Estrogen receptor a mediated long rang chromatin interactions at the ret gene locus in breast cancer

ESTROGEN RECEPTOR α MEDIATED LONG RANGE CHROMATIN INTERACTIONS AT THE RET GENE LOCUS IN BREAST CANCER LIN ZHENHUA NATIONAL UNIVERSITY OF SINGAPORE 10 20 2010 Acknowledgement I would like to express my gratitude to all lab members in Cancer Biology and Pharmacology Lab 3 at the Genome Institute of Singapore. My sincere appreciation goes to Dr Edwin Cheung for his patience and guidance throughout the project. In addition I would like to thank Dr Ng Huck Hui for introducing me into DBS and his guidance during my course of study. My special thanks go to Dr Liu Mei Hui for her advice on the 3C assay and Ms Tan Si Kee for her assistance with the co-factor studies. Many thanks go to other members in my lab who has helped me in one way or another. Without the group in CB3, I will not be able to finish my project and thesis so smoothly. Table of Contents SUMMARY i LIST OF TABLES iii LIST OF FIGURES iv LIST OF ABBREVIATIONS vi Chapter 1 Background 1 1.1 Breast cancer and estrogen 1 1.1.1 Breast cancer and estrogen 1 1.1.2 Estrogen and its role in human physiology 2 1.1.3 Estrogen and the estrogen receptor 2 1.1.4 Molecular mechanism of the estrogen receptor 3 1.2 RET gene 4 1.2.1 RET and its isoforms 4 1.2.2 RET gene and its role in human physiology 6 1.3 Long range chromatin interactions 7 1.3.1 Estrogen receptor binding sites in breast cancer 7 1.3.2 Methods to study long range chromatin interactions 8 1.3.3 Long range chromatin interactions of the estrogen receptor 11 1.4 Aims and objectives of the study 12 Chapter 2 Material and Methods 13 2.1 Plasmids construction 13 2.1.1 PCR amplification 13 2.1.2 Homologous recombination 15 2.2 Mutagenesis 15 2.3 Cell culture, transfection and luciferase assays 18 2.3.1 Cell culture 18 2.3.2 Transient transfection and luciferase/renilla dual reporter assay 18 precipitation assay 2.4 Chromatin immuno immunoprecipitation 19 2.5 Chromosome conformation capture 22 2.5.1 3C assay 22 2.5.2 Primer design and qPCR 23 2.5.3 BAC control 25 2.6 RNA expression 26 2. 2.77 Protein expression 28 2.7.1 Total protein extraction 28 2.7.2 SDS-polyacrylamide gel electrophoresis 28 2.7.3 Western Blotting 29 2.8 siRNA knockdown 29 2.9 Evolutionary conservation analysis 30 Chapter 3 Results 31 3.1 The RET proto-oncogene is up-regulated by estrogen 31 3.1.1 RET mRNA and protein expression level is upregulated after E2 treatment 31 3.1.2 Effect of ERα knockdown on RET mRNA expression 35 3.1.3 The RET gene is a primary target of ERα 37 3.2 RET gene is regulated by E2 through two imperfect EREs 39 3.2.1 ERα binds to six estrogen receptor biding sites at the RET gene locus 39 3.2.2 Two of the six estrogen receptor binding sites are functional 42 3.2.3 Mutagenesis confirmed the function of EREs in these two estrogen receptor binding sites 44 α binding sites interact with the transcription start 3.3 Two ER ERα site 46 3.3.1 3C assay detected three E2 dependent long range chromatin interactions around the RET 3.3.2 Long range chromatin interactions at the RET gene requires ERα 46 50 3.4 Role of other co-factors in long range chromatin interactions around RET 52 3.4.1 Binding of other co-factors at the RET locus through ChIP 52 3.4.2 Mutagenesis of the co-factor motif decreased ERα enhancer ability 56 3.4.3 AP2γ is required for RET gene expression 58 3.4.4 Recruitment of ERα to the estrogen receptor binding sites of RET is 60 dependent on AP2γ 3.4.5 AP2γ affects ERα mediated long range chromatin interactions 3.5 Conservation of the RET gene gene’’s ERα binding sites 62 64 Chapter 4 Discussion 66 α mediated long range 4.1 RET is E2 regulated through ER ERα chromatin interactions 66 4.2 RET gene plays a functional role in human breast cancers 69 2γ functions as a pioneer factor for ER α response pathway 4.3 AP AP2 ERα 70 Chapter 5 Conclusion 72 References 73 SUMMARY Estrogens function as the primary female sex hormones in women of reproductive age. It promotes the development of female secondary sexual characteristics, and is an essential part of a woman’s reproductive process. Recent studies indicate that about 80% of breast cancers, once established, are estrogen dependent. These are known as hormone-sensitive or hormone-receptor-positive cancers. ERα is the key transcription regulator of this breast cancer progression. It is over-expressed in around 70% of breast cancer cases and estrogen has been shown to stimulate proliferation of mammary cells. Using high-throughput ChIP (Chromatin ImmunoPrecipitation)-based technology, such as ChIP-Seq (ChIP process followed by sequencing), we generated a global map of ERα binding sites in the genome of MCF7 breast cancer cell line. From this dataset, we identified two ERα binding sites near the RET (rearrangement during transfection) gene. RET is a proto-oncogene that encodes a receptor tyrosine kinase. It has been shown to be involved in human papillary thyroid tumors and in multiple endocrine neoplasia type 2. Previous studies have shown the RET gene is expressed in primary breast tumors and cell lines. In MCF7 cells, the expression of RET, the activation of its downstream signaling pathways, and the increase of anchor-independent proliferation have been shown to be estrogen dependent. In addition, RET expression is up-regulated by estrogen treatment and knock down of ERα down-regulates RET. i We verified that two ERα binding sites within the RET locus, which are located 50kb upstream and 35kb downstream of the transcription start site, are recruited upon estrogen stimuli. Using Chromosome Conformation Capture assay, we showed that these two ERα binding sites are brought in close proximity with each other and with the promoter region of the RET gene in an estrogen dependent manner. Knock down of ERα disrupted this long-range interaction. In addition, we showed that co-regulatory factors, such as FoxA1, cJun, and AP2γ are recruited to these two ERα binding sites. Among them, AP2γ knock-down resulted in a decrease of RET expression and a concomitant decrease in long range chromatin interaction. Taken together, these results suggest that ERα collaborates with other DNA binding transcription factors to form chromatin loops which directly regulate the transcription of the RET gene in breast cancer cells. ii LIST OF TABLES Table 1: Primer sets used to amplify the 6 ERBSs. 14 Table 2: Primers used to introduce mutations into transcription factor binding motif. 17 Table 3: Primer sets used to detect the 6 ERBSs. 21 Table 4: Primer sets used for the 3C assay. 24 Table 5: Primer sets used to detect mRNA expression level. 27 Table 6: Revolutionary conservation analysis of three ERE sites around RET gene. 65 iii LIST OF FIGURES Fig 1: RET mRNA expression levels with E2 treatment in MCF7 cells. 32 Fig 2: RET51 protein expression level with E2 treatment in MCF7 cells. 34 Fig 3: ERα, RET9 and RET51 mRNA expression level after ERα siRNA 36 knockdown. Fig 4: RET9 and RET51 mRNA expression level with cycloheximide treatment. 38 Fig 5: ERBSs of the RET gene locus. 40 Fig 6: Recruitment of ERα at six ERBSs of the RET gene locus. 41 Fig 7: Functional analysis of the 6 ERBS through transient transfection. 43 Fig 8: Mutation analysis of ERBS 1 and ERBS 6 through transfection. 45 Fig 9: Overview of ERBS location and primers designed for 3C assay. 48 Fig 10: Long range chromatin interaction at the RET gene locus through 3C. 49 Fig 11: Long range chromatin interaction at the RET gene locus after ERα siRNA 51 knockdown. Fig 12: Prediction of other co-factor at ERBS 1 and ERBS 6 through motif 53 analysis. Fig 13: cJun and FoxA1 binding at the RET locus. 54 Fig 14: AP2γ binding at the RET locus. 55 Fig 15: Mutation analysis of ERBS with co-factor motif mutations. 57 Fig 16: Protein and mRNA expression of RET after AP2γ siRNA knockdown. 59 Fig 17: ERα binding at the RET locus after AP2γ knockdown. 61 Fig 18: Long range chromatin interaction at the RET gene locus after AP2γ siRNA knockdown. 63 iv Fig 19: Overview of ChIA-PET interaction around the RET gene locus. 68 v LIST OF ABBREVIATIONS 3C: Chromosome Conformation Capture 3D: Deconvolution of DNA interaction by DNA selection and ligation BAC: Bacterial Artificial Chromosome ChIA-PET: Chromatin Interaction Analysis by Paired-End Tag ChIP: Chromatin Immunoprecipitation ChIP-Seq: ChIP process followed by sequencing CHX: Cycloheximide E2: Estradiol ER: Estrogen Receptor ERBS: Estrogen Receptor Binding Site ERE: Estrogen Response Element GDNF: Glial cell line-Derived Neurotrophic Factor PCR: Polymerase Chain Reaction RET: Rearrangement during Transfection RLU: Relative Luciferase Unit TSS: Transcription Start Site vi Chapter 1 Background 1.1 Breast Cancer and Estrogen 1.1.1 Breast cancer and estrogen Breast cancer is the second ranking cancer worldwide and it is the fifth most common cause of cancer death (Breast Cancer Facts & Figures 2009-2010, American Cancer Society, Atlanta, Georgia). With decades of molecular pathology research and clinical trials, breast cancer is also one of the most well studied cancer types now and its survival rate after therapy is increasing (Wooster and Weber 2003). Established breast cancer cell lines, such as MCF7, is now a common model for the study of breast cancer. Based on the dependency of hormones, breast cancers can be generally divided into two groups, hormone-sensitive and hormone-insensitive breast cancers. The first group, which constitutes about 80% of all breast cancers, is also known as hormone-receptor-positive breast cancers. Such cancers, once established, rely on the hormone estrogen to grow (Perou, Sorlie et al. 2000; Sorlie, Perou et al. 2001; van de Vijver, He et al. 2002; Yager and Davidson 2006; Sadler, Pugazhendhi et al. 2009). 1 1.1.2 Estrogen and its role in human physiology Estrogens (or oestrogens) are a group of steroid compounds, named for their importance in the estrous cycle (Nelson and Bulun 2001; DeNardo, Kim et al. 2005). Estrogen functions as the primary female sex hormone. There are three major naturally occurring estrogens in women: estrone (E1), estradiol (E2), and estriol (E3) (Dahlman-Wright, Cavailles et al. 2006). Even though estrogens are present in both men and women, they are usually present at significantly higher levels in women of reproductive age. They promote the development of female secondary sexual characteristics, such as breasts, and are also involved in the thickening of the endometrium and in the regulation of the menstrual cycle (Yager and Davidson 2006). In males, estrogen regulates specific functions of the reproductive system that are important in the maturation of sperm and may be necessary for a healthy libido (Hess, Bunick et al. 1997). 