THE MECHANISM OF PPARN3 MEDIATED DOWN REGULATION OF SODIUM HYDROGEN EXCHANGER 1 (NHE1) GENE EPXRESSION AND ITS INHIBITION BY ESTROGEN RECEPTOR n1 2

3. RESULTS 3A PPARγ-MEDIATED REGULATION OF NHE1 3A.1 PPARγ AND THE EXPRESSION OF NHE1 It has been shown that activation of peroxisome proliferator-activated receptor γ (PPARγ) inhibits proliferation of multiple cancer cells both in vitro and in vivo; however, the downstream targets responsible for this anti-tumorigenic effect remain unidentified. Our group previously identified a putative peroxisome proliferator response element (PPRE) in the promoter region of the Na+/H+ transporter gene NHE1. The first aim of this study was to investigate the role of NHE1 in PPARγ-mediated anti-proliferative effect in breast cancer cells and the mechanism by which PPARγ regulates NHE1 expression. 3A1.1 Identification of putative PPRE on NHE1 promoter As a classical nuclear receptor, PPARγ has been shown to be involved in transcription regulation of various target genes. The binding of the PPARγ to Peroxisome Proliferator Response Element (PPRE) either represses (Ricote et al., 1999) or activates (Barak et al., 1999) the target gene, depending on the cofactors recruited. To establish NHE1 as a bona fide target gene of PPARγ, we first examined the 5’proximal promoter region of human NHE1 for any presence of potential Peroxisome Proliferator Response Element (PPRE). The DNA sequence of NHE1 promoter kb upstream of the transcription start site was extracted from NCBI 68 http://www.ncbi.nlm.nih.gov. (Accession number: L25272). Consensus PPRE typically consists of Direct Repeat (DR) of AGGTCA spaced by one nucleotide (DR1). However, binding of PPAR to direct repeat of AGGTCA spaced by two nucleotides (DR2) has also been found in the promoter of myeloperoxidase (MPO) gene (Kumar et al., 2004). DNA sequence analysis for potential DR1 and DR2 revealed a putative PPRE in the human NHE1 promoter region between –977 to – 990 upstream of TATA box (Figure 1A). The putative PPRE is located in a primate-specific Alu reporter response element (AluRRE), which is reported to be recognized by different nuclear receptors (Vansant and Reynolds, 1995). Sequence alignment of AluRRE in NHE1 with that found in MPO revealed high sequence similarity (Figure 1B). The putative PPRE in NHE1 contains only one mismatch in nucleotide sequence compared to PPRE of MPO. Though not optimal, binding of PPARγ to DR2 was previously demonstrated on MPO promoter (Kumar et al., 2004). High sequence similarity between MPO and NHE1 PPRE predicts possibility of PPARγ binding to DR2 in NHE1 promoter, and subsequent regulation of NHE1 gene expressions in a similar manner as MPO gene. Besides high sequence similarity to DR2 in MPO, the hexamer sequence on NHE1 is identical to the first half of the consensus PPRE. Alignment with consensus PPRE (Figure 1B) highlights the exact match in the first hexamer sequence of identified NHE1 PPRE to that in classical PPRE. A list of known PPAR target genes containing the sequence of their corresponding PPRE was compiled in Table 1. As shown, majority of PPRE from literature composes of general DR1 consensus of AGGTCA N AGGTCA with a 69 few mismatches in nucleotides. This general pattern of 6-N-6 is relatively conserved in all PPREs, and the identified NHE1 PPRE bears high sequence similarities to these PPREs. In this section, we identified a putative PPRE –977 to –990 upstream of TATA box, after searching through NHE1 promoter for potential motifs of DR1 or DR2. (A) -1344 GGAATCGCATATCAAGCTTTCCAGTGATTCCATTGTACAGCCATGATCCCTTGAACCTCACCAA -1280 TTTCAACCAAACTATAGGTTCAAATTTAAGTTCCACTACTTAAAGCATGCCACTGTTGTGGGTT -1216 GAATTGTGTCCCGGCAAAAGAAGTTGAAGTCCTAATGCCCAGTGCCTATGAAGATGGACTAATT -1152 AGGATGCAGTCTTTGAAGATGTTCAGGTTAAGATGAGGTAATTACGTTGGATTTCTAATCCAAT -1088 GACTGGTGTCCTTATAAAAAGGGGAAATCTGGCTGGGGGTTGTGGCTTACCCCTGTAATCCCAG -1024 CACTTTGGGAGGCCGAGGCGGGTGGATCACCTGAGGTCAGGAGTTCGAGACCAGCCTGACCAAC -0960 ATGGTGAAACCCCATCTCTACTAAAAATACAAAAATTAGCTGGACGTGGTGGTGGGTGCCAGTA -0896 ATCCCAGCTACTCTGGAGGCTGAGGCAGGAGAATCGCTTGAATCCAGGAGGCAGAGGTTGCATT -0832 GAGCTGAGATGGCGCCACCGCACTCCAGCCTGGGCAACAAGAGCCAGACTCTATCTCAAAAAAA -0768 ATAAAAATAAAAATAAAGTGTGGGCGGGGAATCTGGACGCAGAGACAGAGACACCAGGAGAACT -0704 CCATGGAATACCAGATAGTCCTAACAAACCACTGGAAGGTAGGAGAAAGGCATGGGACAGATTC -0640 TCCCTCATAGCTCTCAGCTGAAACCAACCCTGCCAACACCTAGATCCGACCTCCAGCCTCCAGA -0576 ACTGTGAGACAATCAATTTCTGTTGTTGCAGCCACCCAGTTTGGGGTGATACTTTGTTACGGCA -0512 GCCCTAGTAAGCAATACAACTACTTGCATAGTAGCCAGGGGACTCTCTTCACCTGTTTCCTCAT -0448 CTGTAAAAGTGGAATTGTAATAATGTGCCAGGGTGCATTCCAAATAGTTTACACGGATTGTCTC -0384 AGTCATTACATCATCCCTCTGACATAGTCACTATTACTGTCTCTACTTAACAGATGAGAAAGTT -0320 GTGAAACAGGTTAAGTAACTTGCTCAAGGTCACACGGTAACTAAATACATAAACTAATAATACA -0256 TTCTTCACAGGATTATTCGAAAGCCCTTATGAGACTGCAGATGTGGACGTGAAATCGTTTTGTA -0192 AGTAGTCGGCATTTTACTCGCGTTAGTGAGGTTCTCTGTATATTCAGGACTTTTTTTTTTTTTT 70 -0128 TTTTTTGTCATCTCTGACTCTCCTTCCTCTTCCTACGCGATACTTCTTTCCCTCGGCGACAGGG -0064 GCCGCTGCGCTGGGCGGGTGCCGACGGTCTCTCTAGCCCGCCGCACCGGCTGCTCGCTGGTGCC -0000 TATAAGTGACAGCGCCGGGCTCAGCTAGGCTTCAGTCTGCTGCGGCC (B) Figure 1: Sequence Analysis of NHE1 Promoter (A) Sequence of 5’ proximal promoter region 1344bp upstream of human NHE1 gene was retrieved from NCBI (Accession # L25272). Bold denotes Alu element (Alusq) whereas TATA signal denotes start of gene. The underlined sequences are four hexamer repeats that are present in AluRRE. (B) The AluRRE of NHE1 promoter is aligned with AluRRE of myeloperoxidase (MPO) (Kumar et al., 2004).The putative PPRE in 5’ proximal promoter region of NHE1 is aligned with PPRE of PTEN (Patel et al., 2001) and the consensus PPRE. Gene name Consensus Species PubMED ID Cytochrome P450 A1 AGGGTA A AGTTCA Rat 7887901 Fatty acid binding protein(L-FABP) GGGGCA A AGGGCA Mouse 9933587 HMG-CoA synthase AGGCCA T Rat 1487072 71 AGGTCA Peroxisomal enoyl-CoA hydratase/3hydroxyacyl-CoA dehydrogenase AGGTCC T AGTTCA Rat 1502166 Cytochrome P450 A6 AGGGCA A AGTTGA Rat 1326542 Malic enzyme GGGTCA A AGTTGA Rat 7929410 Phosphoenolpyruvate carboxykinse(PEPCK2) GGGTGA A ATGTGC Mouse 7799943 Phosphoenolpyruvate carboxykinse(PEPCK1) CGGCCA A AGGTCA Mouse 7799943 Acyl-CoA oxidaseA AGGACA A AGGTCA Rat 1537328 Adipocyte lipid binding protein (ALBP/aP27) GGATCA G AGTTCA Mouse 7926726 Acyl-CoA oxidaseB AGGTAC A AGGTCA Mouse 1537328 Acyl-CoA synthase AGGGCA T CAGTCA Rat 7642600 Muscle-type carnitine palmitolytransferase AGGGAA A AGGTCA Human 9535828 c-Cbl-associating protein AGGCTA A AGGTCA Mouse 10734046 Fatty acid transport protein GGGCCA A AGGTCT Rat 7913466 Lipoprotein lipase GGGGGA A AGGGCA Human 8895578 Uncoupling protein I TGGTCA A GGGTGA Mouse 8668156 Table 1: PPRE sequences from literature (Adapted from Venkatachalam et. al., 2009) (Venkatachalam et al., 2009) 72 3A1.2 Down-regulation of NHE1 by PPARγ ligands. Intrigued by the presence of putative PPRE on NHE1 promoter, we next assessed the effect of PPARγ ligands on NHE1 expression both at protein level and mRNA level. To this end, three human breast cancer cell lines, MCF-7, MDA-MB-231 and T47D were selected to be exposed to various PPARγ ligands at different doses. The three cell lines express different levels of