AP 2 regulates estrogen receptor mediated long range chromatin interactions and gene transcription

AP-2γ REGULATES ESTROGEN RECEPTORMEDIATED LONG-RANGE CHROMATIN INTERACTIONS AND GENE TRANSCRIPTION TAN SI KEE B.Sc (Hons.), NTU A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY NUS GRADUATE SCHOOL FOR INTEGRATIVE SCIENCES AND ENGINEERING NATIONAL UNIVERSITY OF SINGAPORE 2012 i DECLARATION ii ACKNOWLEDGEMENTS First and foremost, I am thankful to my Ph.D supervisors, Dr Yong Eu Leong and Dr Edwin Cheung, for accepting me as their student in the pursuit of my Ph.D study I owe my deepest gratitude to Dr Edwin Cheung who has supported me throughout the past four years I greatly appreciate his guidance and mentorship, as well as the opportunities that he had provided me to work with great scientists within and outside of GIS, which have contributed tremendously to my learning experience in the scientific field I am deeply indebted to my colleagues who have worked with me on this project Special thanks to Mr Chang Cheng Wei for his extensive efforts in guiding our group in the usage of computational programs so that we can be self-sufficient in performing basic analyses on whole genome dataset Thanks to Mr Lin Zhen Hua who had provided the data on reporter and interaction assays I wish to acknowledge Dr Pan You Fu, Dr Liu Mei Hui, Dr Chuah Shin Chet, Dr Tan Peck Yean and Mr Chng Kern Rei for their valuable advice and insights during the course of my study It is a great pleasure to have met my present and former colleagues in GIS who have always been encouraging and made my stay enjoyable My heartfelt thanks to the GTB sequencing group in GIS for their commitment in generating high quality sequencing data iii This thesis would not have been possible without the sponsorship of my graduate study from NGS I also want to thank my TAC members and annual GIS graduate seminar committee for their scientific input and future directions Finally, I am blessed with family members and boyfriend who have provided me with continuous support and understanding during my graduate study iv TABLE OF CONTENTS DECLARATION .ii ACKNOWLEDGEMENTS iii TABLE OF CONTENTS v SUMMARY viii LIST OF TABLES x LIST OF FIGURES xi ABBREVIATIONS .xii PUBLICATION xvi CHAPTER INTRODUCTION 1.1 Physiological importance of estrogen 1.2 ER structure and mechanism of action 1.3 General co-regulators of ER-mediated transcription 1.4 Significance of ER in breast cancer 12 1.5 Therapeutic regimens for ERα-positive breast cancer 14 1.6 Comprehending ERα transcriptional network – before nextgeneration sequencing era 15 Genome-wide panorama of ERα-mediated transcription – in the next-generation sequencing era 17 1.8 Known collaborative factors of ERα 21 1.9 FoxA1, a pioneer factor of ERα in breast cancer cells 25 1.7 1.10 Activator protein-2 (AP-2) family in normal and cancer developments 32 1.11 Roles of AP-2γ in breast cancer 36 1.12 Aims of the study 39 CHAPTER MATERIALS AND METHODS 40 2.1 Cell culture 40 2.2 Cryogenic preservation and recovery of cells 40 2.3 Reporter plasmids construction 41 2.4 Site-directed mutagenesis 41 v 2.5 Plasmid DNA extraction 42 2.6 Transient transfection reporter assay 43 2.7 ChIP assay 43 2.8 Sequential ChIP 45 2.9 3C assay 46 2.10 