1.1.3 Estrogen and the estrogen receptor Estrogen functions through binding to the estrogen receptors. The estrogen receptor (ER) belongs to a subfamily of the nuclear receptor superfamily (Nilsson, Makela et al. 2001). There are two isoforms of the ER, ERα and ERβ, and each is encoded by a separate gene, ESR1 and ESR2, respectively (Leung, Mak et al. 2006). Despite this, ERα and ERβ show significant overall sequence homology (Ascenzi, Bocedi et al. 2 2006). Like other members of the nuclear receptor superfamily, the ERs have three major domains, the Activation Function domain, the DNA Binding Domain and the Ligand Binding Domain (Shiau, Barstad et al. 1998). After estrogen activation, the estrogen receptors may form 3 different dimers, ERα or ERβ homodimers or ERαβ heterodimers (Couse, Lindzey et al. 1997; Li, Huang et al. 2004). Across various cell types, the ERα homodimer is the most common one and is over-expressed in 70% of breast cancer cases (Deroo and Korach 2006). Estrogen activates ERα and stimulate the proliferation of mammary cells (Fabian and Kimler 2005). Indeed, ERα has been shown to regulate important cell cycle genes, such as Cyclin D1 and DNA methylation genes, such as O-6-methylguanine-DNA methyltransferase (Metivier, Penot et al. 2003; Bjornstrom and Sjoberg 2005; Levin 2005). 1.1.4 Molecular mechanism of the estrogen receptor In the classical model, ERs are activated through ligand binding. Binding of estrogen to the receptors leads to homodimerization. The homodimers subsequently bind to specific response elements known as estrogen response elements (EREs) located in the promoters of the target genes to assist transcription (Nilsson, Makela et al. 2001). Estrogen binding also induces conformational changes within the ligand binding domain of the ERs, and this change allows coactivator proteins to be recruited 3 (Rosenfeld and Glass 2001). In total, one third of the genes in humans that are regulated by ERs can be activated in this ERE-dependent manner (O'Lone, Frith et al. 2004). Besides this classical model, ERs can regulate gene expression without binding directly to DNA by modulating the function of other transcription factors through protein-protein interactions (Gottlicher, Heck et al. 1998). Several genes are activated by E2 through the interaction of ERs with cJun and cFos proteins at AP-1 binding sites within the promoter of genes such as IGF-I (Umayahara, Kawamori et al. 1994) and cyclin D1 (Sabbah, Courilleau et al. 1999; Liu, Albanese et al. 2002). Besides AP-1 binding sites, ERs also regulate GC-rich promoter regions with the Sp1 transcription factor (Porter, Saville et al. 1997; Li, Briggs et al. 2001). These ERE-independent actions mainly rely on the tethering of ERs to other DNA binding transcription factors so as to enhance ER transcriptional regulation (Bjornstrom and Sjoberg 2005). 1.2 RET Gene 1.2.1 RET and its isoforms RET proto-oncogene was named because of its Rearrangement during Transfection (Takahashi, Ritz et al. 1985). The DNA sequence of this gene was originally found 4 to be rearranged within 3T3 fibroblast cell line following its transfection with DNA taken from human lymphoma cells. In human, RET gene is located in chromosome 10 (10q11.2) and contains 21 exons (Takahashi 1988; Takahashi, Buma et al. 1988; Ishizaka, Itoh et al. 1989). The RET gene encodes a receptor tyrosine kinase (RTK) which belongs to the glial cell line-derived neurotrophic factor (GDNF) family of extracellular signaling molecules (Durbec, Marcos-Gutierrez et al. 1996; Trupp, Arenas et al. 1996; Baloh, Tansey et al. 1998). Alternative splicing results in 3 different isoforms of RET, RET9, RET43 and RET51, based on the 9, 43 and 51 amino acids in their C-terminal tail respectively (Tahira, Ishizaka et al. 1990; Myers, Eng et al. 1995; de Graaff, Srinivas et al. 2001). RET43 is seldom found in human (Myers, Eng et al. 1995). The RET protein is divided into 3 domains. In the N-terminal extracellular domain there are four cadherin-like repeats and a cysteine-rich region. The hydrophobic transmembrane domain and the cytoplasmic tyrosine kinase domain are separated by an insertion of 27 amino acids. Within their cytoplasmic domains, there are 16 tyrosines (Tyr) in RET9 and 18 tyrosines in RET51 (Hayashi, Iwashita et al. 2001; Kurokawa, Iwashita et al. 2001). Tyr1090 and Tyr1096 are unique for RET51 (Knauf, Kuroda et al. 2003; Kawamoto, Takeda et al. 2004). 5 1.2.2 RET gene and its role in human physiology Mice deficient in GDNF, GFRα1 or the RET protein exhibit severe defects in kidney and enteric nervous system development (Trupp, Scott et al. 1999; Lee, Chan et al. 2002). This implicates that RET signal transduction is a key pathway in the development of normal kidneys and the enteric nervous system. RET loss of function mutations are associated with the development of Hirschsprung's disease, while gain of function mutations are associated with the development of various types of human cancer, including medullar thyroid carcinoma, multiple endocrine neoplasias type 2A and 2B, phaeochromocytoma and parathyroid tumors (Ishizaka, Itoh et al. 1989; Donis-Keller, Dou et al. 1993; Mulligan, Kwok et al. 1993; Edery, Lyonnet et al. 1994; Hofstra, Landsvater et al. 1994; Romeo, Ronchetto et al. 1994; Eng 1999). Recently researchers have also demonstrated the role of RET in tumors progression from non-neuroendocrine origin. Furthermore, detection of RET mutations in pancreatic cancer and the over expression of genes in the RET RTK pathway in breast tumor cell lines suggest that RET have important roles in the regulation of cancer growth and progression (Hayashi, Ichihara et al. 2000; Dechant 2002; Tsui-Pierchala, Milbrandt et al. 2002; Sawai, Okada et al. 2005; Zeng, Cheng et al. 2008). 6 1.3 Long Range Chromatin Interactions 1.3.1 Estrogen receptor binding sites in breast cancer The human genome is comprised of 23 pairs of chromosome with a total of 3 billion base pairs (Lander, Linton et al. 2001; Venter, Adams et al. 2001). However, only 1.5% of the genome encodes for about 23,000 of all protein-coding genes. Within the non-coding sequences, there are many different kinds of regulatory elements which provide crucial control of gene expression. These elements include insulators, boundary elements and transcription factor binding sites (Maston, Evans et al. 2006). One of the important functions of these regulatory elements is their role as recruitment sites for protein factor to carry out their regulatory functions (West and Fraser 2005). Chromatin Immunoprecipitation (ChIP) is widely used to detect such protein-DNA interactions and ChIP-Seq provides us with the tools to map the position of these regulatory sites across the genome (Kuo and Allis 1999). For example, traditional ChIP assay using a specific antibody against ER isolates chromatin fragments bound by the receptor. By performing traditional or quantitative PCR with specific primers, estrogen receptors binding at specific locations in the genome can be easily detected. By coupling ChIP with massive sequencing technology, the whole pool of estrogen binding fragments can be sequenced and mapped back to the human genome revealing the exact positions of estrogen receptor binding site (ERBS). In 7 addition, ChIP-Seq also contains information on the density or strength of receptor binding. Based on such technology, numerous binding maps of important transcription factors have been generated, including p53, Oct4 and Nanog (Loh, Wu et al. 2006; Wei, Wu et al. 2006). For the estrogen receptor, at least five genome-wide maps of ERα binding in MCF7 cells have been generated beside numerous other partial maps based on chromosomes, promoters or custom loci (Cheung and Kraus, 2009). Based on the different technique, 8,525 ERα binding sites were detected by ChIP-chip (Hurtado, Holmes et al. 2008), 10,205 sites by ChIP-Seq (Welboren, van Driel et al. 2009) and 1,234 sites by ChIP-PET in estradiol-stimulated MCF7 cells (Lin, Vega et al. 2007). Surprisingly, only a small portion of these binding sites were found in the proximal promoter region of genes while the majority were distributed across the genome, mostly in the region around 5-100 kb from the 5’- and 3’- ends of the adjacent transcripts. Such binding characteristics were also observed in other transcription factor and in other cell lines. This suggests that such transcription factors may regulate transcription through long-range chromatin interactions. 1.3.2 Methods to study long range chromatin interactions Chromosome Conformation Capture (3C) is the most widely used method to study long range chromatin interactions across the genome (Dekker, Rippe et al. 2002). The 8 main concept behind the 3C technique is based on the “proximity ligation” concept of the Nuclear Ligation Assay (Cullen, Kladde et al. 1993). In the 3C assay, the chromatin is cross-linked with formaldehyde in the same way as in the ChIP assay and digested by a restriction enzyme. The sticky ends of the fragments are ligated to each other according to their spatial distances. Hence, fragments in close proximity are more likely to ligate at a higher frequency. A classic example of this long-range chromatin interaction is between the ß-globin locus and locus control regions in mammalian cells (Tolhuis, Palstra et al. 2002). Although 3C is a powerful technique, it does have several limitations (Fullwood and Ruan 2009). First and most important of all, 3C experiments have high noise levels. Consequently, 3C analysis relies on a set of control experiments to distinguish real signals from noise, which makes 3C assay laborious and tedious (Dekker, Rippe et al. 2002). In addition, 3C methods are limited to single point interactions of previously known or hypothesized interaction sites. In order to overcome these disadvantages, several groups have developed new techniques based on the principles of 3C (Simonis, Kooren et al. 2007), these include 3D (Hu, Kwon et al. 2008), Associated Chromatin Trap (ACT) (Ling, Li et al. 2006), Chromosome Conformation Capture using Chip (4C) (Simonis, Klous et al. 2006), Circular Chromosome Conformation Capture (also called 4C) (Zhao, Tavoosidana et al. 2006), Open-ended Chromosome Conformation Capture (Wurtele and Chartrand 2006) and Chromosome Conformation Capture Carbon Copy (5C) (Dostie, Richmond et al. 2006). Notably, 3D improves the 9 sensitivity of detection with DNA capture by using a specific biotinylated oligonucleotide followed by DNA selection and ligation. This additional step detects co-captured DNA fragments in a high-throughput and unbiased fashion, which in turn, enhances the ability to detect long range chromatin interactions (Hu, Kwon et al. 2008). These new techniques provide new capabilities to detect long range chromatin interactions, but are still constrained by their ability to provide a genome-wide view. The development of highly efficient, low noise, genome-wide, and de novo method to detect the long range interactions remains a challenge (Fullwood and Ruan 2009). Recently a new strategy, chromatin interaction analysis by paired-end tag sequencing (ChIA-PET), was designed to detect the global chromatin interactions (Fullwood, Liu et al. 2009). In ChIA-PET, the long-range chromatin interactions are captured by cross-linking with formaldehyde. The sonicated DNA-protein fragments are enriched by ChIP process, followed by adding linkers and proximity ligation. The paired-end tags are extracted, purified and sequenced. The sequencing results are mapped to the reference genome to reveal the chromosome regions that are brought into close spatial proximity through chromatin looping. This unbiased whole-genome approach has greatly advanced our ability to study higher order organization of chromosomal structures and functions (Fullwood, Liu et al. 2009). 