Nghiên cứu tạo aptamer đặc hiệu vi khuẩn escherichia coli o157 h7

ĐẠI HỌC QUỐC GIA HÀ NỘI TRƢỜNG ĐẠI HỌC KHOA HỌC TỰ NHIÊN - NGUYỄN THANH THỦY NGHIÊN CỨU TẠO APTAMER ĐẶC HIỆU VI KHUẨN Escherichia coli O157:H7 LUẬN VĂN THẠC SĨ KHOA HỌC Hà Nội – 2013 i ĐẠI HỌC QUỐC GIA HÀ NỘI TRƢỜNG ĐẠI HỌC KHOA HỌC TỰ NHIÊN - NGUYỄN THANH THỦY NGHIÊN CỨU TẠO APTAMER ĐẶC HIỆU VI KHUẨN Escherichia coli O157:H7 Chuyên ngành: Vi sinh vật học Mã số: 60420107 LUẬN VĂN THẠC SĨ KHOA HỌC NGƢỜI HƢỚNG DẪN KHOA HỌC: TS LÃ THỊ HUYỀN GS.TS PHẠM VĂN TY Hà Nội – 2013 ii LỜI CẢM ƠN Trong suốt trình thực đề tài, nhận đƣợc hƣớng dẫn, giúp đỡ tận tình Phịng Cơng nghệ Tế bào động vật - Viện Công nghệ Sinh học - Viện Hàn lâm Khoa học Công nghệ Việt Nam Bộ môn Vi sinh vật học - Khoa Sinh học, Trƣờng Đại học Khoa học Tự nhiên Trƣớc hết, xin gửi lời cảm ơn chân thành sâu sắc đến PGS TS Phạm Văn Ty, TS Lã Thị Huyền tận tình hƣớng dẫn, bảo giúp đỡ tơi suốt q trình học tập nghiên cứu vừa qua Tơi xin bày tỏ lịng biết ơn sâu sắc tới PGS TS Lê Quang Huấn, Trƣởng phòng Phòng Công nghệ Tế bào động vật – Viện Công nghệ Sinh học – Viện Hàn lâm Khoa học Công nghệ Việt Nam tận tình hƣớng dẫn tạo điều kiện suốt trình nghiên cứu đề tài Tôi xin gửi lời cảm ơn tới ThS Nguyễn Thị Thu Thủy ThS Lê Thị Kim Xuân cán phịng Cơng nghệ Tế bào động vật giúp đỡ nhiệt tình tạo điều kiện tốt q trình tơi học tập Tôi xin gửi lời cảm ơn tới thầy, cô giảng dạy Khoa Sinh học - Trƣờng Đại học Khoa học Tự nhiên dạy bảo suốt q trình học tập, trang bị cho tơi tảng kiến thức khoa học, phƣơng pháp học tập nghiên cứu Cuối cùng, tơi xin cảm ơn gia đình, ngƣời thân bạn bè động viên giúp đỡ tơi suốt q trình học tập hồn thành đề tài Hà Nội, ngày tháng năm Học viên Nguyễn Thanh Thuỷ iii MỤC LỤC DANH MỤC CÁC KÝ HIỆU VÀ CÁC CHỮ VIẾT TẮT ivi DANH MỤC CÁC HÌNH viiii DANH MỤC CÁC BẢNG viii MỞ ĐẦU CHƢƠNG TỔNG QUAN TÀI LIỆU 1.1 Escherichia coli O157:H7 1.1.1 Giới thiệu chung E coli O157:H7 1.1.2 Đặc tính E coli O157:H7 1.1.3 Nguyên nhân chế gây bệnh E coli O157:H7 1.1.4 Bệnh E coli O157:H7 gây 10 1.1.5 Tình hình nghiên cứu E coli O157:H7 nƣớc 13 1.2 Aptamer .14 1.2.1 Giới thiệu chung aptamer 14 1.2.2 Ƣu điểm aptamer so với kháng thể .16 1.2.3 Phƣơng pháp làm giàu phát triển hệ thống phối tử cấp số mũ (SELEX) sàng lọc aptamer 17 1.2.4 Tình hình nghiên cứu ứng dụng aptamer 20 1.2.5 Hạt nano vàng .22 1.2.6 Chụp ảnh kính hiển vi điện tử truyền qua (TEM) 24 CHƢƠNG 2: VẬT LIỆU VÀ PHƢƠNG PHÁP NGHIÊN CỨU 26 2.1 Vật liệu 26 2.1.1 Chủng vi vật plasmid 26 2.1.2 Hoá chất 26 2.1.3 Thiết bị, máy móc .26 2.1.4 Môi trƣờng dung dịch 27 2.2 Phƣơng pháp nghiên cứu .27 2.2.1 Phƣơng pháp nuôi cấy vi khuẩn 27 2.2.2 Phƣơng pháp SELEX sàng lọc aptamer đặc hiệu E coli 0157:H7 28 iv 2.2.3 Phƣơng pháp PCR .31 2.2.4 Phƣơng pháp tinh sản phẩm PCR 35 2.2.5 Phƣơng pháp điện di gel agarose 35 2.2.6 Phƣơng pháp gắn gen vào vector tách dòng 37 2.2.7 Phƣơng pháp biến nạp plasmid vào tế bào E coli 38 2.2.8 Phƣơng pháp tách DNA plasmid từ vi khuẩn E coli 40 2.2.9 Phƣơng pháp giải trình tự acid nucleic tự động 42 2.2.10 Phƣơng pháp tạo phức hệ aptamer – hạt nano vàng 44 2.2.11 Phƣơng pháp lai Dot blot 44 CHƢƠNG 3: KẾT QUẢ THỰC NGHIỆM .46 3.1 Kết sàng lọc aptamer đặc hiệu vi khuẩn E coli O157:H7 46 3.1.1.Chuẩn bị thƣ viện 36 3.1.2 Kết sàng lọc aptamer liên kết E coli O157:H7 50 3.2 Kết tách dòng aptamer liên kết đặc hiệu E coli O157:H7 52 3.2.1 Nhân trình tự aptamer ssDNA liên kết vi khuẩn E coli O157:H7 …….53 3.2.2 Phản ứng gắn sản phẩm PCR vào vector pCR 2.1 – TOPO 54 3.2.3 Kết biến nạp vector tái tổ hợp vào tế bào E coli DH5α .56 3.2.4 Tách DNA plasmid từ vi khuẩn E coli .57 3.3 Kết tách dòng aptamer liên kết đặc hiệu E coli O157:H7 58 3.3.1 Kết tách dòng aptamer liên kết đặc hiệu E coli O157:H7 58 3.3.2 Kết xác định liên kết phức hợp aptamer - hạt nano vàng với E coli O157:H7 .60 3.4 Xác định trình tự aptamer nhận biết đặc hiệu E coli O157:H7 61 3.4.1 Tách DNA plasmid từ vi khuẩn E coli .61 3.4.2 Kết xác định trình tự aptamer nhận biết đặc hiệu E coli O157:H7 62 KẾT LUẬN VÀ KIẾN NGHỊ .78 TÀI LIỆU THAM