endogenous PPARγ receptor (Figure 2D). Prostaglandin J2 and its derivatives are reported to be activators of peroxisome proliferator-activated receptors α and γ (Kliewer et al., 1995). Among them, the PGJ2 metabolite 15-deoxy-12,14-PGJ2 has been identified to be the most potent endogenous ligand for PPARγ. It is found to bind directly to PPARγ receptor and elicit efficient differentiation of C3H10T1/2 fibroblasts to adipocytes (Lehmann et al., 1995). The effect of 15d-PGJ2 on NHE1 protein expression was analyzed using Western blot. The result showed that after 24h of exposure to 1µM, 3µM and 5µM of 15d-PGJ2, the NHE1 protein decreased in a dose-dependent manner in MCF-7 cells (Figure 2A). Besides the endogenous PPARγ ligand, thiazolidinedione (TZD) is a class of synthetic PPARγ ligands which are clinically available for treatment of type diabetes. Members of TZDs include troglitazone, rosiglitazone, and pioglitazone, marketed as Rezulin, Avandia and Actos respectively. Ciglitazone though not available in market, is a prototypical compound for the TZD class. To investigate 73 if these synthetic PPARγ ligands produce similar effect of repressing NHE1 protein expression, MCF-7 cells were treated with troglitazone at increasing doses for 24h. Immunoblotting of the NHE1 protein showed similar dose-dependent decrease in NHE1 protein level (Figure 2B). These data suggest that the effect of PPARγ ligands on NHE1 protein is not drug specific, but is conserved in both the endogenous and synthetic PPARγ ligands.The difference in extent of NHE1 repression by 15d-PGJ2 and synthetic PPARγ ligands may be attributed to the different affinities of these ligands for PPARγ receptor (Boitier et al., 2003). To further demonstrate that the down-regulation of NHE1 protein expression was not cell type specific, MDA-MB-231 and T47D were treated with 3µM and 5µM of 15d-PGJ2 for 24h. In agreement with the results obtained for MCF-7, Western blot analysis of NHE1 protein showed similar dose-dependent down-regulation of NHE1 protein level in both cell lines (Figure 2E). Interestingly, the levels of PPARγ protein in these three cell lines are ranked in the order of MDA-MB-231> MCF-7> T47D (Figure 2D). This difference in PPARγ expression correlated well with the repressive efficacy of 15d-PGJ2 on NHE1. In T47D cells that contain lowest level of PPARγ receptor, 15d-PGJ2 showed the least pronounced effect on NHE1 repression, while in MDA-MB-231 cells which express the highest amount of PPARγ, the same drug induced the most significant down-regulation of NHE1. To further verify that the reduction in NHE1 protein level was a result of transcriptional repression of NHE1 gene, we quantified the mRNA expression of NHE1 using real-time PCR. Cells were treated with various PPARγ ligands for 16h, before the total RNA was extracted and analyzed for its mRNA content. 74 Consistent with the results obtained for NHE1 protein expression, mRNA expression of NHE1 decreased in a concentration-dependent manner in MCF-7 cells treated with various PPARγ ligands. It is noteworthy that 15d-PGJ2, as in the case of NHE1 protein expression, remained to be the most efficacious in downregulating NHE1 mRNA compared to troglitzone and ciglitazone: 3µM of 15dPGJ2 induced 55% decrease from the vehicle control (Figure 3A), whereas the similar extent of reduction was only achieved at 15µM of troglitazone and at 10µM of ciglitazone respectively (Figure 3B, C). In agreement with the result of NHE1 protein, NHE1 mRNA in MDA-MB-231 cells was also more sensitive to repression by 15d-PGJ2-induced PPARγ activation