10 1.3.3 Long range chromatin interactions of the estrogen receptor Long range chromatin interactions mediated by the estrogen receptor of selected genes has been reported by others. Using mainly 3C or 3C followed by ChIP, long range chromatin interaction of distal ERα binding region and the proximal promoter region has been reported for key E2 regulated genes such as TFF1 (Carroll, Liu et al. 2005; Pan, Wansa et al. 2008) and GREB1 (Deschenes, Bourdeau et al. 2007). Long range chromatin interaction of the ERα binding site (144 kb upstream) with the promoter of the NRIP-1 gene (Carroll, Liu et al. 2005), a ~ 6 kb upstream ERα enhancer and the promoter of the CA12 gene (Barnett, Sheng et al. 2008) and a ~9 kb upstream enhancer and the promoter of CTSD gene (Bretschneider, Sara et al. 2008) were also reported to be mediated by ERα. Another recent example on ERα mediated chromatin loop formed between the ERα binding site within the ERBB2 intron and the ERBB2 promoter (Hurtado, Holmes et al. 2008), suggested that binding sites within introns also contribute to long range chromatin interaction. With the recently developed 3D assay, the first interchromosomal interaction between the distal ERα binding sites of TFF1 (on chromosome 2) and the proximal ERα binding sites of GREB1 (on chromosome 21) were detected (Hu, Kwon et al. 2008). Due to the dependence on ligand activated ERα, these recent data indicates a key role of ERα in the mediation of long range chromatin interactions. 11 Using the ChIA-PET assay, a genome-wide chromatin interaction network mediated by ERα was comprehensively mapped in MCF7 cells (Fullwood, Liu et al. 2009). In all by 1,451 ERα mediated intrachromosomal and 15 ERα mediated interchromosomal long range interactions were reported. These interactions were mostly anchored from distal ERα binding sites to gene promoters and suggest that transcription regulation by distal ERα binding sites primarily function through long range chromatin interaction. Data from the ERα ChIA-PET study has provided a valuable starting point for future studies on the function of these distal enhancers and the relevant genes that they target. 1.4 Aims and objectives of the study Comparing the microassay results of the E2 regulation genes with the ChIP-Seq database, we detect a serial of ERBSs around the possible E2 regulated genes. From the ChIA-PET data, we are able to build a possible link between the distal ERBSs with the target genes. This study narrows down to a specific E2 regulated gene, RET, to investigate the estrogen regulation pattern and the corresponding ERα binding affinity. More importantly, this study aims to investigate the possible long range chromatin interactions around this target gene, which could be another solid example to accomplish the ERα conducted chromatin interaction network. Besides, we also intend to investigate whether the co-factors of ERα, like cJun, FoxA1, etc, have functions in the ERα conducted chromatin looping. 12 Chapter 2 Material and Methods 2.1 Plasmids construction 2.1.1 PCR amplification Polymerase chain reaction (PCR) is a technique to amplify a single or few copies of a piece of DNA across several orders of magnitude, generating millions or more copies of a particular DNA sequence. Standard PCR was performed in a 25 µl reaction using PTC-100TM peltier thermal cycler (Biorad, USA), Geneamp PCR system 9700 (Applied Biosystems, USA). A PCR reaction included 2.5 μl 10×PCR buffer, 1.5 μl 25 mM MgCl2, 0.5μl of 10 mM dNTP mix, 1 μl cDNA (from first-strand reaction), 1μl amplification primer 1, 1 μl amplification primer 2, 0.2 μl Taq DNA polymerase (5 unit/μl), and 17.3 μl autoclaved, distilled water. The parameters for standard PCR consists of first denaturation at 94°C for 3 minutes, followed by 35 cycles of amplification process including denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds and extension at 72°C for 1 minute and a final extension at 72°C for 10 minutes. PCR primers used to amplify the ERBSs are indicated in Table 1. 13 Forward Reverse ERBS 1 ATCCACACATCCCTTCTGCT GGAAAGGGAGAGGAGCGAGAT ERBS 2 CCCCAACTAATTCCCTTGGT GTCAGAGTGTGGATGCTTGGA ERBS 3 GCAGAGCAGTGAGGCACAG GGAGGGAGCCCTCATCTGAA ERBS 4 CTAGGAGGGAAGGGGAGTTG GAATGTCTGCCAGGAGAATGC ERBS 5 GGATTGGCGCTGAGACAATG CTGTAGGGCCACAGGTTCTC ERBS 6 CTCGCCATCTGTGGAACTTT GCCTGTAATGGCCTGAGGGTA Table 1: Primer sets used to amplify the 6 ERBSs. 14 2.1.2 Homologous recombination The In-Fusion 2.0 PCR Cloning Kits (Clontech, USA) are designed to join multiple pieces of DNA which have 15 base pairs of homology at their linear ends. During the PCR process, the PCR primers have at least 15 bases of homology with sequences flanking the desired site of insertion in the cloning vector. In general, 100 ng of the linearized vector with 2 times of PCR fragment were added into one reaction of the kit and the final volume was adjusted to 10 μl using deionized H2O. The reactions were incubated for 15 min at 37℃ followed by 15 min at 50℃ and then transferred to ice. Then the reaction mixture were diluted with 40 μl TE buffer (pH=8) and mixed well. The products can be directly used for transformation or stored at -20℃. 2.2 Mutagenesis The QuickChange Lightning Multi Site-Directed Mutagenesis Kit (Stratagene) can be used to introduce multiple site mutations into the sequences we want. Primers may be designed to bind to adjacent sequences or to well-separated regions on the same strand of the template plasmid, with the desiring changes to introduce the mutations. Primers are between 25 and 45 bases in length, with a melting temperature (Tm) greater than 75°C. The estimated Tm is calculated based on the following formula: The desired point mutation or degenerate codon is designed close to the middle of the 15 primer with ~10–15 bases of template/complementary sequence on both sides. Optimum primers have a minimum GC content of 40% and terminate in one or more C or G bases at the 3’-end. The primers used in mutagenesis process are listed here in Table 2. The following procedures were carried out according to the manufacture’s recommendation. 16 ERE in ERBS 1 CAAGGTGCGCGGAGCCCAGAGGGTGATTCAGCTTGCTGACGAG ERE in ERBS 6 GAACCTCGAGGCCCTGAATTGCCTTGATATCCAGCTCCCAGGAAC AP2γ in ERBS 1 TCCGGGACAACGCGAACAGGGGCTCTGGAC AP1 in ERBS 1 GCAGGTGAGACTGGCAAAGTTTGACCTGCTGCCGG AP4 in ERBS 1 CTGAGTCAGACAAGCAACCGGGGCAGACGCAGGACAAGG FoxA1 in ERBS 1 TCACCACGGTAATGCTGTATTGGGGCCTGGCACCATCACC AP1 in ERBS 6 GCGGCTTTGTTGTCAAAGTTTGGGAGGAAAGGGGAGTAAAGG AP2γ in ERBS 6 GTTGAGTCAGGGCCTGAATGGAACTTTTCCTGCCACC AP4 in ERBS 6 GCTCCCAGGAACAGGGGTTGCAAGTAACATGTGG FoxA1 in ERBS 6 GAAAGGGGAGTAAACCGTTGAAACAGGGCCTGCCTGGG Table 2: Primers used to introduce mutations into transcription factor binding motif. 17 2.3 Cell Culture, Transfection and Luciferase Assays 2.3.1 Cell culture Early passage MCF7 cells (ATCC, Virginia) were cultured in DMEM, containing 5% Fetal Bovine Serum (Gibco, Invitrogen, California) with 50000U of penicillin/streptomycin (Gibco, Invitrogen, California) and 15 mg of gentamycin (Gibco, Invitrogen, California), at 37°C and 5% CO2. The cells were PBS washed twice, trypsinised by 1 ml trypsin (Gibco, Invitrogen, California) and incubated at 37°C for approximately 3 min. the cells were then washed from the surface of the flask with 3 ml of the passage medium and then pipette up and down repeatedly to obtain single cell suspension. The MCF7 cells were then subcultured at 1:2 ratio where 2 ml of cells were added to 8ml of MCF7 passage medium to new flasks. Before the estrogen stimulation, the MCF7 cells were transferred into serum starve medium (containing 5% CD-FBS with penicillin, streptomycin and gentamycin in phenol red-free DMEM/F-12 medium) for at least 72 hours. 2.3.2 Transient transfection and luciferase/renilla dual reporter assay MCF7 cells were seeded into 24 wells plates at around 70% confluence in starving medium for 3 days. Then 250 ng of the plasmid constructs, with 5 ng of the renilla plasmids were incubated with 0.75 µl Lipofectamine 2000 (Invitrogen) for 20 min 18 before adding into the corresponding wells. Each plasmid constructs were transfected in 6 individual wells. 8 hours later, estrogen (E2) or ethanol (EtOH) were added to a final concentration of 100 nM for 3 of the 6 wells. Cells were harvested 24 hour post drug treatment. Then the samples were processed to the luciferase/renilla dual reporter assay (Promega) using TriStar LB 941 machine (Berthold Technologies). precipitation assay 2.4 Chromatin immuno immunoprecipitation Following the indicated time of drug treatment (usually 45 min of 100 nM estrogen or vehicle), MCF7 cells were cross-linked with 1% formaldehyde (Sigma-Aldrich, Missouri) at room temperature for 10 min, then stopped with 125 mM glycine for 5 min, with slow rotation. Cells were washed by PBS twice, collected, and resuspended in lysis buffer with 1× protease inhibitor cocktail (Roche), and sonicated for 8-10 min in a Biorupter (Diagenode) to generate DNA fragments with an average of 500 bp. The supernatant was diluted 5-fold by dilution buffer, pre-cleared with Protein-A Sepharose beads, and immunoprecipitated with specific antibody. Precipitates were washed with 1 ml of washing buffer, then the chromatin complexes were incubated at room temperature with elution buffer. After de-crosslinking by incubating at 65 ℃ overnight, the ChIP DNA was purified using QIAquick columns (QIAGEN, California) and then forward to quantitative real time PCR analyses with SYBR green master mix kit (Applied Biosystems, California) on the ABI PRISM 7900 Sequence Detection System(Applied Biosystems, California). For each reaction, 5 µl of the 2 × 19 SYBR green master mixes was used with 2 µl of the ChIP material and 3 µl of the corresponding primer sets to make a 10 µl real-time PCR system. Primers were designed to detect specific genomic loci using Primer Express 3 or Primer 3 online (http://frodo.wi.mit.edu/primer3/). The primers used to detect the ERBSs from ChIP samples are listed in Table 3. 20 Forward Primer Reverse Primer ERBS 1 CCCTGAGGGCGCAGAGA GGGATGGCAAGGTTAGAAGCT ERBS 2 GGAACAGACACCAGCATATCCA CCTCGGTTTCCCTTTCTTTGA ERBS 3 GGCATAAGCTCTGTGCAAACAT CATTTCCATGGTGTTTTATTAAAGGA ERBS 4 TGTTCTCTCCCTGCGAGTTGT GAAGGAGCGACGCAACCA ERBS 5 AAGGAGTGGCTCCACAAAGTGT TGCAGCGGTGACCTTTCTG ERBS 6 CCCCCCTAGATCGGGAAAG ACGTTGATGCCACTGAATGC Table 3: Primer sets used to detect the 6 ERBSs. 21 2.5 Capture of Chromosome Conformation 2.5.1 3C assay MCF7 cells were grown in the same way as preparing for ChIP assays above and treated with the 100 nM indicated ligand or vehicle for 45 min prior to fixation in 1% formaldehyde (Sigma-Aldrich, Missouri) for 10 min. Following that 125 mM glycine was added to stop the cross-linking. Cells were washed by PBS twice and then harvest into 15 ml falcon tubes. Cells were lysed in 5 ml cold lysis buffer (0.25% Triton X-100, 10 mM EDTA, 10 mM Tris­HCl, pH=8.1, 100 mM NaCl and 1× protease inhibitors) at 4 ℃ for 20 min with slow rotation. Released nuclei were collected by centrifuge at 3,000g for 10 min then re-suspended in 1× enzyme buffer with 0.3% SDS and 1.8% Triton-X. Chromatin was digested by BtgI (New England Biolabs)or XhoII (Fermentas) overnight at 37℃ while rotating. Samples were heated to 65℃ to deactivate the enzyme and then ligation buffer and T4 ligase (New England Biolabs) were added into the samples. Samples were incubated in 16℃ for at least 4 hours, then at room temperature for 1 hour, followed by 65℃ de-crosslinking overnight. 