KHẢO 79 v DANH MỤC CÁC KÝ HIỆU VÀ CÁC CHỮ VIẾT TẮT Base pair Cặp base Centers for Disease Control and Trung tâm Kiểm sốt phịng Prevention ngừa bệnh dịch Hoa Kỳ DNA Deoxyribonucleic acid Axit deoxyribonucleic DNase Deoxyribonuclease Enzyme DNase EDTA Ethyenediaminetetraacetic acid Axit ethyenediaminetetraacetic E coli Escherichia coli Vi khuẩn Escherichia coli Bp CDC E coli O157:H7 Escherichia coli O157:H7 Vi khuẩn Escherichia coli O157:H7 H Hour Giờ HUS Hemolytic uremic syndrome Hội chứng huyết niệu HC Hemorrhagic colitis Viêm kết tràng xuất huyết Kb Kilo base Kb LB Luria Bertani Môi trƣờng LB PCR Polymerase chain Reaction Phản ứng chuỗi trùng hợp Reverse transcriptase Polymerase Phản ứng chuỗi trùng hợp thời chain reaction gian thực RNase Ribonuclease Enzyme Rnase RNA Ribonucleic acid Axit ribonucleic TEM Transmission electron microscopy Kính hiển vi điện tử truyền qua STEC Shiga toxigenic E coli Escherichia coli sinh độc tố Shiga ssDNA Single strand DNA Sợi đơn DNA dsDNA Double strand DNA Sợi đôi DNA SDS Sodium dodecyl sulphate Natri dodexyl sulphat TAE Tris – acetate – EDTA Tris – acetate – EDTA Polymerase Thermus aquaticus Enzyme polymerase chịu nhiệt RT – PCR Taq polymerase vi X – gal v/ph – Bromo – Clorua – indodyl – – Bromo – Clorua – indodyl – β – D – galactoside β – D – galactoside Round/minute Vòng/phút vii DANH MỤC CÁC HÌNH Hình 1.1 Cấu tạo tế bào vi khuẩn E coli O157:H7 Hình 1.2 Cấu trúc hệ gen vi khuẩn E coli O157:H7 Hình 1.3 Hình ảnh khuẩn lạc môi trƣờng Endo agar môi trƣờng Fluorocult Hình 1.4 Cấu trúc Shiga – like – toxin chế gây bệnh vi khuẩn E coli O157:H7 10 Hình 1.5 Hình ảnh cấu trúc aptamer liên kết với protein neomycin 15 Hình 1.6 Quy trình phƣơng pháp làm giàu phát triển hệ thống phối tử cấp số mũ (SELEX) 18 Hình 1.7 Sơ đồ aptamer ssDNA 18 Hình 1.8 Cấu tạo kính hiển vi điện tử truyền qua (TEM) 25 Hình 2.1 Ba giai đoạn chu kỳ PCR 33 Hình 2.2 Đồ thị biểu diễn mối quan hệ thời gian nhiệt độ chu kỳ PCR .33 Hình 2.3 PCR với lƣợng sản phẩm tăng theo cấp số nhân 34 Hình 2.4 Sơ đồ cấu tạo vector tách dịng PCR2.1 – TOPO (Invitrogen) 37 Hình 2.5 Sơ đồ giải trình tự gen theo phƣơng pháp F.Sanger 43 Hình 3.1 Kết PCR làm giàu thƣ viện 46 Hình 3.2 Quá trình tạo sợi đơn DNA sử dụng enzym lamda exonuclease 48 Hình 3.3 Kết tạo ssDNA từ sản phẩm PCR sử dụng enzyme lamda exonuclease 48 Hình 3.4 Kết PCR sản phẩm sau cắt tạo sợi đơn 49 Hình 3.5 Kết PCR làm giàu sau vòng sàng lọc với cặp mồi ApF2/ApR2 50 Hình 3.6 Q trình tách dịng sản phẩm sau sàng lọc 52 Hình 3.7 Quy trình tách dịng giải trình tự aptamer ssDNA nhận biết đặc hiệu vi khuẩn E coli O157:H7 53 viii Hình 3.8 Kết điện di sản phẩm PCR 54 Hình 3.9 Cơ chế hoạt động TA Cloning kit 55 Hình 3.10 Kết biến nạp vector pCR2.1 (đã gắn sản phẩm PCR) vào tế bào E coli DH5α………………….………………………………………… … 56 Hình 3.11 Kết PCR trực tiếp từ khuẩn lạc với cặp mồi ApF2/ApR2 57 Hình 3.12 Kết tách chiết plasmid tái tổ hợp mang apamer liên kết E coli O157:H7 58 Hình 3.13 Kết Dot blot phức hợp aptamer - nano vàng với kháng nguyên đích E coli O157:H7 59 Hình 3.14 Ảnh chụp kính hiển vi điện tử truyền qua (TEM) phức hệ aptamer-hạt vàng 61 Hình 3.15 Kết tra sản phẩm tách dòng aptamer ssDNA 62 Hình 3.16 Trình tự aptamer ssDNA 63 Hình 3.17 Mơ hình cấu trúc bậc aptamer ssDNA đƣợc dự đốn cơng cụ Mfold 64 Hình 3.18 Kết so sánh trình tự aptamer ssDNA với trình tự aptamer ngân hàng gen công cụ FASTA 64 ix DANH MỤC CÁC BẢNG Bảng 1.1 Thông số hệ gen vi khuẩn E coli O157:H7 Bảng 1.2 So sánh ƣu điểm aptamer kháng thể 17 Bảng 2.1 Thành phần hỗn hợpPCR khuếch đại trình tự gen làm giàu thƣ viện 29 Bảng 2.2 Chu kỳ nhiệt PCR khuếch đại trình tự gen làm giàu thƣ viện 29 Bảng 2.3 Thành phần hỗn hợp phản ứng tạo ssDNA 30 Bảng 2.4 Thành phần hỗn hợp PCR khuếch đại trình tự gen 34 Bảng 2.5 Chu kỳ nhiệt PCR khuếch đại trình tự gen làm giàu thƣ viện 34 Bảng 3.1 Tóm tắt điều kiện nghiêm ngặt tăng dần cho vòng sàng lọc 51 x 1:1-72) 70 60 50 40 30 20 EMBOS- TATCCGTCACACCTGCTCTGTAGATGGCAAGGCATAAGCGTCCGGTTGGTGTGGTTGGTG ::::::::: :::::::::::::::::::::::::::::::::: : : ::::: EM_PAT