Short interfering RNA (siRNA) studies 48 2.11 Cycloheximide treatment 48 2.12 RNA isolation and reverse transcription 49 2.13 Protein isolation and western blotting 49 2.14 Motif enrichment analysis 51 2.15 Solexa sequencing and binding site determination 51 2.16 De novo motif discovery 52 2.17 Microarray analysis 52 2.18 Real-time PCR 53 2.19 Data deposition 53 CHAPTER RESULTS 54 3.1 Enrichment of AP-2 motifs at ChIA-PET ERBS 54 3.2 Identification of AP-2γ as a potential collaborative factor of ERα 59 3.3 AP-2γ is essential for efficient transcription of estrogen-regulated genes 62 Prediction of AP-2 motifs at ChIA-PET ERBS associated with AP-2γ-dependent estrogen up-regulated genes 66 3.5 Expression of RET, a direct target of ERα, is regulated by AP-2γ 70 3.6 AP-2γ directly binds to RET-associated ERBS in a ligandindependent manner 74 3.7 AP-2γ regulates ERα-mediated long-range chromatin interactions 78 3.8 Recruitment of ERα to ERBS is dependent on AP-2γ 83 3.9 Similarity in AP-2γ and FoxA1 binding profiles in the MCF-7 genome 85 3.4 3.10 FoxA1 co-occupies with AP-2γ at the RET-associated ERBS 91 3.11 Preferential co-localization of AP-2γ and FoxA1 at ERBS across the MCF-7 genome 96 vi 3.12 Interdependence between AP-2γ and FoxA1 at ERBS 101 3.13 Preferential association of AP-2γ and FoxA1 with ERα-mediated long-range chromatin interactions 107 CHAPTER 4.1 4.2 4.3 4.4 DISCUSSIONS 109 Exploring potential determinants of ERα-mediated long range transcriptional regulation 109 AP-2γ is a transcriptional activator and repressor of estrogenregulated transcriptome 113 Combinatorial action of AP-2γ and FoxA1 in regulating the ERα cistrome 115 AP-2γ is a critical determinant of estrogen-mediated long-range chromatin interactions 117 CONCLUSION, FUTURE DIRECTIONS AND PERSPECTIVES 122 BIBLIOGRAPHY 125 APPENDIX I 153 APPENDIX II 158 APPENDIX III 159 APPENDIX IV 159 APPENDIX V 161 APPENDIX VI 162 vii SUMMARY Estrogen receptor α (ERα) is a key player in the development and progression of mammary tumorigenesis and factors collaborating with ERα within its network of transcription are likely to contribute to the pathological outcome Recently, the cistrome and interactome of ERα were mapped in breast cancer cell line, MCF-7, revealing the importance of spatial organization in estrogen-mediated transcription To unravel the relationship between ERα and other collaborative factors underlying such regulatory process, our genome-wide analysis on ERα binding sites (ERBS) identified from the Chromatin Interaction Analysis-Paired End DiTag (ChIA-PET) revealed a significant enrichment of AP-2 motifs Members of AP-2 transcription factor family are important regulators of vertebrate embryogenesis, required for proper formation of critical organs and body structures Moreover, their roles in adult tissues have been associated with multiple cancer types AP-2γ, earlier identified as estrogen receptor factor-1, was particularly involved in driving proliferation and tumor development in breast However, whether it works cooperatively with ERα at genomic level still remains unknown In our study, we demonstrated that AP-2γ regulates nearly half of the estrogenmediated transcriptome It is also recruited to ERBS associated with their coregulated