7 ml of phenol-chloroform was added into the tube and mixed vigorously by vortexing for 30 sec. The samples were centrifuged at 2,200g for 15 min at 4 ℃ . The supernatants were transferred into a new 50 ml tube and 7 ml of distilled water, 1.5 ml of 2M sodium acetate (pH=5.6) with 35 ml of ethanol were added. After mixing the tubes were placed at -80 ℃ for approximately 1 hour. Then the mixture were 22 centrifuge at 2,200g at 4 ℃ for 45 min. The DNA samples were collected at the bottom of the tube. Samples were washed by 10 ml of 70% ethanol then dissolved in 200 µl TE buffer (10mM Tris-Cl, 1 mM EDTA, pH=7.5). 2.5.2 Primer design and qPCR The ligated DNA samples were purified again using QIAquick columns (QIAGEN) before processing to the PCR amplification. For each reaction, 5 µl of the 2× SYBR green master mix (Applied Biosystems, California) was used with 3 µl of the ligated DNA material and 2 µl of the corresponding primer sets to make a 10 µl real-time PCR system. Quantitative real time PCR analyses were carried out on the ABI PRISM 7900 Sequence Detection System (Applied Biosystems, California). The primers were designed based on the targeting genomic region and the corresponding restriction enzyme digestion sites. The suitable primers were positioned around 50-80 bps upstream the digestion sites, which made the PCR product at around 100-150 bps. Primers used in the 3C-qPCR process are listed in Table 4. 23 AB BC BD BE BF BG BH BI BJ BK IJ A CATGGGAGAAAGATGTAGTCTGGGAGAC B CTCTTTCGGGACACAGCATCATAATC B CTCTTTCGGGACACAGCATCATAATC C GAAAGGACAGAGAAGGTGCCAGTTG B TTCGGGACACAGCATCATAA D ATCAAACTGGAGGGAGCAGA B TCAGACAGTGCCAGTGGAAG E GCCAGTGGAAGTGTAAGTTGG B TCGGGACACAGCATCATAA F GACACTGACAGGATTTACCATACTGTTGG B TCGGGACACAGCATCATAA G GGTCAAGTGTTCCCGTGATCCTACTG B TCGGGACACAGCATCATAA H CACAGGGAAATGCAGCACAGCTAG B AACCCCGTGTGTCCTTCAG I ACCGTCACTTTCCCTGTGTT B AACCCCGTGTGTCCTTCAG J CTGCCTAGAGGTCTGCTGGT B CTCTTTCGGGACACAGCATCATAATC K GGCCCTGATGACCTGTCCTTATTC I ACCGTCACTTTCCCTGTGTT J CATTCAGTGGCATCAACGTC Table 4: Primer sets used for the 3C assay. 24 2.5.3 BAC control The control of the 3C PCR process was generated in BAC (Bacterial Artificial Chromosome) covering the same region as RET position. Single colony of BAC cloning RP11-669H9 (Invitrogen) was amplified in 50 ml LB medium with chloramphenicol at 37 ℃ overnight. Then the BAC DNA was purified using NucleoBond® BAC 100 kit (Macherey-Nagel). The bacteria was harvested from LB culture by centrifugation at 4,500g for 15 min at 4℃. Then the pellet of bacterial cells was resuspended in 24 ml Buffer S1 with RNase A. Then 24 ml of Buffer S2 was added to the suspension. The mixture was inverted several times and was incubated for 5 min. Following that, 24 ml of pre-cooled Buffer S3 (4 ℃ ) was added to the suspension and the lysate was mixed several times to get a homogeneous suspension. Then the suspension was centrifuged at 12,000g for 40 min at 4 ℃ . Then the supernatant was filtered by a NucleoBond® Fold Filter. The cleared lysate was loaded onto the NucleoBond® column to allow the DNA to bind. Following that the column was washed twice by 18 ml Buffer N3, then eluted with 15 ml Buffer N5. 11 ml of room-temperature isopropanol was added into the solutions and processed to centrifuge at 15,000g for 30 min at 4℃. After discarding the supernatant, 5 ml of the 70% ethanol was added to wash the pellet. The samples were centrifuged again at 15,000g for 10 min then carefully discard the ethanol. The DNA pellet was reconstituted in 200 µl buffer TE (10 mM Tris-Cl, 1 mM EDTA, pH=7.5). 25 1 µg of the BAC DNA was processed for digestion and ligation. 1 µg of the BAC DNA was mixed with 4 µl of the 10 × restriction enzyme buffer and 2 µl of the appropriate restriction enzyme in a 40 µl digestion system. The mixture was incubated at 37℃ overnight. Then 5 µl of the 10× ligation buffer and 5 µl of the ligase was added into the tube to ligate the fragments. The tube was incubated at 16 ℃ for 4 hours then left at room temperature for 1 hour. The ligation products were purified using QIAquick columns (QIAGEN) then precede to real-time PCR. 2.6 RNA expression RNA was purified using Invitrogen’s RNA purification kit and converted to cDNA using MMLV Reverse Transcriptase (Promega). Quantitative real-time PCR analyses was carried out using SYBR green master mix kit (Applied Biosystems, California) on the ABI PRISM 7900 Sequence Detection System(Applied Biosystems, California). For each reaction, 5 µl of the 2× SYBR green master mix was used with 3 µl of the cDNA material and 2 µl of the corresponding primer sets to make a 10 µl real-time PCR system. The cDNA primers were designed using primer express 3 to cover at least one junction of the exons. The target gene expression level was normalized by GAPDH levels. The primers used for the qPCR process are listed in Table 5. 26 GAPDH RET9 RET51 TFAP2γ ERα F GGCCTCCAAGGAGTAAGACC R AGGGGAGATTCAGTGTGGTG F CCGCTGGTGGACTGTAATAATG R GTAAATGCATGGGAAATTCTACCAT F GAGCCCTCCCTTCCACATG R GGACTCTCTCCAGGCCAGTTC F ACTGTCCCCACCTGAATGCT R CGATTTGGCTCTTCTGAGAACA F GCCGCAGCTCTCGCCCTTCCT R ACCGCTTCATTCCTGCCCTCTCCA Table 5: Primer sets used to detect mRNA expression level. 27 2. 2.77 Protein expression 2.7.1 Total protein extraction MCF7 cells in 6 wells plate were washed by PBS twice, then 100-200 µl of cold lysis buffer were added with shacking for 20 min. Cell lysate were transferred into a new tube and centrifuged at 13,200 g for 15 min. The supernatant was carefully removed into a new tube and stored at -80℃ or directly taken to use. The concentration of the protein samples were measured by protein assay following the manufacturer’s instructions (Pierce). 2.7.2 SDS-polyacrylamide gel electrophoresis SDS-PAGE is a commonly used method for separation of proteins based on weight and electrical properties as they migrate through a polyacrylamide matrix. 40 ng of the samples were mixed with 2× SDS-gel loading buffer (50 mM Tris-HCl pH=6.8, 4% SDS, 0.02% bromophenol blue, 20% glycerol, 100 mM DTT) and heated to 95℃ for 5 minutes before loading into the wells. Electrophoresis was carried out by Bio-Rad Mini-PROTEAN in 5× Tris-glycine electrophoresis buffer at 10 mA for 10 min, then at 20mA until the blue dye run out of the gel. 28 2.7.3 Western Blotting After SDS-PAGE electrophoresis, the protein samples were transferred to nitrocellulose membrane in transfer buffer (25 mM Tris, 192 mM glycine, 0.037% SDS, 20% methanol) by wet electroblotter at 400 mA for 120 min. The nitrocellulose membrane was blocked overnight at 4°C with 5% non-fat milk/TBST (50 mM Tris-Cl, pH=7.4, 150 mM NaCl, 0.1% Tween-20) or at 37°C for 1 hour. The next day, the membrane was incubated with primary antibody (for RET51, 1:500 dilution in 5% milk, Santa Cruz) for 2 h at room temperature. After four times washes with TBST, the membrane was incubated with secondary antibody (1:2,000 dilution in 3% milk, anti-goat secondary antibody, Santa Cruz) for 1 hour at room temperature on an orbital shaker. The membrane was subsequently washed, and incubated with the mixture of ECL detection reagents (1.5 ml solution A with 37.5 µl solution B) (Pierce, USA) for 5 minutes in darkness. At last, the signal was detected by exposure in dark room. 2.8 siRNA knockdown SiRNA from Dharmacon or FirstBase were diluted to 50 µM before use. MCF7 cells were seeded in 6 well plates in passage medium or starve medium for RNA or protein collection. Before transfection, reaction 1 was prepared by mixing 6 µl of 29 Lipofectamine RNAiMax (Invitrogen) with 44 µl of DMEM-F12, while reaction 2 was prepared by mixing 3 µl of 50 uM siRNA with 47 µl of DMEM-F12. After 10 min, the 2 reactions were mixed together and incubated for 15 min at room temperature. Then the media in the well were removed and 1.5 ml of DMEM+5% FBS (or DMEM-F12+5% CDFBS) without any antibiotics media was added into the transfection tubes and then transferred into the 6-well plate. After overnight transfection, the media in each well was changed by 2 ml fresh DMEM+5% FBS or DMEM-F12+5% CDFBS without antibiotics. Totally after 48 hours of siRNA transfection, the cells were harvested for either protein preps or RNA preps. 2.9 Evolutionary conservation analysis 2 nucleotide mutations to the consensus ERE sequence (GGTCAnnnTGACC) criterion was used to find the possible ERE binding site in the 6 detect regions. Following that, the possible ERE binding sequences were retrieved and aligned in human (hg18), Chimp(panTro2), Rhesus(rheMac2), Mouse(mm8), Rat(rn4), Dog(canFam2), Cow(bosTau3), Horse(equCab1), Cat(felCat3), TreeShrew(tupBel1), Bushbaby(otoGar1) and Rabbit(oryCun1) through UCSC Genome Bioinformatics website (http://genome.ucsc.edu/). The bioinformatic scanning for the co-factors of ERα, such as FoxA1, AP1, AP2γ, was identified by Genomatix and Transfec program. 30 Chapter 3 Results 3.1 The RET proto-oncogene is up-regulated by estrogen 3.1.1 RET mRNA and protein expression level is upregulated by E2 stimulation Recently, numerous groups including ours have performed extensive microarray studies to profile genes that are regulated by estrogen in MCF7 cells. From our analysis, we observed a moderate up-regulation of the RET gene expression by E2. In order to investigate the RET regulation by estrogen in breast cancer in greater detail, we first examined the time course of both isoforms of RET, RET9 and RET51, at the mRNA and protein levels in ERα-positive MCF7 breast cancer cell lines. As shown in Fig 1, RET9 and RET51 mRNA were significantly stimulated after 3 hours of E2 exposure, and continued to increase to a maximal around 8 fold at 6 and 12 hours respectively. The RET51 gene was more responsive to E2 as its mRNA expression level was amplified up to 7 fold at 3 hours post E2 treatment. In contrast, the E2 response of the RET9 gene was more gradual. RET9 expression level was only amplified 4 folds after 3 hours, and reached its maximal exposure 6 hours later than RET51. 31 Fig 1: RET mRNA expression levels with E2 treatment in MCF7 cells. RET mRNA expression levels were normalized with GAPDH levels and the expression level at 0 hours of EtOH samples were normalized as 1 unit. All results showed here are in triplicates. 32 At the protein level, increases in RET51 protein levels were detected as early as 3 hours post E2 treatment and continued to increase throughout the time course of treatment (Fig 2). These observations were consistent with the earlier data on the level of mRNA of the RET gene. 33 Fig 2: RET51 protein expression level with E2 treatment in MCF7 cells. MCF7 cells were treated with 10 nmol/l of E2 for 0 to 24 hours and total cellular lysates were used for RET51 immunoblotting. 34 3.1.2 Effect of ERα knockdown on RET mRNA expression Since we have established that the RET gene is E2 responsive, we next examined the requirement of ERα for E2-mediated stimulation of RET mRNA. To accomplish this, siRNA technology was used. As shown in Fig 3, a siRNA targeted specifically to ERα led to a 90% depletion of ERα mRNA level in MCF7 cells. MCF7 cells transfected with ERα siRNA were stimulated with either E2 or EtOH for 8 hours and RNA harvested. In the absence of ERα expression, RET9 RNA expression level of E2 treatment was decreased from 4.6 fold to 1.4 fold (Fig 3). Similarly, RET51 RNA expression level decreased from 6.6 fold to 1.6 fold. The reduction in RET expression after E2 treatment was also observed at the protein level. This abolishment of RET up-regulation after E2 treatment suggested that the E2 up-regulation of RET is dependent on ERα. 35 Fig 3: ERα, RET9 and RET51 mRNA expression level after ERα siRNA knockdown. ERα, RET9 and RET51 expression levels were adjusted to GAPDH internal control. In each group, the expression level in the control siRNA group after EtOH treatment was normalized as 1 unit. All results showed here are in triplicates. 