ATCCGTCACTCCTGCTCTGTAGATGGCAAGGCATAAGCGTCCGGAACGATAGAATGGTG 10 20 30 40 50 10 EMBOS- TTGGCTCCCGTAT ::::::::::::: EM_PAT TTGGCTCCCGTAT 60 70 25 EM_PAT:JA04 1140 Sequence 156 from Patent EP2255015 Cross-references and related information in:   72 279 87.5 87.5 1.3E-9 Literature Ontologies >>EM_PAT:JA041140 JA041140.1 Sequence 156 from Patent EP2255015 (72 nt) rev-comp initn: 279 init1: 279 opt: 279 Z-score: 372.7 bits: 72.9 E(169318201): 1.3e09 banded Smith-Waterman score: 279; 87.5% identity (87.5% similar) in 72 nt overlap (721:1-72) 70 60 50 40 30 20 EMBOS- TATCCGTCACACCTGCTCTGTAGATGGCAAGGCATAAGCGTCCGGTTGGTGTGGTTGGTG ::::::::: :::::::::::::::::::::::::::::::::: : : ::::: EM_PAT ATCCGTCACTCCTGCTCTGTAGATGGCAAGGCATAAGCGTCCGGAACGATAGAATGGTG 10 20 30 40 50 10 EMBOS- TTGGCTCCCGTAT ::::::::::::: EM_PAT TTGGCTCCCGTAT 60 70 26 EM_PAT:JA04 1029 Sequence 45 from Patent EP2255015 Cross-references and related information in:   72 279 87.5 87.5 1.3E-9 Literature Ontologies >>EM_PAT:JA041029 JA041029.1 Sequence 45 from Patent EP2255015 (72 nt) initn: 279 init1: 279 opt: 279 Z-score: 372.7 bits: 72.9 E(169318201): 1.3e-09 banded Smith-Waterman score: 279; 87.5% identity (87.5% similar) in 72 nt overlap (172:1-72) 10 20 30 40 50 60 ATACGGGAGCCAACACCAACCACACCAACCGGACGCTTATGCCTTGCCATCTACAGAGCA :::::::::::::::::: : : :::::::::::::::::::::::::::::::: EM_PAT ATACGGGAGCCAACACCATTCTATCGTTCCGGACGCTTATGCCTTGCCATCTACAGAGCA 10 20 30 40 50 60 EMBOS 70 GGTGTGACGGATA : :::::::::: EM_PAT GTTGTGACGGAT 70 EMBOS 74 27 EM_PAT:GZ84 4085 Sequence 43 from patent US 8389710 Cross-references and related information in:  72 279 87.5 87.5 1.3E-9 Ontologies >>EM_PAT:GZ844085 GZ844085.1 Sequence 43 from patent US 8389710 (72 nt) initn: 279 init1: 279 opt: 279 Z-score: 372.7 bits: 72.9 E(169318201): 1.3e-09 banded Smith-Waterman score: 279; 87.5% identity (87.5% similar) in 72 nt overlap (172:1-72) 10 20 30 40 50 60 ATACGGGAGCCAACACCAACCACACCAACCGGACGCTTATGCCTTGCCATCTACAGAGCA :::::::::::::::::: : : ::::::: :::::::::::::::::::::::: EM_PAT ATACGGGAGCCAACACCATTCTATCGTTCCGGACGGTTATGCCTTGCCATCTACAGAGCA 10 20 30 40 50 60 EMBOS 70 GGTGTGACGGATA :::::::::::: EM_PAT GGTGTGACGGAT 70 EMBOS 28 EM_PAT:JA04 1320 Sequence 336 from Patent EP2255015 Cross-references and related information in:   73 270 87.7 87.7 5.6E-9 Literature Ontologies >>EM_PAT:JA041320 JA041320.1 Sequence 336 from Patent EP2255015 (73 nt) rev-comp initn: 288 init1: 220 opt: 270 Z-score: 361.2 bits: 70.8 E(169318201): 5.6e09 banded Smith-Waterman score: 270; 87.7% identity (87.7% similar) in 73 nt overlap (721:1-73) 70 60 50 40 30 20 EMBOS- TATCCGTCACACCTGCTCTGTAGATGGCAAGGCATAAGCGTCCGG-TTGGTGTGGTTGGT :::::::::::::::::::::::::::::::::::::::::::: : : :::: EM_PAT ATCCGTCACACCTGCTCTGTAGATGGCAAGGCATAAGCGTCCGGAAACGATAGAATGGT 10 20 30 40 50 10 EMBOS- GTTGGCTCCCGTAT :::::::::::::: EM_PAT GTTGGCTCCCGTAT 60 70 29 EM_PAT:JA04 1004 Sequence 20 from Patent EP2255015 Cross-references and related information in:   72 261 84.7 84.7 2.4E-8 Literature Ontologies >>EM_PAT:JA041004 JA041004.1 Sequence 20 from Patent EP2255015 (72 nt) initn: 261 init1: 261 opt: 261 Z-score: 350.0 bits: 68.7 E(169318201): 2.4e-08 banded Smith-Waterman score: 261; 84.7% identity (84.7% similar) in 72 nt overlap (172:1-72) 10 20 30 40 50 60 75 EMBOS ATACGGGAGCCAACACCAACCACACCAACCGGACGCTTATGCCTTGCCATCTACAGAGCA :::::::::::::::::: : : :::::::::::::::::::::::: ::::: EM_PAT ATACGGGAGCCAACACCATTCTATCGTTCCGGACGCTTATGCCTTGCCATCTCACGAGCA 10 20 30 40 50 60 70 GGTGTGACGGATA :::::::::::: EM_PAT GGTGTGACGGAT 70 EMBOS 30 EM_PAT:JA04 0997 Sequence 13 from Patent EP2255015 Cross-references and related information in:  Literature  Ontologies 70 256 86.1 86.1 5.3E-8 >>EM_PAT:JA040997 JA040997.1 Sequence 13 from Patent EP2255015 (70 nt) rev-comp initn: 256 init1: 170 opt: 256 Z-score: 343.9 bits: 67.5 E(169318201): 5.3e08 banded Smith-Waterman score: 256; 86.1% identity (86.1% similar) in 72 nt overlap (721:1-70) 70 60 50 40 30 20 EMBOS- TATCCGTCACACCTGCTCTGTAGATGGCAAGGCATAAGCGTCCGGTTGGTGTGGTTGGTG :::::::::::::::::::::::::::::::::: :::::::: : : ::::: EM_PAT ATCCGTCACACCTGCTCTGTAGATGGCAAGGCAT GCGTCCGGAACGATAGAATGGTG 10 20 30 40 50 10 EMBOS- TTGGCTCCCGTAT ::::::::::::: EM_PAT TTGGCTCCCGTAT 60 70 31 EM_PAT:GZ84 4091 Sequence 49 from patent US 8389710 Cross-references and related information in:  Ontologies 72 252 83.3 83.3 1.0E-7 >>EM_PAT:GZ844091 GZ844091.1 Sequence 49 from patent US 8389710 (72 nt) rev-comp initn: 252 init1: 252 opt: 252 Z-score: 338.6 bits: 66.6 E(169318201): 1e-07 banded Smith-Waterman score: 252; 83.3% identity (83.3% similar) in 72 nt overlap (721:1-72) 70 60 50 40 30 20 EMBOS- TATCCGTCACACCTGCTCTGTAGATGGCAAGGCATAAGCGTCCGGTTGGTGTGGTTGGTG :::::::::::::::::::::::::::::::::::::::::::: : : ::::: EM_PAT ATCCGTCACACCTGCTCTGTAGATGGCAAGGCATAAGCGTCCGGAACGATAGAATGGTG 10 20 30 40 50 10 EMBOS- TTGGCTCCCGTAT : : ::::::: EM_PAT TGGCTCCCCGTAT 60 70 32 EM_PAT:JA04 1035 Sequence 51 from Patent EP2255015 Cross-references and related information in: 72 184 76.7 76.7 0.0061 76   Literature Ontologies >>EM_PAT:JA041035 JA041035.1 Sequence 51 from Patent EP2255015 (72 nt) initn: 153 init1: 153 opt: 184 Z-score: 252.8 bits: 50.7 E(169318201): 0.0061 banded Smith-Waterman score: 184; 76.7% identity (76.7% similar) in 73 nt overlap (172:1-72) 10 20 30 40 50 ATACGGGAGCCAACACCAACCACACCAACCGGACGCTTATGC-CTTGCCATCTACAGAGC :::::::::::::::::: :: : :: :: : :::: ::: : : : ::::::: EM_PAT ATACGGGAGCCAACACCACCCCCTCCCTCCTG-CGCTGCTGCTCATCATCGCGACAGAGC 10 20 30 40 50 EMBOS 60 70 AGGTGTGACGGATA ::::::::::::: EM_PAT AGGTGTGACGGAT 60 70 EMBOS 33 EM_PAT:GZ84 4109 Sequence 67 from patent US 8389710 Cross-references and related information in:  Ontologies 72 184 78.4 78.4 0.0061 >>EM_PAT:GZ844109 GZ844109.1 Sequence 67 from patent US 8389710 (72 nt) rev-comp initn: 153 init1: 153 opt: 184 Z-score: 252.8 bits: 50.7 E(169318201): 0.0061 banded Smith-Waterman score: 184; 78.4% identity (78.4% similar) in 74 nt overlap (721:1-72) 70 60 50 40 30 20 EMBOS- TATCCGTCACACCTGCTCTGT AGATGGCAAGGCATAAGCGTCCGGTTGGTGTGGTTGG :::::::::::::::::::: :::: : ::: :::: : :: :: : :: ::: EM_PAT ATCCGTCACACCTGCTCTGTCGCGATGATGA-GCAGCAGCG-CAGGAGGGAGGGGGTGG 10 20 30 40 50 10 EMBOS- TGTTGGCTCCCGTAT ::::::::::::::: EM_PAT TGTTGGCTCCCGTAT 60 70 Hình 3.18: Kết so sánh trình tự aptamer ssDNA với trình tự aptamer ngân hàng gen công cụ FASTA 77 KẾT LUẬN VÀ KIẾN NGHỊ Kết luận - Đã xây dựng đƣợc quy trình sàng lọc aptamer ssDNA đặc hiệu E coli O157:H7 lựa chọn đƣợc aptamer có lực liên kết cao với vi khuẩn E coli O157:H7 - Đã tách dịng, xác định trình tự, dự đốn cấu trúc bậc phân tích cấu trúc aptamer ssDNA Kết cho thấy aptamer ssDNA có chiều dài 72 nucleotid với vùng hoạt động: vùng khoảng nucleotid 1-28, vùng khoảng 43-57 Kiến nghị - Nghiên cứu tính đặc hiệu chọn lọc dòng aptamer ssDNA với số vi khuẩn: E coli O104:H4, E coli O102, Salmonella spp., Shigella - Nghiên cứu khả sử dụng aptamer ssDNA đặc hiệu E coli O157:H7 nhằm tạo kit xác định nhanh E coli O157:H7 78 TÀI LIỆU THAM KHẢO Tài liệu tiếng Việt Hà Mai Dung, Trần Nhật Khoa (2011), ―Tình hình nhiễm E coli O157:H7 bị ngoại thành phố Hồ Chí Minh ‖, Tạp chí Y học thành phố Hồ Chí Minh, tập 15, số Trần Thị Định, Vũ Thị Thƣ, Jeroen Lammertyn (2010),―Xác định số phân ly DNA aptamer-im-munoglobuline nhờ phƣơng pháp huỳnh quang bất đẳng hƣớng điện di mao quản‖.Tạp chí Dinh Dưỡng Thực phẩm/Journal of Food and Nutrition Sciences,tập 6, số 3+4 Nguyễn Trọng Hải, Đào Hoài Thu, Phan Thị Hằng, Hồ Văn Hiệp, Nguyễn Thị Kim Phụng, Đỗ Văn Tấn, Lê Đình Hải, Vũ Khắc Hùng (2011), ―Xác định tỷ lệ nhiễm khả kháng kháng sinh vi khuẩn Escherichia coli O157:H7 trâu, bò khỏe mạnh số tỉnh Nam Trung Bộ‖ Tạp chí Khoa học Kỹ thuật thú y, tập XVIII, số 3: 31- 37 Hoàng Phú Hiệp, Nguyễn Thị Giang, Lê Quang Huấn (2011), ―Tách dịng xác định trình tự đoạn gen 16S rRNA vi khuẩn Escherichia coliO157:H7‖ Tạp chí Dinh dưỡng Thực phẩm, tập 7, số 2, tháng 6/2011 Lê Thị Mai Khanh (2004), ―Phát số gen độc lực Escherichia coli phân lập đƣợc từ phân thịt bò, heo kỹ thuật multiplex - PCR” Luận văn Thạc sỹ Nông nghiệp Trƣờng Đại học Nơng Lâm, TP Hồ Chí Minh Phạm Thị Tâm, Phạm Công Hoạt, Tô Long Thành (2011), ―Nghiên cứu xác định điều kiện tối ƣu quy trình sản xuất kháng thể đơn dòng đặc hiệu với kháng nguyên H7 vi khuẩn Escherichia coliO157:H7‖ Tạp chí Nơng nghiệp Phát triển nông thôn, số 10 (168), 2011 Tài liệu tiếng Anh Baker DR, Moxley RA, Steele MB, LeJeune JT, Christopher-Hennings J, Chen DG, Hardwidge PR, Francis DH (2007),―Differences in virulence among 79 Escherichia coli O157:H7 strains isolated from humans during disease outbreaks and from healthy cattle.