genes in a ligand-independent manner, which is indicative of its early binding event Furthermore, perturbation of AP-2γ expression suggests its viii importance in ERα recruitment to chromatin and long-range chromatin interactions in response to estrogen Globally, we observed convergence of a large number of AP-2γ and ERα binding events across the genome The majority of these shared regions are also co-occupied by the pioneer factor, FoxA1, which shares similar genomic behavior with AP-2γ Our molecular studies further imply there is functional interplay between AP-2γ and FoxA1 at ERBS where they colocalize Finally, ERBS involved in long-range chromatin interactions are preferentially occupied by AP-2γ and FoxA1 Collectively, our findings suggest that AP-2γ is a novel collaborative factor of ERα to define higher-order chromatin structure for transcriptional regulation ix LIST OF TABLES Table Summary of ChIP-Seq analysis 88 x Sun J, Nawaz Z, Slingerland JM (2007) Long-range activation of GREB1 by estrogen receptor via three distal consensus estrogen-responsive elements in breast cancer cells Molecular endocrinology 21: 2651-2662 Svotelis A, Bianco S, Madore J, Huppe G, Nordell-Markovits A, Mes-Masson AM, Gevry N (2011) H3K27 demethylation by JMJD3 at a poised enhancer of anti-apoptotic gene BCL2 determines ERalpha ligand dependency EMBO J 30: 3947-3961 Tahira T, Ishizaka Y, Itoh F, Sugimura T, Nagao M (1990) Characterization of ret proto-oncogene mRNAs encoding two isoforms of the protein product in a human neuroblastoma cell line Oncogene 5: 97-102 Tan PY, Chang CW, Chng KR, Wansa KD, Sung WK, Cheung E (2011) Integration of regulatory networks by NKX3-1 promotes androgen-dependent prostate cancer survival Mol Cell Biol 32: 399-414 Tanner MM, Tirkkonen M, Kallioniemi A, Collins C, Stokke T, Karhu R, Kowbel D, Shadravan F, Hintz M, Kuo WL, et al (1994) Increased copy number at 20q13 in breast cancer: defining the critical region and exclusion of candidate genes Cancer Res 54: 4257-4260 Tennakoon C, Purbojati RW, Sung WK (2012) BatMis: a fast algorithm for kmismatch mapping Bioinformatics 28: 2122-2128 Teyssier C, Chen D, Stallcup MR (2002) Requirement for multiple domains of the protein arginine methyltransferase CARM1 in its transcriptional coactivator function The Journal of biological chemistry 277: 46066-46072 Thomas P, Pang Y, Filardo EJ, Dong J (2005) Identity of an estrogen membrane receptor coupled to a G protein in human breast cancer cells Endocrinology 146: 624-632 Tiwari VK, Cope L, McGarvey KM, Ohm JE, Baylin SB (2008) A novel 6C assay uncovers Polycomb-mediated higher order chromatin conformations Genome Res 18: 1171-1179 Tora L, White J, Brou C, Tasset D, Webster N, Scheer E, Chambon P (1989) The human estrogen receptor has two independent nonacidic transcriptional activation functions Cell 59: 477-487 Tozlu S, Girault I, Vacher S, Vendrell J, Andrieu C, Spyratos F, Cohen P, Lidereau R, Bieche I (2006) Identification of novel genes that co-cluster with 148 estrogen receptor alpha in breast tumor biopsy specimens, using a large-scale realtime reverse transcription-PCR approach Endocr Relat Cancer 13: 1109-1120 Tremblay A, Tremblay GB, Labrie F, Giguere V (1999) Ligand-independent recruitment of SRC-1 