36 3.1.3 The RET gene is a primary target of ERα In order to confirm that RET gene is one of the primary/direct target genes of ERα, MCF7 cells were pre-treated with the protein synthesis inhibitor cycloheximide (CHX) prior to E2 stimulation. As shown in Fig 4, RET expression of cycloheximide and non-cycloheximide treated cells were similar at 8 hours or 12 hours post E2 treatment. This indicates that the RET gene is directly regulated by ERα in response to E2. 37 Fig 4: RET9 and RET51 mRNA expression level with cycloheximide treatment. MCF7 cells were pretreated with 10 ug/ml of cycloheximide (CHX) for 1 hour before the 10 nmol/l of E2 treatment for 8 or 12 hours. RET mRNA expression levels were adjusted to the internal control GAPDH expression level, then the expression level at 0 hours without cycloheximide treatment was normalized as 1 unit. All results showed here are in triplicates. 38 3.2 RET gene is regulated by E2 through two imperfect EREs 3.2.1 ERα binds to six ERBSs at the RET gene locus In order to further examine the role of ERα in the regulation of RET mRNA, ChIP assay was preformed to investigate the recruitment and binding of ERα at the RET gene locus. Previous genome-wide ERα ChIP-Seq experiments carried out by other members in the lab showed a cluster of six ERBSs in the region between -50 kb and +35kb around the RET transcription start site (TSS) (Fig 5). To validate the ERBSs at the RET gene locus, ChIP assay with anti-ERα antibody was carried out. As shown in Fig 6, ERBS 1 and ERBS 6 showed high levels of ERα enrichment after E2 treatment (3.6% for ERBS 1 and 1.0% for ERBS 6), respectively, whereas the other 4 ERBSs showed low level of ERα recruitment. 39 Fig 5: ERBSs of the RET gene locus. The genomic loci of RET coding region and relevant position of the 6 ERBSs in chromosome 10 are showed here. 40 Fig 6: Recruitment of ERα at six ERBSs of the RET gene locus. The qPCR results of ERα ChIP samples were adjusted to the relative total input samples to get the percentage input. All results showed here are in triplicates. 41 3.2.2 Two of the six ERBS s are functional To validate and further examine the function of these distal ERBSs within the RET genomic region, 500-1000 bp region of each ERBS was amplified from the MCF7 genome and inserted into a luciferase reporter construct for transient transfection assays. As shown in Fig 7, not all of the ERBSs were functional. Construct #1 and #6, containing ERBS 1 and ERBS 6 respectively, were efficiently activated in an estrogen-dependent manner similar to the positive control. The positive control is a luciferase reporter construct containing 2 consensus EREs cloned upstream of a TATA box (pGL4-2ERE-TATA). In response to E2, the relative luciferase activity of ERBS 1 and ERBS 6 were 8 and 10 folds higher than EtOH, respectively. The results indicated that these two ERBSs have ERα recruitment ability and function as enhancers to activate transcription of the RET gene after E2 stimulation. 42 Fig 7: Functional analysis of the six ERBS through transient transfection. The basic structures of the plasmids are showing below. The luciferase expression level detected by the reporter system was normalized to the co-transfected Renilla level in order to get the Relative Luciferase Unit (RLU). All results showed here are in triplicates. 43 3.2.3 Mutagenesis confirmed the function of EREs in these two ERBSs Sequence analysis of these six putative ERBSs revealed that there are three imperfect EREs within ERBS 1, ERBS 2 and ERBS 6, respectively. According to the functionality of these ERBS, we focused on ERE I and ERE III to validate the function of these imperfect EREs. Compared to the consensus ERE motif, GGTCANNNTGACC, both ERE I (CCTCAgggTGACC) and ERE III (GGTTGcctTGACC) contain two mismatches (Fig 8). Mutations were introduced into these two ERBSs using site-directed mutagenesis. ERE I was mutated to CCAGAgggTGATT, while ERE III was mutated to AATTGcctTGATA. As shown in Fig 8, transfection results showed that mutations to the imperfect ERE I of ERBS 1 and ERE III of ERBS 6 almost completely abrogated their transcriptional activity. The results indicated that these two ERBSs are bona fide ERα transcriptional enhancers. 44 Fig 8: Mutation analysis of ERBS 1 and ERBS 6 through transfection. The consensus ERE motif, EREs containing in these two ERBSs and the mutations introduced were indicated below. Luciferase expression was adjusted to the co-transfected renilla level to generate RLU. PC and NC stand for Positive Control and Negative Control, respectively. All results showed here are in triplicates. 45 3.3 Two ERBSs interact with the transcription start site 3.3.1 3C assay detected three E2 dependent long range chromatin interactions around the RET The recruitment of ERα to the distal enhancers upstream and downstream of the RET gene suggested that the E2 mediated stimulation of RET may occur via long range chromatin interaction. To test this, we preformed chromosome conformation capture (3C) assays to examine the putative interactions of the -50 kb and +35 kb enhancers with the TSS. Firstly, a series of primers were designed unidirectionally at restriction enzyme digestion sites for each of the 6 ERBSs (Fig 9). An additional primer designed further downstream of the RET coding sequence was used as negative control. The unique primers were combined with one another in the quantitative PCR process to detect the interaction frenquency between each paired regions. For example, the data presented by primer B with primer D reflected the interaction frequency between ERBS 1 and ERBS 2. All primers used in the experiments and their relative positions are shown in Fig 9. Using primer B as our anchor point, we measured the relative interaction frequency of restriction enzyme digested fragments containing ERBS across the RET locus. As 46 shown in Fig 10, strong interactions were detected between ERBS 1 and ERBS 6 as expected. Since ERBS 2, 3 and 4 had minimal transcriptional ability, interactions of ERBS 1 with ERBS 2, ERBS 3 and ERBS 4 were low. However, a relatively high interaction frequency was detected between ERBS 1 and ERBS 5, although ERBS 5 did not contain a ERE motif nor had functional activity. As expected interaction frequency between the anchor point (primer B) and its surrounding regions (primers A,C,D,E) were high due to random molecular collision and they represented positive control interactions of this assay. As the distance from the anchor point increased, interaction frequency due to random molecular collision decreased. Furthermore, these four interactions were E2 independent. In contrast, two interactions between ERBS 1 with ERBS 5 and ERBS 6 (represented by primer sets B-I, B-J) showed strong E2 dependence. Since ERBS 5 and ERBS 6 both interact with ERBS 1, we investigated whether these two ERBSs also interact with each other. The results showed in Fig 10 indicated that the interactions frequency between ERBS 5 and 6 were as strong as the ones between ERBS 1 and 5, or between ERBS 1 and 6. This interaction was also highly E2 dependent. 47 Fig 9: Overview of ERBS location and primers designed for 3C assay. The blue breaks indicate the Xho II enzyme digestion sites in this region. Primer B, F, G, H, I and J represent the 6 ERBSs respectively, while primer A, C, D, E and K are primers designed as controls. 48 Fig 10: Long range chromatin interaction at the RET gene locus through 3C. The X axis indicates the primer sets used to detect the possible interactions. The qPCR results of each primer set in the 3C chromatin samples were normalized to the results of each primer set in the BAC samples first, to account for the primer efficiency differences. Then the results of EtOH or E2 stimulated samples were further normalized to the results of an independent locus, which exists in an E2 unaffected region in chromosome 15, to get the percentage of interaction frequency. The DNA fragments amplified were sequenced and mapped back into the Human Genome Browser (UCSC). All results showed here are in triplicates. 49 3.3.2 Long range chromatin interactions at the RET gene requires ERα Even though ERBS 5 has neither a ERE motif nor transcriptional enhancer activity, its position is nearest to the promoter region. This suggests that E2 dependent RET gene expression may be regulated through functional interaction between the enhancers (ERBS 1 and ERBS 6) with the promoter region (ERBS 5) of the RET gene. All three combinations of these ERBS showed a 2~3 fold interaction frequency that were also E2 dependent. In order to confirm the role of ERα in the mediation of these long range chromatin interactions, the 3C assay were carried out in MCF7 cells transfected with or without siRNA targeted to ERα. After successful knockdown of ERα, as shown in Fig 11, the 3C assay results showed a general decrease in all three main interactions, compared to the control siRNA. The interaction frequency in the EtOH samples was decreased to 1/3 to 1/4 of the control siRNA samples. E2 responses were also lost. In contrast, the positive control interactions, mediated by random molecular interactions, were not affected. Through the 3C assay, we have demonstrated E2 dependent interaction of the distal enhancers with the proximal promoter of the RET gene, in vivo. Taken together, these 3C data suggested that the ERα regulated enhancers transactivate the RET gene via an intrachromosomal looping mechanism. 50 Fig 11: Long range chromatin interaction at the RET gene locus after ERα siRNA knockdown. Anti-ERα siRNA or control siRNA was first transfected in starved MCF7 cells 48 hours prior to the 3C assay. The western blotting results above show the successful deprivation of ERα. The data generated here were the same as normal 3C assay. All results showed here are in triplicates. 51 3.4 Role of other co-factors in long range chromatin interactions around RET 3.4.1 Binding of other co-factors at the RET locus through ChIP Using bioinformatic tools such as Genomatix and Transfac to detect for the enrichment of binding motifs of other transcription factors at the ERBS, we showed that some of the enriched motifs are bound by co-factors which have been previously reported to be co-regulators of ERα. These co-factors include FoxA1 (Robyr, Gegonne et al. 2000) and cJun (Umayahara, Kawamori et al. 1994) (Fig 12). In order to validate the recruitment of these co-factors around the ERBSs, ChIP experiments were carried out for each of the factors. As shown in Fig 13, cJun was recruited mainly at ERBS 1, at 0.02% of input and 0.07% of input before and after E2 treatment respectively. FoxA1 was recruited at ERBS 1, 3 and 5. Based on the ERα co-localization transcription factor list generated from other members of the lab, we also detected the binding of some novel factors within the ERBSs around RET gene locus. Among them, AP2γ was detected at all the 6 ERBSs. AP2γ binding was strongest at ERBS 1, 3 and 5 with enrichment at 0.14-0.18% of input (Fig 14). 