‖, Appl Environ Microbiol 73(22): 7338-7346 Barrett T J., Kaper L P., Jerse A E., and Wachsmuth I K (1992),―Virulence factors in Shiga-like toxin producing Escherichia coli isolated from humans and cattle‖, J.Infect Dis 165: 970 - 980 Baugh, C., D Grate, C.Wilson (2000),―2.8 angstrom crystal structure of the malachite green aptamer.‖, J Mol Biol 301 : 117–128 10 Bolger M., Coker R D., DiNovi M., Gaylor D., Gelderblom W., OlsenM., Speijers G J A, Fumonisins (2001), ―WHO/IPCS safety evaluation of certain mycotoxins in food‖ WHO Food Additives Series, 47, pp.557-680 11 Cebula T A., Payne W L., and Feng P (1995),―Simultaneous IdentificationofStrains ofEscherichia coli Serotype O157:H7 and Their Shiga – Like toxin‖ 12 Cháfer-Pericás, C.; Maquieira, Á & Puchades, R (2010), ―Fast screening methods to detect antibiotic residues in food samples.‖, TrAC Trends in Analytical Chemistry, 29, (10), pp.1038-1049, 0165-9936 13 Cheli F., Pinotti L., Campagnoli A., Fusi E., Rebucci R., Baldi A (2008), ―Mycotoxin analysis, mycotoxin-producing fungi assays and mycotoxin toxicity bioassays in food mycotoxin monitoring and surveillance‖, Italian Journal of Food Science, 20, 4, pp.447-462, 1120-1770 14 Clarke RC, Read SCMSA (1991), ―Isolation of verocytotoxin-producing Escherichia coli from animal and food products In: Workshop on Methods to Isolate E coli O157:H7 and Other Verotoxigenic E coli”, From Foods: Ottawa, Canada Canada 15 Darfeuille F., S Reigadas, J Hansen, H Orum, C Di Primo, J Toulme (2006), "aptamers targeted to an RNA hairpin show improved specificity compared to that of complementary oligonucleotides.", Biochemistry 45 : 12076–12082 80 16 David JH & Szostak JW (2002), ―Isolation of high – affinity GTP aptamer from partially structured RNA libraries.‖, Proc Nalt Acad Sci USA 99, 11616- 11621 17 Deng M, Fratamico P (1996),―A multiplex PCR for rapid identificaton of shiga-like toxin-producing Escherichia coli O157:H7 isolated from foods.‖, Journal of Food Protection 1996;59;570-576 18 Dieckmann T., E Fujikawa, X Xhao, J Szostak, J Feigon (1995), ―Structural Investigations of RNA and DNA aptamers in Solution‖, Journal of Cellular Biochemistry : 56–56 19 Ding H., Huang L., Mao X., Zou Q (2011),―Characterization of stx2 and its variants in Escherichia coli O157:H7 isolated from patients and animals.‖, AJB, 10: 2991-2998 20 Donnenberg M S., Tzipori S., McKee M L., O’Brien A D., Alroy J., and Kaper J B (1993),―The role of the eae gene of enterohemorrhagic Escherichia coli in intimate attachment in vitro and in a porcine model.‖, J Clin Invest 92: 1418 - 1424 21 Doyle M P and J L Schoeni (1987),―Isolation of Escherichia coli O157:H7 from retail fresh meats and poultry‖, Appl Environ Microbiol, 53:23942396 22 Ellington AD & Szostak JW (1992),―Selection In vitro of single – strand DNA molecules that fold into specific ligand – binding structures.‖, Nature, 355, 850-852 23 Esposito CL., Catuogno S., Franciscis V., Cerchia L (2011),―New insight into the clinical development of nucleic acid aptamers.‖, Discovery Medicine; 11 (61): 487–496 PMid:21712014 24 Feng P and Monday S (2000), ―Multiplex PCR for detection of trait and virulence factors in enterohemorrhagic Escherichia coli serotypes ‖, Molecular and Cellular Probes 14: 333 - 337 81 25 Friedrich AW., Bielaszewska M., Zhang WL., Pulz M., Kuczius T., Ammon A., Karch H (2002),―Escherichia coli harboring Shiga toxin gene variants: frequency and association with clinical symptoms.