compared to MCF-7 cells. In MCF-7 cells treated with 5µM of 15d-PGJ2, NHE1 mRNA level decreased to 40% of the vehicle control, while the same concentration reduced NHE1 mRNA to 20% of the vehicle control in MDA-MB-231 cells (Figure 3D). These data again demonstrated that the repressive efficacy of PPARγ ligand on NHE1 expression in different cell lines mirror-imaged the endogenous level of PPARγ receptor present. Together, these results confirm that PPARγ agonists down-regulate NHE1 protein as well as mRNA in three breast cancer cell lines. 75 76 Figure 2: PPARγ ligands down-regulate NHE1 protein levels in human breast cancer cells. MCF-7 (3 X10 cells/6-well dishes) were exposed to different PPARγ ligands: (A) 15d-PGJ2, (B) troglitazone for 24h, and the protein expression of NHE1 was analyzed by Western blot. (C) MDA-MB-231 (2X105 cells/6-well dishes), and T47D cells (3 X105 cells/6-well dishes) were treated with increasing doses of 15dPGJ2. NHE1 protein expression was then determined by Western blot, NHE1 band intensity was normalized to β-actin. (D) MCF-7 (3 X105 cells/6-well dishes), MDA-MB-231 (2X105 cells/6-well dishes) and T47D cells (3 X105 cells/6-well dishes) were subjected to nuclear-cytosol fractionation as described in Materials and Methods. The PPARγ levels in nuclear lysates were analyzed by Western blot, using PARP as a loading control. 77 94 Figure 8: PPARγ binds to NHE1 promoter upon 15d-PGJ2treatment. (A) MCF-7 (1.78 X 106/100mm dish) and (B) MDA-MB-231 (1.7 X 106 cells/100mm dish) cells were exposed to 3M 15d-PGJ2 for 4h before harvesting for nuclear-cytosol fractionation as described in Materials and Methods. The NoShift™ Transcription Factor Assay was utilized for determination of endogenous PPARγ binding to putative PPRE as described in Materials and Methods. 20g of nuclear lysate was incubated with 10pmol of biotinylated NHE1 PPRE oligonucleotides in the absence or presence of 50pmol of nonbiotinylatedNHE1 PPRE oligonucleotides. Results denote means +/-SD computed from three experiments. (C) MCF-7 (5.4 X 106/150mm dish) cells were treated with 3M 15d-PGJ2 for 4h before they are harvested for Chromatinimmunoprecipitation (ChIP) assay as described in Materials and Methods. Sheared chromatin was immunoprecipitated using a PPAR antibody (anti-PPAR). Occupancy of PPARγ on NHE1 promoter and PTEN promoter was analyzed by real-time PCR as relative to input. Results denote means +/-SE computed from three experiments. *, p[...]... both synthetic and endogenous ligands of PPARγ were capable of inducing down- regulation of PPARγ NHE1 and mRNA Among them, the inhibitory effect was the most pronounced in cell lines expressing higher level of PPARγ receptor These observations lead to the speculation of PPARγ receptor s involvement in PPARγ ligand-induced downregulation of NHE1 The data obtained from PPARγ- overexpressing T47D further... antagonist to confirm the role of PPARγ receptor in PPARγ ligand- 88 mediated down- regulation of NHE1 gene expression Besides, the presence of the putative PPRE on NHE1 promoter and PPARγ ligands’ ability to down- regulate NHE1 mRNA further implied NHE1 as a transcriptional target of PPARγ To test the involvement of transcriptional activity of PPARγ in its inhibitory effect on NHE1 expression, we overexpressed... the effect of NAC on 15 d-PGJ2 -mediated repression of NHE1 mRNA transcripts using real-time PCR Consistent with the data of protein expression, NAC itself resulted in 40% up -regulation in NHE1 mRNA and further treatment with 15 d-PGJ2 lead to 42% decrease in NHE1 mRNA from the control