52 Fig 12: Prediction of other co-factor at ERBS 1 and ERBS 6 through motif analysis. The relative positions of these co-factor motifs are showed here. 53 Fig 13: cJun and FoxA1 binding at the RET locus. Primers used here were the same as those in detecting ERα recruitment in these 6 ERBSs. All results showed here are in triplicates. 54 Fig 14: AP2γ binding at the RET locus. Primers used here were the same as those in detecting ERα recruitment in these 6 ERBSs. All results showed here are in triplicates. 55 3.4.2 Mutagenesis of the co-factor motif decreased ERα enhancer ability To confirm the activity of the above co-factors in assisting ERα at the ERBSs, specific point mutations were introduced to reporter constructs containing ERBS 1 or 6. As shown in Fig 15, there was a decrease in E2 response when the binding motifs were mutated. At ERBS 1, mutations at AP1, AP2γ, and FoxA1 motif resulted in a 50% decrease in transcriptional activity. At ERBS 6, mutations of these 3 co-factors caused 50-75% decrease in transcriptional activity. The results suggest that these ERBSs were functional in the recruitment of relevant transcription factors to enhance E2 dependent transcription. 56 Fig 15: Mutation analysis of ERBS with co-factor motif. The motif of the co-factor was labeled behind the binding region number. The RLU value was calculated in the same way as previous described. All results showed here are in triplicates. 57 3.4.3 AP2γ is required for RET gene expression To further explore the function of the novel transcription factor, AP2γ, we used siRNAs to knockdown this transcription factor and measured its effect on RET gene expression. As shown in Fig 16, knockdown of AP2γ decreased RET expression by 30% at the mRNA level. Similar results were detected at the protein level. 58 Fig 16: Protein and mRNA expression of RET after AP2γ siRNA knockdown. Anti-RET51 antibody was used to detect RET51 protein level. RNA was collected after 8 hours of E2 or EtOH stimulation post 48 hours of relative siRNA transfection. RET9 and RET51 cDNA primers used were the same as used previously. 59 3.4.4 Recruitment of ERα to the estrogen receptor binding sites of RET is dependent on AP2γ Since AP2γ was recruited to the ERBS of the RET gene locus and knockdown of AP2γ resulted in a decrease of RET transcriptional level, we next investigated whether AP2γ can affect the recruitment of ERα to these ERBSs. In this experiment, MCF7 cells were transfected with AP2γ siRNA or control siRNA for 48 hours followed by ChIP with an ERα specific antibody. As shown in Fig 17, knockdown of AP2γ affected recruitment of ERα at all the 6 ERBSs. At ERBS 1, the recruitment of ERα after E2 treatment decreased from 3.8% to 1.3%, while at ERBS 6, the recruitment of ERα decreased from 0.7% to 0.2%. These results strongly suggest that AP2γ plays a functional role in mediating ERα recruitment at these 6 ERBSs. 60 Fig 17: ERα binding at the RET locus after AP2γ knockdown. MCF7 cells were processed to ChIP assay after 48 hours of transfection of AP2γ siRNA or control siRNA. ChIP primers of these 6 ERBSs were the same as previously used. All results showed here are in triplicates. 61 3.4.5 AP2γ affects ERα mediated long range interactions The importance of AP2γ in ERα recruitment to these 6 ERBSs suggested that AP2γ may also affect the chromatin loop mediated by ERα at the RET gene locus. To test this, 3C assay after AP2γ knockdown was performed in the same way as previously described for ERα knockdown 3C assay. The results in Fig 18 showed that AP2γ knockdown affected the 3 key long range chromatin interactions at the RET locus. Even though the basal interaction frequency of EtOH treated samples remained the same, the 2-3 fold increase in interaction frequency after E2 stimulation was lost in AP2γ knockdown samples. This indicated that the E2 dependent chromatin loop mediated by ERα was abolished. The results are consistent with the decrease in RET gene expression after AP2γ knockdown (Fig 16). 62 Fig 18: Long range chromatin interaction at the RET gene locus after AP2γ siRNA knockdown. MCF7 cells were transfected by AP2γ or control siRNA for 48 hours then proceeded to 3C assay. The primer sets were the same as previously used. Results showed here are in triplicates. 63 3.5 Conservation of the RET gene gene’’s ERα binding sites Since RET gene is evolutionary conserved in the mammalian genome, we compared the RET locus of different species whose genomes have been sequenced, and found that the EREs around the RET locus are also evolutionarily conserved. As shown in Table 6, the conservation of ERE shows a parallel pattern, and they are most conserved in mammalian genomes. 64 ERE I (in ERBS1) ERE II (in ERBS 2) ERE III (in ERBS 3) Human(hg18) CCTCAGG-GTGACC GGTCACAATAACC GGTTGCCTTGACC Chimp(panTro2) CCTCGGG-GTGACC GGTCACAATAACC GGTTGCCTTGACC Rhesus(rheMac2) CCTCAGG-GTGACC N GGTTGCTTTGACC Mouse(mm8) N GGAGGAAGTAATA N Rat(rn4) N AGAGGAAATAATA N Dog(canFam2) CTGCAGGGGTGACC GGGCAACATAATA TGTC-CTTTCACC Cow(bosTau3) N GGGCAAAATAATA TGTTCTTTCCACC Horse(equCab1) CCACAGGCTGGACC GGGCAAAACAATA AGTTGCTTTCACC Cat(felCat3) N GGGCAAAATAATA AGTT-CTTCCACC TreeShrew(tupBel1) N GGGCAC-ATAACA N Bushbaby(otoGar1) N GGGCAAAATAATA N Rabbit(oryCun1) N N N Table 6: Revolutionary conservation analysis of three ERE sites around RET gene. N stands for Negative alignment, while motif in italic stands for the possible EREs in relative mammalian genome. 65 Chapter 4 Discussion α mediated long range 4.1 RET is E2 regulated through ER ERα interaction From our ERα ChIP assay, we found 6 ERBSs associated with the RET region. Among them, two (ERBS 1 and ERBS 6) showed high level of binding affinity while the rest showed relatively low binding affinity (Fig 6). Subsequent reporter assays confirmed that these two ERBSs were ERα specific while the remaining four were not (Fig 7). In addition, the 3C assay results confirmed the presence of ERα mediated long range interaction between ERα enhancers, 50kb upstream and 33kb downstream of the RET gene promoter region is E2 dependent (Fig 11). In this model, the ERBS 5, which represents the promoter region, acts as an anchor for the two enhancers to initiate RNA Pol II gene transcription through ERα activation. Here, we provide evidence that distal ERBS, up to 50kb away, is a bona fide transcriptional enhancer that is critical for maximal transcription activity. At the same time, an ERα enhancer further downstream in the RET gene coding region, was also functional in the transcriptional activation of RET gene. Further bioinformatic analysis showed that other co-activators such as AP2γ collaborate with ERα and RNA Pol II complex to consolidate and initiate active transcription (Fig 14, 16). The two imperfect EREs in each of the enhancers play a major role in the determination of the overall transcriptional activity of the promoter (Fig 8). Comparison made across different 66 species indicates there is a high level of evolutionarily conservation of these EREs (Table 6). Taken together, these two imperfect ERE recruited ERα to bind after E2 stimulation and loop towards the promoter area to recruit RNA Pol II and other factors to form a functional transcription complex which activates the RET gene expression. The interactions between the two ERBSs and the promoter region of RET gene were also detected after E2 stimuli in the CHIA-PET assay (Fig 19). However, there are also interaction PETs between the other four ERBSs which was not detected by the 3C assay. This difference could be due to the low efficiency of enzyme digesting, ligation and PCR amplification during 3C assay, which makes 3C assay suitable mainly in the detection of high frequency interactions. The detection of low frequency interactions by the ChIA-PET assay has demonstrated that intrachromosomal looping around RET gene locus is far more complex than anticipated. 67 Fig 19: Overview of ChIA-PET interaction around the RET gene locus. Each line indicates a pair of PETs connecting the 2 different genomic locations. 68 4.2 RET gene plays a functional role in human breast cancers RET is one of the driving oncogenes first identified in various neoplasms of the thyroid. Further research indicated that this gene is also functional in other kinds of tumors (Okada, Takeyama et al. 1999; Thomas, Baker et al. 2007; Boulay, Breuleux et al. 2008; Zeng, Cheng et al. 2008). RET, as a member of the transmembrane protein kinases, has been show to be connected to various pathways which leads cell to proliferation and survival (Manie, Santoro et al. 2001; Paratcha, Ledda et al. 2001). In ERα positive breast cancer cell line MCF7, it has been demonstrated that RET was activated by the ligand GDNF (glial-derived neurotrophic factor) which leads to the initiation of downstream signaling proteins such as ERK and AKT of the PI3K pathway (Esseghir, Todd et al. 2007). While earlier work has reported the role of the PI3K pathway in the phosphorylation of ERα, our work suggest a possible additional connection between the pathways. In RET siRNA knockdown samples, we found that ERα regulated genes, such as GREB1, displayed a different expression pattern after E2 stimulation. Building on previous work and ours, we proposed a feedback kinase dependent intrachromosomal interaction that may be dependent on ERα and RET. In this model, ERα is activated after E2 stimulation and induces the transcription of its target genes. With the subsequent upregulation of RET gene expression, ERα is phosphorylated by other kinases downstream of the RET signaling pathway. 69 Phosphorylation of ERα maintains its transcriptional activity. Further studies will be needed to test this postulated cross talk between the regulated pathways of ERα and RET. 2γ functions as a pioneer factor for ER α response pathway 4.3 AP AP2 ERα Previous studies have shown that certain transcription factors, such as FoxA1, cJun and cFos, assist ERα in the regulation of downstream targets gene in pathways related to breast cancer. In this work, the role of a novel ERα co-factor, AP2γ, in E2 dependent regulation of RET was investigated (Fig 14, 16). AP2γ belongs to the family of activating enhancer-binding protein 2 (AP-2) transcription factors, whose 5 members share a high homology (Eckert, Buhl et al. 2005). All five members have similar multidomain structures which consist of a proline-rich transactivation domain, a highly conserved basic helical DNA-binding domain, and a dimerization domain that perimits homodimerization or heterodimerization. Previous works have established a link between AP2γ and breast cancer in the direct regulation of ERα gene expression and in cell proliferation and differentiation (Turner, Zhang et al. 1998; Woodfield, Horan et al. 2007; Orso, Penna et al. 2008). Here, we identified an additional function of AP2γ as a co-regulator of ERα (Fig 14, 15, 16). While binding of AP2γ was specific at the RET gene locus, the recruitment of AP2γ was E2 independent (Fig 14). This suggests that AP2γ is already recruited to the 70 target regions before E2 stimulation. Loss of ERα recruitment after AP2γ siRNA knockdown indicated that the presence of AP2γ was a necessary requirement for ERα recruitment at the RET locus (Fig 17). Consequently, the loss of ERα recruitment abrogated intrachromosomal interaction at the region (Fig 18). Although previous research indicated that AP2γ regulates ERα transcription (Woodfield, Horan et al. 2007), our AP2γ siRNA knockdown samples did not show obvious changes of ERα at both mRNA and protein levels. Furthermore, target genes of ERα, such as GREB1 and TFF1, did not show obvious expression changes after AP2γ siRNA knockdown (data not shown). In addition, the ERα recruitments at the enhancer and promoter region of GREB1 gene were not obviously affected (data not shown). These results suggested that AP2γ alone was not able to change the regulation network conducted by ERα. The RET gene provides an example of an AP2γ dependent ERα regulated gene, which E2 regulation is mediated through long range chromatin interaction. The recruitment of ERα and the transactivation process is mediated by a transcriptional complex consisting of ERα and other co-factors, indicating AP2γ maybe primarily involved in long range chromatin interaction. The preloading of AP2γ onto the ERBSs may function mainly as the anchors for the looping process. The exact function of AP2γ in ERα mediated transactivation process requires further research works to fully elucidate. 