to estrogen receptor beta through phosphorylation of activation function AF-1 Mol Cell 3: 513-519 Trupp M, Arenas E, Fainzilber M, Nilsson AS, Sieber BA, Grigoriou M, Kilkenny C, Salazar-Grueso E, Pachnis V, Arumae U (1996) Functional receptor for GDNF encoded by the c-ret proto-oncogene Nature 381: 785-789 Tsytsykova AV, Rajsbaum R, Falvo JV, Ligeiro F, Neely SR, Goldfeld AE (2007) Activation-dependent intrachromosomal interactions formed by the TNF gene promoter and two distal enhancers Proceedings of the National Academy of Sciences of the United States of America 104: 16850-16855 Turner BC, Zhang J, Gumbs AA, Maher MG, Kaplan L, Carter D, Glazer PM, Hurst HC, Haffty BG, Williams T (1998) Expression of AP-2 transcription factors in human breast cancer correlates with the regulation of multiple growth factor signalling pathways Cancer Res 58: 5466-5472 Umayahara Y, Kawamori R, Watada H, Imano E, Iwama N, Morishima T, Yamasaki Y, Kajimoto Y, Kamada T (1994) Estrogen regulation of the insulinlike growth factor I gene transcription involves an AP-1 enhancer J Biol Chem 269: 16433-16442 Vakoc CR, Letting DL, Gheldof N, Sawado T, Bender MA, Groudine M, Weiss MJ, Dekker J, Blobel GA (2005) Proximity among distant regulatory elements at the beta-globin locus requires GATA-1 and FOG-1 Molecular cell 17: 453-462 Vega VB, Lin CY, Lai KS, Kong SL, Xie M, Su X, Teh HF, Thomsen JS, Yeo AL, Sung WK, Bourque G, Liu ET (2006) Multiplatform genome-wide identification and modeling of functional human estrogen receptor binding sites Genome Biol 7: R82 Wagner S, Weber S, Kleinschmidt MA, Nagata K, Bauer UM (2006) SETmediated promoter hypoacetylation is a prerequisite for coactivation of the estrogen-responsive pS2 gene by PRMT1 The Journal of biological chemistry 281: 27242-27250 Walter P, Green S, Greene G, Krust A, Bornert JM, Jeltsch JM, Staub A, Jensen E, Scrace G, Waterfield M, et al (1985) Cloning of the human estrogen receptor cDNA Proc Natl Acad Sci U S A 82: 7889-7893 149 Wang C, Mayer JA, Mazumdar A, Fertuck K, Kim H, Brown M, Brown PH (2011a) Estrogen induces c-myc gene expression via an upstream enhancer activated by the estrogen receptor and the AP-1 transcription factor Molecular endocrinology 25: 1527-1538 Wang D, Garcia-Bassets I, Benner C, Li W, Su X, Zhou Y, Qiu J, Liu W, Kaikkonen MU, Ohgi KA, Glass CK, Rosenfeld MG, Fu XD (2011b) Reprogramming transcription by distinct classes of enhancers functionally defined by eRNA Nature 474: 390-394 Wang H, Huang ZQ, Xia L, Feng Q, Erdjument-Bromage H, Strahl BD, Briggs SD, Allis CD, Wong J, Tempst P, Zhang Y (2001) Methylation of histone H4 at arginine facilitating transcriptional activation by nuclear hormone receptor Science 293: 853-857 Webb P, Nguyen P, Valentine C, Lopez GN, Kwok GR, McInerney E, Katzenellenbogen BS, Enmark E, Gustafsson JA, Nilsson S, Kushner PJ (1999) The estrogen receptor enhances AP-1 activity by two distinct mechanisms with different requirements for receptor transactivation functions Mol Endocrinol 13: 1672-1685 Welboren WJ, van Driel MA, Janssen-Megens EM, van Heeringen SJ, Sweep FC, Span PN, Stunnenberg HG (2009) ChIP-Seq of ERalpha and RNA polymerase II defines genes differentially responding to ligands EMBO J 28: 1418-1428 Wendt KS, Yoshida