‖, J Infect Dis 185: 7484 26 Fujisawa T., Sata S., and Aikawa K (2002), “Evaluation of sorbitolsalicin MacConkey medium containing cefixime and tellurite (CT-SSMAC medium) for isolation of Escherichia coli O157:H7 from raw vegetables.‖, J Food Mic 74: 161 - 163 27 Grate D., & Wilson C (1999), ―Laser-mediated, site-specific inactivation of RNA transcripts.‖, Proceedings of the National Academy of Sciences of the United States of America, 96, 11, (May 25), pp.6131-6136, 0027-8424; 0027-8424 28 Held D.M., Greathouse S.T., Agrawal A., Burke D.H (2003), ―Evolutionary landscapes for the acquisition of new ligand recognition by RNA aptamers.‖, J Mol Evol 57, 299–308 29 Hendry P., Hannan G (1996),―Detection and quantitation of unlabeled nucleic acids in polyacrylamide gels.‖, Biotechniques 20, 258–264 30 Huang Z., Szostak J.W (2003), ―Evolution of aptamers with secondarystructures from a new specificity and new an ATP aptamer RNA-A 9,1456–1463 31 Jayasena SD (1999), ―aptamers: an emerging class of molecules that rival antibodies in diagnostics.‖, Clin Chem, 45 (9): 1628–1650 32 Jensen K.B., Atkinson B.L., WillisM.C., Koch T.H., Gold L (1995), ―Using invitro selection to direct the covalent attachment of human immuno deficiency virus type Rev protein to high-affinity RNA ligands.‖, Proc Natl Acad Sci USA 92, 12220–12224 33 Jerse A E., Yu J., Tall B D., and Kaper J B (1990),―A genetic locus of enteropathogenic Escherichia coli necessary for the production of attaching and effacing lesions on tissue culture cells.‖ Proc Natl Acad Sci USA 87: 7839 – 7843 82 34 Jeon S.H., Kayhan B., Ben-Yedidia T., RNA R (2004),―A DNA aptamer prevents influenza infection by blocking the receptor binding region of the iral hemagglutinin.‖, J Biol Chem 279, 48410–48419 35 Jeong S., Eom T., Kim S., Lee S., Yu J (2001), ―In vitro selection of the RNA aptamer against the Sialyl Lewis X and its inhibition of the cell adhesion Biochem.‖, Biophys Res Commun 281, 237–243 36 Jeong S., SR Han, YJ Lee, SW Lee (2010), ―Selection of RNA aptamers specific to active prostate-specific antigen.‖, Biotechnology Letters 32 : 379–85 37 Josefa M Rangel, Phyllis H Sparling, Collen Crowe, Patricia M Griffin, David L Swerdlow(2005), ―Epidemiology of Escherichia coli O157:H7 Outbreaks, United States, 1982–2002‖, Emerg Infect Dis.11(4):603–609 PMCID: PMC3320345 38 Kim M., Um H J., Bang S., Lee S H., Oh S J., Han J H., Kim Y H (2009), ―Arsenic removal from vietnamxsese groundwater using the arsenic-binding DNA aptamer.‖, Environmental Science & Technology, 43, 24, (Dec 15), pp.93359340, 0013-936X; 0013-936X 39 Kim H H (1994), ―Characteristics of antibiotic-resistant Escherichia coli0157:H7 in Washington State, 1984-1991.‖, J Infect Dis 170: 1606-1609 40 Kozyr, N Luneva, A Kolesnikov, A Khlyntseva, I Shemyakin (Moscow, RU) (2013), ― Development of sensitive assays based on DNA-aptamers selected against virulent strain E coli O157:H7‖, European society of clinical microbiology and infectious disases, 24/9/2013 41 Kyung-Mi Song, Seonghwan Lee, and Changill Ban (2012), ―aptamer and their biological applications‖, Sensors (Basel) 2012; 12(1): 612–631 42 Levine M M., Xu J., Kaper J B., Lior H., Prado V., Tall B., Nataro J., Karch H., and Wachsmuth I K (1987), ―A DNA probe to identify enterohemorrhagic Escherichia coli of O157:H7 and other serotypes that cause hemorrhagic colitis and hemolytic uremic syndrome.‖, J Infect Dis 156: 175 – 182 83 43 Leyer G J., Wang L., and Johnson E A (1995), ―Acid adaptation of Escherichiacoli O157:H7 increases survival in acidic foods‖, Appl Environ Microbiol 61:3752- 3755 44 Lingwood C A (1996), ―Role of verotoxin receptors in pathogenesis.‖, TrendsMicrobiol 4: 147 - 153 45 Liu M., T.Kagahara, H.Abe, Y.Ito (2009), ―Direct In Vitro Selection of Hemin-Binding DNA aptamer with Peroxidase Activity‖, Bulletin of the Chemical Society of Japan 82 : 99–104 46 Long S., M Long, R White, B Sullenger (2008), ―Crystal structure of an RNA aptamer bound to thrombin‖ RNA 14 (2): 2504–2512 47 Min K., M Cho, S Han, Y Shim, J Ku, C Ban (2008), ―A simple and direct electrochemical detection of interferon-gamma using its RNA and DNA aptamers.