71 Chapter 5 Conclusion Our research demonstrated that ERα conducted long range chromatin loops were mainly responsible for the transcriptional regulation of RET gene in breast cancer cell line MCF7 after E2 treatment. This chromatin loops connected two ERα binding sites which separated 85 kb away from each other and conducted the complex to the promoter region to recruit RNA Pol II to start transcription. During this process, the function of ERα was carried out with the assistance of some other co-factors, such as AP2γ, cJun, FoxA1, etc. Of them, AP2γ is discovered to be the pre-loading factor for ERα and is important for the formation of the transactivation looping. The up-regulation of RET gene after E2 stimulation also enhanced the proliferation of the MCF7 cells. 72 References: Ascenzi, P., A. Bocedi, et al. (2006). "Structure-function relationship of estrogen receptor alpha and beta: impact on human health." Mol Aspects Med 27 27(4): 299-402. Baloh, R. H., M. G. Tansey, et al. (1998). "Artemin, a novel member of the GDNF ligand family, supports peripheral and central neurons and signals through the GFRalpha3-RET receptor complex." Neuron 21 21(6): 1291-302. Barnett, D. H., S. Sheng, et al. (2008). "Estrogen receptor regulation of carbonic anhydrase XII through a distal enhancer in breast cancer." Cancer Res 68 68(9): 3505-15. Bjornstrom, L. and M. Sjoberg (2005). "Mechanisms of estrogen receptor signaling: convergence of genomic and nongenomic actions on target genes." Mol Endocrinol 19 19(4): 833-42. Boulay, A., M. Breuleux, et al. (2008). "The Ret receptor tyrosine kinase pathway functionally interacts with the ERalpha pathway in breast cancer." Cancer Res 68 68(10): 3743-51. Bretschneider, N., K. Sara, et al. (2008). "E2-mediated cathepsin D (CTSD) activation involves looping of distal enhancer elements." Mol Oncol 2(2): 182-90. Carroll, J. S., X. S. Liu, et al. (2005). "Chromosome-wide mapping of estrogen receptor binding reveals long-range regulation requiring the forkhead protein FoxA1." Cell 122 122(1): 33-43. Couse, J. F., J. Lindzey, et al. (1997). "Tissue distribution and quantitative analysis of estrogen receptor-alpha (ERalpha) and estrogen receptor-beta (ERbeta) messenger ribonucleic acid in the wild-type and ERalpha-knockout mouse." Endocrinology 138 138(11): 4613-21. Cullen, K. E., M. P. Kladde, et al. (1993). "Interaction between transcription regulatory regions of prolactin chromatin." Science 261 261(5118): 203-6. Dahlman-Wright, K., V. Cavailles, et al. (2006). "International Union of Pharmacology. LXIV. Estrogen receptors." Pharmacol Rev 58 58(4): 773-81. de Graaff, E., S. Srinivas, et al. (2001). "Differential activities of the RET tyrosine kinase receptor isoforms during mammalian embryogenesis." Genes Dev 15 15(18): 2433-44. Dechant, G. (2002). "Chat in the trophic web: NGF activates Ret by inter-RTK signaling." Neuron 33 33(2): 156-8. Dekker, J., K. Rippe, et al. (2002). "Capturing chromosome conformation." Science 295 295(5558): 1306-11. DeNardo, D. G., H. T. Kim, et al. (2005). "Global gene expression analysis of estrogen receptor transcription factor cross talk in breast cancer: identification of estrogen-induced/activator protein-1-dependent genes." Mol Endocrinol 19 19(2): 362-78. Deroo, B. J. and K. S. Korach (2006). "Estrogen receptors and human disease." J Clin Invest 116 116(3): 561-70. Deschenes, J., V. Bourdeau, et al. (2007). "Regulation of GREB1 transcription by estrogen receptor alpha through a multipartite enhancer spread over 20 kb of upstream flanking sequences." J Biol Chem 282 282(24): 17335-9. Donis-Keller, H., S. Dou, et al. (1993). "Mutations in the RET proto-oncogene are associated with MEN 2A and FMTC." Hum Mol Genet 2(7): 851-6. Dostie, J., T. A. Richmond, et al. (2006). "Chromosome Conformation Capture Carbon Copy (5C): a massively parallel solution for mapping interactions between genomic elements." Genome Res 16 16(10): 1299-309. Durbec, P., C. V. Marcos-Gutierrez, et al. (1996). "GDNF signalling through the Ret receptor tyrosine 73 kinase." Nature 381 381(6585): 789-93. Eckert, D., S. Buhl, et al. (2005). "The AP-2 family of transcription factors." Genome Biol 6(13): 246. Edery, P., S. Lyonnet, et al. (1994). "Mutations of the RET proto-oncogene in Hirschsprung's disease." Nature 367 367(6461): 378-80. Eng, C. (1999). "RET proto-oncogene in the development of human cancer." J Clin Oncol 17 17(1): 380-93. Esseghir, S., S. K. Todd, et al. (2007). "A role for glial cell derived neurotrophic factor induced expression by inflammatory cytokines and RET/GFR alpha 1 receptor up-regulation in breast cancer." Cancer Res 67 67(24): 11732-41. Fabian, C. J. and B. F. Kimler (2005). "Selective estrogen-receptor modulators for primary prevention of breast cancer." J Clin Oncol 23 23(8): 1644-55. Fullwood, M. J., M. H. Liu, et al. (2009). "An oestrogen-receptor-alpha-bound human chromatin interactome." Nature 462 462(7269): 58-64. Fullwood, M. J. and Y. Ruan (2009). "ChIP-based methods for the identification of long-range chromatin interactions." J Cell Biochem 107 107(1): 30-9. Gottlicher, M., S. Heck, et al. (1998). "Transcriptional cross-talk, the second mode of steroid hormone receptor action." J Mol Med 76 76(7): 480-9. Hayashi, H., M. Ichihara, et al. (2000). "Characterization of intracellular signals via tyrosine 1062 in RET activated by glial cell line-derived neurotrophic factor." Oncogene 19 19(39): 4469-75. Hayashi, Y., T. Iwashita, et al. (2001). "Activation of BMK1 via tyrosine 1062 in RET by GDNF and MEN2A mutation." Biochem Biophys Res Commun 281 281(3): 682-9. Hess, R. A., D. Bunick, et al. (1997). "A role for oestrogens in the male reproductive system." Nature 390 390(6659): 509-12. Hofstra, R. M., R. M. Landsvater, et al. (1994). "A mutation in the RET proto-oncogene associated with multiple endocrine neoplasia type 2B and sporadic medullary thyroid carcinoma." Nature 367 367(6461): 375-6. Hu, Q., Y. S. Kwon, et al. (2008). "Enhancing nuclear receptor-induced transcription requires nuclear motor and LSD1-dependent gene networking in interchromatin granules." Proc Natl Acad Sci U S A 105 105(49): 19199-204. Hurtado, A., K. A. Holmes, et al. (2008). "Regulation of ERBB2 by oestrogen receptor-PAX2 determines response to tamoxifen." Nature 456 456(7222): 663-6. Ishizaka, Y., F. Itoh, et al. (1989). "Presence of aberrant transcripts of ret proto-oncogene in a human papillary thyroid carcinoma cell line." Jpn J Cancer Res 80 80(12): 1149-52. Ishizaka, Y., F. Itoh, et al. (1989). "Human ret proto-oncogene mapped to chromosome 10q11.2." Oncogene 4(12): 1519-21. Kawamoto, Y., K. Takeda, et al. (2004). "Identification of RET autophosphorylation sites by mass spectrometry." J Biol Chem 279 279(14): 14213-24. Knauf, J. A., H. Kuroda, et al. (2003). "RET/PTC-induced dedifferentiation of thyroid cells is mediated through Y1062 signaling through SHC-RAS-MAP kinase." Oncogene 22 22(28): 4406-12. Kuo, M. H. and C. D. Allis (1999). "In vivo cross-linking and immunoprecipitation for studying dynamic Protein:DNA associations in a chromatin environment." Methods 19 19(3): 425-33. Kurokawa, K., T. Iwashita, et al. (2001). "Identification of SNT/FRS2 docking site on RET receptor tyrosine kinase and its role for signal transduction." Oncogene 20 20(16): 1929-38. Lander, E. S., L. M. Linton, et al. (2001). "Initial sequencing and analysis of the human genome." 74 Nature 409 409(6822): 860-921. Lee, D. C., K. W. Chan, et al. (2002). "RET receptor tyrosine kinase isoforms in kidney function and disease." Oncogene 21 21(36): 5582-92. Leung, Y. K., P. Mak, et al. (2006). "Estrogen receptor (ER)-beta isoforms: a key to understanding ER-beta signaling." Proc Natl Acad Sci U S A 103 103(35): 13162-7. Levin, E. R. (2005). "Integration of the extranuclear and nuclear actions of estrogen." Mol Endocrinol 19 19(8): 1951-9. Li, C., M. R. Briggs, et al. (2001). "Requirement of Sp1 and estrogen receptor alpha interaction in 17beta-estradiol-mediated transcriptional activation of the low density lipoprotein receptor gene expression." Endocrinology 142 142(4): 1546-53. Li, X., J. Huang, et al. (2004). "Single-chain estrogen receptors (ERs) reveal that the ERalpha/beta heterodimer emulates functions of the ERalpha dimer in genomic estrogen signaling pathways." Mol Cell Biol 24 24(17): 7681-94. Lin, C. Y., V. B. Vega, et al. (2007). "Whole-genome cartography of estrogen receptor alpha binding sites." PLoS Genet 3(6): e87. Ling, J. Q., T. Li, et al. (2006). "CTCF mediates interchromosomal colocalization between Igf2/H19 and Wsb1/Nf1." Science 312 312(5771): 269-72. Liu, M. M., C. Albanese, et al. (2002). "Opposing action of estrogen receptors alpha and beta on cyclin D1 gene expression." J Biol Chem 277 277(27): 24353-60. Loh, Y. H., Q. Wu, et al. (2006). "The Oct4 and Nanog transcription network regulates pluripotency in mouse embryonic stem cells." Nat Genet 38 38(4): 431-40. Manie, S., M. Santoro, et al. (2001). "The RET receptor: function in development and dysfunction in congenital malformation." Trends Genet 17 17(10): 580-9. Maston, G. A., S. K. Evans, et al. (2006). "Transcriptional regulatory elements in the human genome." Annu Rev Genomics Hum Genet 7: 29-59. Metivier, R., G. Penot, et al. (2003). "Estrogen receptor-alpha directs ordered, cyclical, and combinatorial recruitment of cofactors on a natural target promoter." Cell 115 115(6): 751-63. Mulligan, L. M., J. B. Kwok, et al. (1993). "Germ-line mutations of the RET proto-oncogene in multiple endocrine neoplasia type 2A." Nature 363 363(6428): 458-60. Myers, S. M., C. Eng, et al. (1995). "Characterization of RET proto-oncogene 3' splicing variants and polyadenylation sites: a novel C-terminus for RET." Oncogene 11 11(10): 2039-45. Nelson, L. R. and S. E. Bulun (2001). "Estrogen production and action." J Am Acad Dermatol 45 45(3 Suppl): S116-24. Nilsson, S., S. Makela, et al. (2001). "Mechanisms of estrogen action." Physiol Rev 81 81(4): 1535-65. O'Lone, R., M. C. Frith, et al. (2004). "Genomic targets of nuclear estrogen receptors." Mol Endocrinol 18 18(8): 1859-75. Okada, Y., H. Takeyama, et al. (1999). "Experimental implication of celiac ganglionotropic invasion of pancreatic-cancer cells bearing c-ret proto-oncogene with reference to glial-cell-line-derived neurotrophic factor (GDNF)." Int J Cancer 81 81(1): 67-73. Orso, F., E. Penna, et al. (2008). "AP-2alpha and AP-2gamma regulate tumor progression via specific genetic programs." FASEB J 22 22(8): 2702-14. Pan, Y. F., K. D. Wansa, et al. (2008). "Regulation of estrogen receptor-mediated long range transcription via evolutionarily conserved distal response elements." J Biol Chem 283 283(47): 32977-88. 