K, Itoh T, Bando M, Koch B, Schirghuber E, Tsutsumi S, Nagae G, Ishihara K, Mishiro T, Yahata K, Imamoto F, Aburatani H, Nakao M, Imamoto N, Maeshima K, Shirahige K, Peters JM (2008) Cohesin mediates transcriptional insulation by CCCTC-binding factor Nature 451: 796-801 Werling U, Schorle H (2002) Transcription factor gene AP-2 gamma essential for early murine development Mol Cell Biol 22: 3149-3156 Williams C, Edvardsson K, Lewandowski SA, Strom A, Gustafsson JA (2008) A genome-wide study of the repressive effects of estrogen receptor beta on estrogen receptor alpha signaling in breast cancer cells Oncogene 27: 1019-1032 Williams CM, Scibetta AG, Friedrich JK, Canosa M, Berlato C, Moss CH, Hurst HC (2009) AP-2gamma promotes proliferation in breast tumour cells by direct repression of the CDKN1A gene EMBO J 28: 3591-3601 Williams T, Tjian R (1991a) Analysis of the DNA-binding and activation properties of the human transcription factor AP-2 Genes Dev 5: 670-682 150 Williams T, Tjian R (1991b) Characterization of a dimerization motif in AP-2 and its function in heterologous DNA-binding proteins Science 251: 1067-1071 Wong PP, Miranda F, Chan KV, Berlato C, Hurst HC, Scibetta AG (2012) Histone Demethylase KDM5B Collaborates with TFAP2C and Myc To Repress the Cell Cycle Inhibitor p21cip (CDKN1A) Molecular and cellular biology 32: 1633-1644 Woodfield GW, Chen Y, Bair TB, Domann FE, Weigel RJ (2010) Identification of primary gene targets of TFAP2C in hormone responsive breast carcinoma cells Genes Chromosomes Cancer 49: 948-962 Woodfield GW, Hitchler MJ, Chen Y, Domann FE, Weigel RJ (2009) Interaction of TFAP2C with the estrogen receptor-alpha promoter is controlled by chromatin structure Clin Cancer Res 15: 3672-3679 Woodfield GW, Horan AD, Chen Y, Weigel RJ (2007) TFAP2C controls hormone response in breast cancer cells through multiple pathways of estrogen signaling Cancer Res 67: 8439-8443 Wu H, Chen Y, Liang J, Shi B, Wu G, Zhang Y, Wang D, Li R, Yi X, Zhang H, Sun L, Shang Y (2005) Hypomethylation-linked activation of PAX2 mediates tamoxifen-stimulated endometrial carcinogenesis Nature 438: 981-987 Xu H, Handoko L, Wei X, Ye C, Sheng J, Wei CL, Lin F, Sung WK (2010) A signal-noise model for significance analysis of ChIP-seq with negative control Bioinformatics 26: 1199-1204 Xu J, Qiu Y, DeMayo FJ, Tsai SY, Tsai MJ, O'Malley BW (1998) Partial hormone resistance in mice with disruption of the steroid receptor coactivator-1 (SRC-1) gene Science 279: 1922-1925 Xu W, Cho H, Kadam S, Banayo EM, Anderson S, Yates JR, 3rd, Emerson BM, Evans RM (2004) A methylation-mediator complex in hormone signaling Genes & development 18: 144-156 Yang XJ (2004) Lysine acetylation and the bromodomain: a new partnership for signaling Bioessays 26: 1076-1087 Yang Y, Cvekl A (2007) Large Maf Transcription Factors: Cousins of AP-1 Proteins and Important Regulators of Cellular Differentiation Einstein J Biol Med 23: 2-11 151 Zaret KS, Carroll JS (2011) Pioneer transcription factors: establishing competence for gene expression Genes Dev 25: 2227-2241 Zeng L, Zhang Q, Gerona-Navarro G, Moshkina N, Zhou MM (2008) Structural basis of site-specific histone recognition by the bromodomains of human coactivators PCAF and CBP/p300 Structure 16: 