21 . 5 7.5 10 35 .55 15 .17 28 . 71 NP1 525 AE 12 .7 > 25 15 1. 87 30 .1 2. 51 18.68 MENO2 32 AE 28 .35 > 25 15 10 29 .5 4.84 4.66 MENO 432 ...
- 8
- 445
- 0
Báo cáo y học: " Therapeutic efficacy of alpha-1 antitrypsin augmentation therapy on the loss of lung tissue: an integrated analysis of 2 randomised clinical trials using computed " potx
... 16 / 23 38 /22 29 / 30 0. 0 93 Smoking status (n, ex/never) Body mass index (kg•m2) 27 /0 23 .3 ± 3 .15 27 /0 24 .4 ± 2. 70 34 /4 24 .3 ± 3. 3 35 /4 24 .3 ± 3. 5 56/4 24 .0 ± 3. 3 56 /3 24 .5 ± 3 .2 0. 748 0 .35 5 FEV1 (L), ... 1. 63 ± 0. 49 1. 63 1. 72 ± 0. 53 1. 61 1.44 ± 0. 60 1. 14 1. 35 ± 0. 62 1. 14 1. 55 ± 0. 56 1. 47 1. 48 ± 0. 63 1. 38 0. 5 53 FEV1% predicted, median 47 .3 ± 11 .4 48.6 51. 2 ± 14 .5 49 .0 46 .3 ± 19 .6 41. 1 46.6 ± 21 . 0 ... 60) Placebo (n = 59) p value 11 4 ± 14 .7 59.7 ± 16 .0 57 .0 11 7 ± 16 .4 60 .1 ± 16 .3 65 .0 94 ± 21 . 8 50. 7 ± 19 .5 47.6 98 ± 23 .2 52. 2 ± 15 .2 50 .1 1 03 .1 ± 21 . 8 56 .3 ± 17 .3 56 .1 104 .7 ± 23 .9 55.7 ± 15 .9...
- 8
- 257
- 0
Báo cáo y học: " Caveolin-1 and -2 in airway epithelium: expression and in situ association as detected by FRET-CLSM" pps
... Position of amplified DNA (bp) cav -1 Z46 614 .1 1 23 25 14 7 cav -1 Z46 614 .1 1 21 165 28 5 cav -2 BC0 6 20 59 .1 106 3 92 497 cav -2 BC0 6 20 59 .1 127 17 6 3 02 β-MG NM_ 0 12 5 12 Forward: CAGCATGTCTGGGGGTAAAT Reverse: ... Chem 20 01 , 27 6 :3 8 12 1 -3 8 13 8 22 23 24 25 26 27 28 29 30 31 32 33 34 Drenckhahn D, Hofmann HD, Mannherz HG: Evidence for the association of villin with core filaments and rootlets of intestinal epithelial ... and distal airway epithelium Exp Physiol 20 05 , 90: 535 -544 Salathe M: Effects of beta-agonists on airway epithelial cells J Allergy Clin Immunol 20 02 , 11 0: S275- 81 Fujimoto T: Calcium pump of the...
- 13
- 293
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25