75 Paratcha, G., F. Ledda, et al. (2001). "Released GFRalpha1 potentiates downstream signaling, neuronal survival, and differentiation via a novel mechanism of recruitment of c-Ret to lipid rafts." Neuron 29 29(1): 171-84. Perou, C. M., T. Sorlie, et al. (2000). "Molecular portraits of human breast tumours." Nature 406 406(6797): 747-52. Porter, W., B. Saville, et al. (1997). "Functional synergy between the transcription factor Sp1 and the estrogen receptor." Mol Endocrinol 11 11(11): 1569-80. Robyr, D., A. Gegonne, et al. (2000). "Determinants of vitellogenin B1 promoter architecture. HNF3 and estrogen responsive transcription within chromatin." J Biol Chem 275 275(36): 28291-300. Romeo, G., P. Ronchetto, et al. (1994). "Point mutations affecting the tyrosine kinase domain of the RET proto-oncogene in Hirschsprung's disease." Nature 367 367(6461): 377-8. Rosenfeld, M. G. and C. K. Glass (2001). "Coregulator codes of transcriptional regulation by nuclear receptors." J Biol Chem 276 276(40): 36865-8. Sabbah, M., D. Courilleau, et al. (1999). "Estrogen induction of the cyclin D1 promoter: involvement of a cAMP response-like element." Proc Natl Acad Sci U S A 96 96(20): 11217-22. Sadler, A. J., D. Pugazhendhi, et al. (2009). "Use of global gene expression patterns in mechanistic studies of oestrogen action in MCF7 human breast cancer cells." J Steroid Biochem Mol Biol 114 114(1-2): 21-32. Sawai, H., Y. Okada, et al. (2005). "The G691S RET polymorphism increases glial cell line-derived neurotrophic factor-induced pancreatic cancer cell invasion by amplifying mitogen-activated protein kinase signaling." Cancer Res 65 65(24): 11536-44. Shiau, A. K., D. Barstad, et al. (1998). "The structural basis of estrogen receptor/coactivator recognition and the antagonism of this interaction by tamoxifen." Cell 95 95(7): 927-37. Simonis, M., P. Klous, et al. (2006). "Nuclear organization of active and inactive chromatin domains uncovered by chromosome conformation capture-on-chip (4C)." Nat Genet 38 38(11): 1348-54. Simonis, M., J. Kooren, et al. (2007). "An evaluation of 3C-based methods to capture DNA interactions." Nat Methods 4(11): 895-901. Sorlie, T., C. M. Perou, et al. (2001). "Gene expression patterns of breast carcinomas distinguish tumor subclasses with clinical implications." Proc Natl Acad Sci U S A 98 98(19): 10869-74. Tahira, T., Y. Ishizaka, et al. (1990). "Characterization of ret proto-oncogene mRNAs encoding two isoforms of the protein product in a human neuroblastoma cell line." Oncogene 5(1): 97-102. Takahashi, M. (1988). "Structure and expression of the ret transforming gene." IARC Sci Publ(92): 189-97. Takahashi, M., Y. Buma, et al. (1988). "Cloning and expression of the ret proto-oncogene encoding a tyrosine kinase with two potential transmembrane domains." Oncogene 3(5): 571-8. Takahashi, M., J. Ritz, et al. (1985). "Activation of a novel human transforming gene, ret, by DNA rearrangement." Cell 42 42(2): 581-8. Thomas, R. K., A. C. Baker, et al. (2007). "High-throughput oncogene mutation profiling in human cancer." Nat Genet 39 39(3): 347-51. Tolhuis, B., R. J. Palstra, et al. (2002). "Looping and interaction between hypersensitive sites in the active beta-globin locus." Mol Cell 10 10(6): 1453-65. Trupp, M., E. Arenas, et al. (1996). "Functional receptor for GDNF encoded by the c-ret proto-oncogene." Nature 381 381(6585): 785-9. Trupp, M., R. Scott, et al. (1999). "Ret-dependent and -independent mechanisms of glial cell 76 line-derived neurotrophic factor signaling in neuronal cells." J Biol Chem 274 274(30): 20885-94. Tsui-Pierchala, B. A., J. Milbrandt, et al. (2002). "NGF utilizes c-Ret via a novel GFL-independent, inter-RTK signaling mechanism to maintain the trophic status of mature sympathetic neurons." Neuron 33 33(2): 261-73. Turner, B. C., J. Zhang, et al. (1998). "Expression of AP-2 transcription factors in human breast cancer correlates with the regulation of multiple growth factor signalling pathways." Cancer Res 58 58(23): 5466-72. Umayahara, Y., R. Kawamori, et al. (1994). "Estrogen regulation of the insulin-like growth factor I gene transcription involves an AP-1 enhancer." J Biol Chem 269 269(23): 16433-42. van de Vijver, M. J., Y. D. He, et al. (2002). "A gene-expression signature as a predictor of survival in breast cancer." N Engl J Med 347 347(25): 1999-2009. Venter, J. C., M. D. Adams, et al. (2001). "The sequence of the human genome." Science 291 291(5507): 1304-51. Wei, C. L., Q. Wu, et al. (2006). "A global map of p53 transcription-factor binding sites in the human genome." Cell 124 124(1): 207-19. Welboren, W. J., M. A. van Driel, et al. (2009). "ChIP-Seq of ERalpha and RNA polymerase II defines genes differentially responding to ligands." EMBO J 28 28(10): 1418-28. West, A. G. and P. Fraser (2005). "Remote control of gene transcription." Hum Mol Genet 14 Spec No 1: R101-11. Woodfield, G. W., A. D. Horan, et al. (2007). "TFAP2C controls hormone response in breast cancer cells through multiple pathways of estrogen signaling." Cancer Res 67 67(18): 8439-43. Wooster, R. and B. L. Weber (2003). "Breast and ovarian cancer." N Engl J Med 348 348(23): 2339-47. Wurtele, H. and P. Chartrand (2006). "Genome-wide scanning of HoxB1-associated loci in mouse ES cells using an open-ended Chromosome Conformation Capture methodology." Chromosome Res 14 14(5): 477-95. Yager, J. D. and N. E. Davidson (2006). "Estrogen carcinogenesis in breast cancer." N Engl J Med 354 354(3): 270-82. Zeng, Q., Y. Cheng, et al. (2008). "The relationship between overexpression of glial cell-derived neurotrophic factor and its RET receptor with progression and prognosis of human pancreatic cancer." J Int Med Res 36 36(4): 656-64. Zhao, Z., G. Tavoosidana, et al. (2006). "Circular chromosome conformation capture (4C) uncovers extensive networks of epigenetically regulated intra- and interchromosomal interactions." Nat Genet 38 38(11): 1341-7. 77 [...]... for 1 minute and a final extension at 72°C for 10 minutes PCR primers used to amplify the ERBSs are indicated in Table 1 13 Forward Reverse ERBS 1 ATCCACACATCCCTTCTGCT GGAAAGGGAGAGGAGCGAGAT ERBS 2 CCCCAACTAATTCCCTTGGT GTCAGAGTGTGGATGCTTGGA ERBS 3 GCAGAGCAGTGAGGCACAG GGAGGGAGCCCTCATCTGAA ERBS 4 CTAGGAGGGAAGGGGAGTTG GAATGTCTGCCAGGAGAATGC ERBS 5 GGATTGGCGCTGAGACAATG CTGTAGGGCCACAGGTTCTC ERBS 6 CTCGCCATCTGTGGAACTTT... CTGAGTCAGACAAGCAACCGGGGCAGACGCAGGACAAGG FoxA1 in ERBS 1 TCACCACGGTAATGCTGTATTGGGGCCTGGCACCATCACC AP1 in ERBS 6 GCGGCTTTGTTGTCAAAGTTTGGGAGGAAAGGGGAGTAAAGG AP2γ in ERBS 6 GTTGAGTCAGGGCCTGAATGGAACTTTTCCTGCCACC AP4 in ERBS 6 GCTCCCAGGAACAGGGGTTGCAAGTAACATGTGG FoxA1 in ERBS 6 GAAAGGGGAGTAAACCGTTGAAACAGGGCCTGCCTGGG Table 2: Primers used to introduce mutations into transcription factor binding motif 17 2.3... 3 20 Forward Primer Reverse Primer ERBS 1 CCCTGAGGGCGCAGAGA GGGATGGCAAGGTTAGAAGCT ERBS 2 GGAACAGACACCAGCATATCCA CCTCGGTTTCCCTTTCTTTGA ERBS 3 GGCATAAGCTCTGTGCAAACAT CATTTCCATGGTGTTTTATTAAAGGA ERBS 4 TGTTCTCTCCCTGCGAGTTGT GAAGGAGCGACGCAACCA ERBS 5 AAGGAGTGGCTCCACAAAGTGT TGCAGCGGTGACCTTTCTG ERBS 6 CCCCCCTAGATCGGGAAAG ACGTTGATGCCACTGAATGC Table 3: Primer sets used to detect the 6 ERBSs 21 2.5 Capture of... 3’-end The primers used in mutagenesis process are listed here in Table 2 The following procedures were carried out according to the manufacture’s recommendation 16 ERE in ERBS 1 CAAGGTGCGCGGAGCCCAGAGGGTGATTCAGCTTGCTGACGAG ERE in ERBS 6 GAACCTCGAGGCCCTGAATTGCCTTGATATCCAGCTCCCAGGAAC AP2γ in ERBS 1 TCCGGGACAACGCGAACAGGGGCTCTGGAC AP1 in ERBS 1 GCAGGTGAGACTGGCAAAGTTTGACCTGCTGCCGG AP4 in ERBS 1 CTGAGTCAGACAAGCAACCGGGGCAGACGCAGGACAAGG... mutations in pancreatic cancer and the over expression of genes in the RET RTK pathway in breast tumor cell lines suggest that RET have important roles in the regulation of cancer growth and progression (Hayashi, Ichihara et al 2000; Dechant 2002; Tsui-Pierchala, Milbrandt et al 2002; Sawai, Okada et al 2005; Zeng, Cheng et al 2008) 6 1.3 Long Range Chromatin Interactions 1.3.1 Estrogen receptor binding... co-factor at ERBS 1 and ERBS 6 through motif 53 analysis Fig 13: cJun and FoxA1 binding at the RET locus 54 Fig 14: AP2γ binding at the RET locus 55 Fig 15: Mutation analysis of ERBS with co-factor motif mutations 57 Fig 16: Protein and mRNA expression of RET after AP2γ siRNA knockdown 59 Fig 17: ERα binding at the RET locus after AP2γ knockdown 61 Fig 18: Long range chromatin interaction at the RET gene. .. mediation of long range chromatin interactions 11 Using the ChIA-PET assay, a genome-wide chromatin interaction network mediated by ERα was comprehensively mapped in MCF7 cells (Fullwood, Liu et al 2009) In all by 1,451 ERα mediated intrachromosomal and 15 ERα mediated interchromosomal long range interactions were reported These interactions were mostly anchored from distal ERα binding sites to gene. .. et al 1990; Myers, Eng et al 1995; de Graaff, Srinivas et al 2001) RET4 3 is seldom found in human (Myers, Eng et al 1995) The RET protein is divided into 3 domains In the N-terminal extracellular domain there are four cadherin-like repeats and a cysteine-rich region The hydrophobic transmembrane domain and the cytoplasmic tyrosine kinase domain are separated by an insertion of 27 amino acids Within their... Breast cancer is the second ranking cancer worldwide and it is the fifth most common cause of cancer death (Breast Cancer Facts & Figures 2009-2010, American Cancer Society, Atlanta, Georgia) With decades of molecular pathology research and clinical trials, breast cancer is also one of the most well studied cancer types now and its survival rate after therapy is increasing (Wooster and Weber 2003) Established... observed in other transcription factor and in other cell lines This suggests that such transcription factors may regulate transcription through long- range chromatin interactions 1.3.2 Methods to study long range chromatin interactions Chromosome Conformation Capture (3C) is the most widely used method to study long range chromatin interactions across the genome (Dekker, Rippe et al 2002) The 8 main concept ... ATCAAACTGGAGGGAGCAGA B TCAGACAGTGCCAGTGGAAG E GCCAGTGGAAGTGTAAGTTGG B TCGGGACACAGCATCATAA F GACACTGACAGGATTTACCATACTGTTGG B TCGGGACACAGCATCATAA G GGTCAAGTGTTCCCGTGATCCTACTG B TCGGGACACAGCATCATAA H CACAGGGAAATGCAGCACAGCTAG... 23 AB BC BD BE BF BG BH BI BJ BK IJ A CATGGGAGAAAGATGTAGTCTGGGAGAC B CTCTTTCGGGACACAGCATCATAATC B CTCTTTCGGGACACAGCATCATAATC C GAAAGGACAGAGAAGGTGCCAGTTG B TTCGGGACACAGCATCATAA D ATCAAACTGGAGGGAGCAGA... CCCTGAGGGCGCAGAGA GGGATGGCAAGGTTAGAAGCT ERBS GGAACAGACACCAGCATATCCA CCTCGGTTTCCCTTTCTTTGA ERBS GGCATAAGCTCTGTGCAAACAT CATTTCCATGGTGTTTTATTAAAGGA ERBS TGTTCTCTCCCTGCGAGTTGT GAAGGAGCGACGCAACCA ERBS AAGGAGTGGCTCCACAAAGTGT