643-652 Zhang J, Brewer S, Huang J, Williams T (2003) Overexpression of transcription factor AP-2alpha suppresses mammary gland growth and morphogenesis Dev Biol 256: 127-145 Zhang J, Hagopian-Donaldson S, Serbedzija G, Elsemore J, Plehn-Dujowich D, McMahon AP, Flavell RA, Williams T (1996) Neural tube, skeletal and body wall defects in mice lacking transcription factor AP-2 Nature 381: 238-241 Zhang Y, Liang J, Li Y, Xuan C, Wang F, Wang D, Shi L, Zhang D, Shang Y (2010) CCCTC-binding factor acts upstream of FOXA1 and demarcates the genomic response to estrogen The Journal of biological chemistry 285: 2860428613 Zhang Z, Chang CW, Goh WL, Sung WK, Cheung E (2011) CENTDIST: discovery of co-associated factors by motif distribution Nucleic Acids Res 39: W391-399 Zhao Z, Tavoosidana G, Sjolinder M, Gondor A, Mariano P, Wang S, Kanduri C, Lezcano M, Sandhu KS, Singh U, Pant V, Tiwari V, Kurukuti S, Ohlsson R (2006) Circular chromosome conformation capture (4C) uncovers extensive networks of epigenetically regulated intra- and interchromosomal interactions Nat Genet 38: 1341-1347 152 APPENDIX I Cloning primers for reporter plasmids construction ERBS-1_F TGGCCTAACTGGCCGGTACCATCCACACATCCCTTCTGCT ERBS-1_R ATCCTCTAGACTCGAGGGAAAGGGAGAGGAGCGAGAT ERBS-2_F TGGCCTAACTGGCCGGTACCCCCCAACTAATTCCCTTGGT ERBS-2_R ATCCTCTAGACTCGAGGTCAGAGTGTGGATGCTTGGA ERBS-3_F TGGCCTAACTGGCCGGTACCGCAGAGCAGTGAGGCACAG ERBS-3_R ATCCTCTAGACTCGAGGGAGGGAGCCCTCATCTGAA ERBS-4_F TGGCCTAACTGGCCGGTACCCTAGGAGGGAAGGGGAGTTG ERBS-4_R ATCCTCTAGACTCGAGGAATGTCTGCCAGGAGAATGC ERBS-5_F TGGCCTAACTGGCCGGTACCGGATTGGCGCTGAGACAATG ERBS-5_R ATCCTCTAGACTCGAGCTGTAGGGCCACAGGTTCTC ERBS-6_F TGGCCTAACTGGCCGGTACCCTCGCCATCTGTGGAACTTT ERBS-6_R ATCCTCTAGACTCGAGGCCTGTAATGGCCTGAGGGTA *Sequences homologous to the desired insertion site of pGL4-TATA vector are highlighted in yellow **Nucleotides added to reconstruct KpnI and XhoI restriction sites are underlined Mutagenesis primers for reporter plasmids construction ERBS-1_EREmt ERBS-1_AP2mt CAAGGTGCGCGGAGCCCAGAGGGTGATTCAGCTTGC TGACGAG GAACCTCGAGGCCCTGAATTGCCTTGATATCCAGCTC CCAGGAAC TCCGGGACAACGCGAACAGGGGCTCTGGAC ERBS-6_AP2mt GTTGAGTCAGGGCCTGAATGGAACTTTTCCTGCCACC ERBS-6_EREmt *Mutated nucleotides are underlined 153 ChIP real-time quantitative PCR primers ERBS-1_F CCCTGAGGGCGCAGAGA ERBS-1_R GGGATGGCAAGGTTAGAAGCT ERBS-2_F GGAACAGACACCAGCATATCCA ERBS-2_R CCTCGGTTTCCCTTTCTTTGA ERBS-3_F GGCATAAGCTCTGTGCAAACAT ERBS-3_R CATTTCCATGGTGTTTTATTAAAGGA ERBS-4_F TGTTCTCTCCCTGCGAGTTGT ERBS-4_R GAAGGAGCGACGCAACCA ERBS-5_F AAGGAGTGGCTCCACAAAGTGT ERBS-5_R TGCAGCGGTGACCTTTCTG ERBS-6_F GCTGTCTCCAGGCCCAGTT ERBS-6_R TGAGGGTAGAGATTCCCACACA BCMO1_F TGTGTGAGGCCCGAGGTT BCMO1_R CCAGGTCCACAGTGCTTCCT BRIP1_F CAGGCATGCTTTCCAAACAA BRIP1_R TGCCTTGGGCCTTTTGC CELSR2_F GCCGAGCAGTTGGGAACA CELSR2_R GATGCGGAGGCAACTACCA FOS_F CCCGAACCACCCAAACCT FOS_R CCAAGGAGGCAAAGAGAGACA RARA_F GTACCCCGCAGGCAGTGT RARA_R GGATAAAGCCACTCCAAGGTAGGT 154 TH_F GCTGGCTGTGGCACAAGAT TH_R CGCAGGCAAGGTCAGGAT VASN_F TGACAGGTCAGGCCAGTCTTC VASN_R TGCCACGGCAGACAGGAT FAM129B_F CCCCTCAACCACAGTTAATGC FAM129B_R GACAGCGGAGAGCAGTCTCAGT CALML5_F GCACTGGCCAGGCTCTGA CALML5_R GGTCACTCATTGCGACCTGTT CST6_F TGGCCGGCATCAAGTACTTC CST6_R TGGTCTTGCGGCAGTCTGT Greb1 Enh_F GCTGGGTGCCCGTTTTG Greb1 Enh_R TCAGTCAGCAGTTTCGGTGAGT Greb1 