‖, Biosensors & Bioelectronics 23 : 1819–1824 48 Murphy MB, Fuller ST, Richardson PM & Doyle SA (2003), ―An improved method for the in vitro evolution of aptamers and applications in protein detection and purification.‖ Nucleic Acids Res 31, e110 49 Myron M Levine, Jian-guo Xu, James B Kaper, Hermy Lior, Valeria Prado, Ben Tall, James Nataro, Helge Karch and Kaye Wachsmuth(1987),―A DNA Probe to Identify Enterohemorrhagic Escherichia coli of 0157:H7 and Other Serotypes That Cause Hemorrhagic Colitis and Hemolytic Uremic Syndrome‖ Oxford Joural, Volume 156 Issue 1, p.175-182 50 Ng, EWM, DT Shima P., Calias, ET Cunningham, DR Guyer, AP Adamis (2006), ―Pegaptanib, a targeted anti-VEGF aptamer for ocular vascular disease.‖ Nature Reviews Drug Discovery (2): 123–132 51 O’Sullivan C.K (2002), ―Aptasensors—the future of biosensing‖ Anal Bioanal.Chem 372, 44–48 52 Ohuchi S.P., Ohtsu T., Nakamura Y (2006), ―Selection of RNA aptamers against recombinant transforming growth factor-beta type III receptor displayed on cell surface.‖, Biochimie 88, 897–904 84 53 Patricia M Griffin, MD, Stephen M Ostroff, MD, Robert V Tauxe, MD, MPH, Katherine D Greene, Joy G Wells, MS, Jay H., Lewis BS., Paul A Blake, MD, MPH (1988), ―Illnesses Associated with Escherichia coli 0157:H7 Infections: A Broad Clinical Spectrum‖, Ananals of Internal Medicine,109(9):705712 54 Paton J C and Paton A W (1998), ―Pathogenesis and diagnosis of Shiga toxin-producingEscherichia coli infection‖, Clin Microbiol Rev 11: 450 – 479 55 Potty, A.; K Kourentzi, H Fang, G Jackson, X Zhang, G Legge, R Willson (2009), ―Biophysical Characterization of DNA aptamer Interactions with Vascular Endothelial Growth Factor.‖, Biopolymers 91 : 145–156 56 Ray P et al (2012), ―aptamer-mediated delivery of chemotherapy to pancreatic cancer cells‖, Nucleic Acid Therapeutics, 22 (5): 295–305 57 Regina Stoltenburg, Christine Reinemann, Beate Strehlitz (2007), ―SELEX _ A(r)evolutionary method to generate high – afinity nucleic acid ligands‖, Science Direct, Biomolecular Engineerung 24: 381-403 58 Riley LW, Remis RS, Helgerson SD, McGee HB, Wells JG, Davis BR, Heber Rj, Olcott ES, Johnson LM, Hargrett NT (1983), ―Hemorrhagis colitis associated with a rare E coli O157:H7 ‖ N Engl J Med, 308:681-685 59 Roger P Jonson, Rebecca J Durham, Shelley T Johnson, Leslie A Macdonal, Scott R Jeffrey, and Bryan T.Butman (1995), ―Detection of Escherichia coli O157:H7 in Meat by an Enzyme-Linked Immunosorbent Assay, EHEC-Tek‖, Applied anh Environmental, p 386–388 60 Roland Lindqvist (1997), ―Preparation of PCR samples from food by a rapid and simple centrifugation technique evaluated by detection of E coli O157:H7‖, International Journal of Food Microbioly 61 Savory N., K Abe, K Sode, K Ikebukuro (2010),"Selection of DNA aptamer against prostate specific antigen using a genetic algorithm and application to sensing.", Biosensors & Bioelectronics 15 : 1386–91 85 62 Shamah SM, Healy JM, Cload ST (2008), ―Complex target SELEX.‖, Acc Chem Res, 41 (1): 130–138 63 Stead S L., Ashwin H., Johnston B., Dallas A.; Kazakov S A., Tarbin J A., Keely B J (2010), ―An RNA-aptamer-based assay for the detection and analysis of malachite green and leucomalachite green residues in fish tissue.‖ Analytical Chemistry, 82, 7, (Apr 1), pp.2652-2660, 1520-6882; 0003-2700 64 Tombelli S., Minunni A., Mascini A (2005), ―Analytical applications of aptamers Biosens.‖, Bioelectron 20, 2424–2434 65 Toulme J.J., Darfeuille F., Kolb G.L., Chabas S., Staedel C (2003), ―Mod-ulating viral gene expression by aptamers to RNA structures.‖, Biol Cell 95,229–238 66 Tsai RYL, Reed RR (1998), ―Identification of DNA recognition sequnces and protein intreaction domains of the multiple – Zn – finger protein Roaz.‖, Mol Cell Biol 18, 6447-6456 67 Tuerk C & Gold L (1990), ―Systematic evolution of lignads by exponential enrichment: RNA lignads to bacteriophage T4 DNA polymerase.