treated with NAC alone (Figure 11 C) In contrast, 15 d-PGJ2 caused 61% reduction in NHE1 mRNA in the absence of NAC We reasoned... OF PPARγ -MEDIATED DOWN- REGULATION OF NHE1 After establishing the crucial role of activated PPARγ receptor in down- regulating NHE1 expression, we set out to investigate the mechanism involved in the repression of NHE1 by PPARγ 3A2 .1 Transcription-defective PPARγ abrogates the effect of PPARγ ligand on NHE1 gene expression From previous sections, we used PPARγ overexpression, PPARγ silencing and PPARγ... block the effect of 15 d-PGJ2 on NHE1 expression at higher concentration of 5µM This phenomenon could be explained by incomplete 83 knocking down of PPARγ receptor and its stronger activation at higher concentration of the ligand, leading to the observed reduction in NHE1 protein from the untreated control The inhibition on NHE1 protein in PPARγ-silenced cells at higher concentration of 15 d-PGJ2 could... PPARγindependent effect of the ligand The PPARγ-indepedent mechanism of PPARγ ligand -mediated inhibition on NHE1 will be further discussed in later sections Figure 5: Silencing PPARγ attenuates the inhibition of 15 d-PGJ2 on NHE1 expression MDA-MB -2 31 (1. 5 X 10 5 cells/6-well dishes) cells were transfected with 20 0ng of PPARγ Si RNA or control Si RNA as described in Materials and Methods 48h after transfection,... PPARγ but not other PPAR subtypes After establishing the function of GW96 62 as a PPARγ antagonist, we tested its ability to rescue the inhibitory effect of PPARγ ligand on NHE1 expression MDA-MB -2 31 cells were pre-incubated with GW96 62 for 2h, before they were exposed to increasing doses of 15 d-PGJ2 Western blot and real-time PCR assays were then performed to assess the NHE1 protein and mRNA level... the effect of PPARγ ligand on NHE1 82 Another means to assess whether the observed down- regulation of NHE1 expression was mediated by PPARγ receptor was by silencing PPARγ protein PPARγ silencing was performed in MDA-MB -2 31 cells as described in Materials and Methods with scrambled si RNA as a negative control or with PPARγ si RNA These two cell lines were chosen because they express higher level of. .. in both MDA-MB -2 31 cells (Figure 5) However, the reversal of the downregulation of NHE1 by silencing was more significant at 3µM than 5µM of 15 dPGJ2 In silenced cells, exposure to 3µM of 15 d-PGJ2 showed no significant reduction in NHE1 protein level from the untreated control On the other hand, 3µM of 15 d-PGJ2 drastically down- regulated NHE1 protein in cells transfected with negative si RNA It should... to the 15 d-PGJ2 alone, pre-treatment with 50µM FeTPPS successfully shifted the fluorescence histogram back to that of the control (Figure 10 A) A quantitative representation of the G-mean values of the DCF fluorescence expressed in terms of percentage of the unteated control similarly showed a significant increase in ROS/RNS production by 3µM of 15 d-PGJ2 alone and its abrogation by FeTPPS (Figure 10 B) . 3A1.4 Silencing PPARγ abrogates the effect of PPARγ ligand on NHE1. 83 Another means to assess whether the observed down- regulation of NHE1 expression was mediated by PPARγ receptor was by. al., 19 95). The effect of 15 d-PGJ 2 on NHE1 protein expression was analyzed using Western blot. The result showed that after 24 h of exposure to 1 M, 3µM and 5µM of 15 d-PGJ 2 , the NHE1 protein. extent of NHE1 repression by 15 d-PGJ 2 and synthetic PPARγ ligands may be attributed to the different affinities of these ligands for PPARγ receptor (Boitier et al., 20 03). To further demonstrate