Pro_F CACTGTGACCCAGCAAAACAC Greb1 Pro_R GGCAAATGCCACCGTTTC Control_F CCTGGAGGGCTTGGAGATG Control_R GATCCTACGGCTGGCTGTGA cDNA real-time quantitative PCR primers ERα_F GAATCTGCCAAGGAGACTCGC ERα _R ACTGGTTGGTGGCTGGACAC AP-2γ_F ACTGTCCCCACCTGAATGCT AP-2γ_R CGATTTGGCTCTTCTGAGAACA RET9_F CCGCTGGTGGACTGTAATAATG 155 RET9_R GTAAATGCATGGGAAATTCTACCAT RET51_F GAGCCCTCCCTTCCACATG RET51_R GGACTCTCTCCAGGCCAGTTC GREB1_F CAGGCTTTTGCACCGAATCT GREB1_R CAAAGCGTGTCGTCTTCAGCT E2F1_F AGATCCCAGCCAGTCTCTACTCA E2F1_R TGCCCATCCGGGACAA CDC6_F ACGTCTGGGCGATGACAAC CDC6_R TTGGTGGAGAACAAGGAGGTAAA GAPDH_F GGCCTCCAAGGAGTAAGACC GAPDH_R AGGGGAGATTCAGTGTGGTG 3C real-time quantitative PCR primers AB AACCCCGTGTGTCCTTCAG ATCAAACTGGAGGGAGCAGA B AACCCCGTGTGTCCTTCAG GAAAGGACAGAGAAGGTGCCAGTTG B AACCCCGTGTGTCCTTCAG E BF B D BE AACCCCGTGTGTCCTTCAG C BD CATGGGAGAAAGATGTAGTCTGGGAGAC B BC A GCCAGTGGAAGTGTAAGTTGG B AACCCCGTGTGTCCTTCAG F CATGTTGTCAGTGGGGGTTA 156 BG AGGGTGGGAAGAGGTGAC B AACCCCGTGTGTCCTTCAG ACCGTCACTTTCCCTGTGTT B AACCCCGTGTGTCCTTCAG CTAGGGGTGGTCACCTCAGC B CCGCGTCCTCTGTACTTGA K CATTCAGTGGCATCAACGTC I AACCCCGTGTGTCCTTCAG J IJ AACCCCGTGTGTCCTTCAG J BK B I BJ GGATGTAGTGGCACCAGCCATAGG H BI AACCCCGTGTGTCCTTCAG G BH B GGCCCTGATGACCTGTCCTTATTC siRNA sense sequences Dharmacon SiGenome Non-Targeting siRNA pool #1 (D-001206-13-50) N.A siERα 1st BASE Pte Ltd UCAUCGCAUUCCUUGCAAATT siAP-2γ (1) 1st BASE Pte Ltd GGUACUGAAGCUUUAUUUGTT siAP-2γ (2) Dharmacon ON-TARGETplus SMARTpool (L-005238-00) (1) CCGAUAAUGUCAAGUACGA (2) ACACUGGAGUCGCCGAAUA (3) GUAAACCAGUGGCAGAAUA (4) GGACAAGAUUGGGUUGAAU siFoxA1 Dharmacon ON-TARGETplus SMARTpool (L-010319-00) (1) GCACUGCAAUACUCGCCUU (2) CCUCGGAGCAGCAGCAUAA (3) GAACAGCUACUACGCAGAC (4) CCUAAACACUUCCUAGCUC 157 APPENDIX II Comparison of AP2GBS determined by different FDR cut-offs (0.002-0.05) Majority of AP2GBS are present before and after E2 stimulation 158 APPENDIX III Comparison of FOXA1BS determined by different FDR cut-offs (0.002-0.05) Majority of FOXA1BS are present before and after E2 stimulation 159 APPENDIX IV Comparison of ChIA-PET ERBS with AP2GBS and FoxA1BS determined by different FDR cut-offs (0.002-0.05) revealed a large co-localization of the three factors 160 APPENDIX V ERBS identified from ChIA-PET and ChIP-Seq are highly similar in their colocalization with AP-2γ and FoxA1 161 APPENDIX VI GO analysis performed on estrogen-regulated genes that are dependent on AP-2γ using the Ingenuity® System Enriched pathways from analysis of estrogenregulated genes independent of AP-2γ were used as the background control Top 10 biological processes are shown Threshold was set at p-value of 0.0001 162 ... Yong EL, Sung WK, Cheung E (20 11) AP- 2gamma regulates oestrogen receptor- mediated long- range chromatin interaction and gene transcription The EMBO journal 30: 25 69 -25 81 Chng KR, Chang CW, Tan... association of AP- 2? ? and FoxA1 with ERα -mediated long- range chromatin interactions 107 CHAPTER 4.1 4 .2 4.3 4.4 DISCUSSIONS 109 Exploring potential determinants of ERα -mediated long range transcriptional... mammals, five homologous members namely AP- 2? ?, AP- 2? ?, AP- 2? ?, AP- 2? ? and AP- 2? ? were identified, each encoded by separate genes (Eckert et al, 20 05; Pellikainen & Kosma, 20 07) This family of proteins shares