‖, Science, 249, 505-510 68 Tzipori S., Karch H., Wachsmuth I K., Robins-Browne R M., O’Brien A D., Lior H., Cohen M L., Smithers J., and Levine M M (1987), ―Role of a 60MDa plasmid and Shiga-like toxins in the pathogenesis of infection caused by enterohemorrhagic Escherichia coli O157:H7 in gnotobiotic piglets.‖, Infect Immun 55: 3117 – 3125 69 Xu J P., Song Z G., Fang Y., Mei J., Jia L., Qin A J., Tang B Z (2010), ―Label-free fluorescence detection of mercury(II) and glutathione based on Hg2+DNA complexes stimulating aggregation-induced emission of a tetraphenylethene derivative.‖, The Analyst, 135, 11, (Nov), pp.3002-3007, 1364-5528; 0003-2654 70 Walsh R., M DeRosa (2009), ―Retention of function in the DNA homolog of the RNA dopamine aptamer‖, Biochemical and Biophysical Research Communications, 388 : 732–735 86 71 Waterman S R., and Small P L (1996), ―Characterization of the acid resistance phenotype and rpoS alleles of Shiga-like toxin-producing Escherichia coli.‖, Infect Immun 64: 2808 – 2811 72 Wells J, Davis B, Wachsmuth I, Riley L, Remis RS, Sokolow R, Morris G (1983) ―Laboratory investigation of hemorrhagic colitis outbreaks associates with a rare E coli seotype‖, J Clin Microbiol, 18: 512 73 Wen-he Wu, Min Li, Yue Wang, Hou-xian Ouyang, Lin Wang, Ci-xiu Li, Yu-chen Cao, Qing-he Meng and Jian-xin Lu1 (2012), ―Aptasensors for rapid detection of Escherichia coli O157:H7 and Salmonella typhimurium.‖,PLoS One (Public Library of Science), November 2012, Volume 7, Issue 11, e48999 74 Williams K.P., Liu X.H., Schumacher T.N., Lin H.Y., Ausiello D.A., Kim P.S., Bartel D.P (1999), ―Bioactive and nuclease-resistant L-DNA ligand of vasopressin.‖, Proc Natl Acad Sci U S A 94, 11285–11290 75 Wilson C., Nix J., Szostak J (1998), ―Functional requirements for specific ligand recognition by a biotin-binding RNA pseudoknot.‖, Biochemistry 37,14410–14419 76 Wilson, C., Szostak, J (1999), ―In vitro evolution of a self-alkylating ribozyme.‖, Nature 374, 777–782 77 Wilson, C., Szostak, J.W (1999), ―Isolation of a fluorophore-specific DNA aptamer with weak redox activity.‖, Chem Biol 5, 609–617 78 Wilson, D.S., Szostak J.W (1999), ―In vitro selection of functional nucleic acids.‖, Ann Rev Biochem 68, 611–647 79 Wong C.S, (2000) ―The Risk of the Hemolytic-Uremic Syndrome after Antibiotic Treatment of E coli 0157: H7‖, New Engl Journ Of Medicine, vol342, no 26, June29 80 Wu W, Zhang J, Zheng M, Zhong Y, Yang J, Zhao Y, Wu W, Ye W, Wen J, Wang Q, Lu J.(2012), ―An aptamer-based biosensor for colorimetric detection of Escherichia coli O157:H7.”, PLoS One.(Public Library of Science) 2012;7(11) 87 81 Ying Lu, Xianchan Li, limin Zhang, Ping Yu, Lei Su, and Lanqun Mao (2008), ―aptamer – Based Electrochemical Sensors with aptamer- Complementary DNA Oligonucleotides as probe‖, Anal.Chem :1883-1890 82 Young Ju Lee, Seung Ryul Han, Jin-Soo Maeng, Yong-Jin Cho, SeongWook Lee (2012), ―In vitro selection of Escherichia coli O157:H7-specific RNA aptamer.‖, Biochemical and Biophysical Research Communications, Volume 417, Issue 1, January 2012, Pages 414–420 83 Zhou J, Li H, Zhang J, Piotr S, Rossi J (2011), ―Development of celltype specific anti-HIV gp120 aptamers for siRNA delivery.‖, J Vis Exp 2011 Jun 23;(52) pii: 2954 doi: 10.3791/2954 84 Zuker M., ―Mfold web server for nucleic acid folding, hybridization prediction‖, Nucleic Acids Res 31 (2003) 3406–3415 85 http://www.aptagen.com/home.aspx 86 http://edition.cnn.com/2013/06/28/health/e-coli-outbreaks-fast-facts/ 88 ... Axit ethyenediaminetetraacetic E coli Escherichia coli Vi khuẩn Escherichia coli Bp CDC E coli O157: H7 Escherichia coli O157: H7 Vi khuẩn Escherichia coli O157: H7 H Hour Giờ HUS Hemolytic uremic... Và nghiên cứu để phát loại virus gây bệnh động thực vật  Tình hình nghiên cứu aptamer nhận biết đặc hiệu vi khuẩn E coli O157: H7 nƣớc Trên giới, có số nghiên cứu aptamer nhận biết đặc hiệu vi. .. aptamer đặc hiệu vi khuẩn E coli O157: H7 46 3.1.1.Chuẩn bị thƣ vi? ??n 36 3.1.2 Kết sàng lọc aptamer liên kết E coli O157: H7 50 3.2 Kết tách dòng aptamer liên kết đặc hiệu E coli O157: H7