tóm tắt luận án chọn giống lúa và kỹ thuật canh tác lúa cho mô hình lúa - tôm ở tỉnh bạc liêu (tiếng anh)

24 Withdrawal of water for dried before harvesting 7 - 10 days for easy harvesting. (v) Fertilization: Amount of fertilizer used for 1ha: 300 - 350 kg of phosphate; 60 - 100 kg urea; 100 - 130 kg of NPK (20 - 20 - 15); (vi) Pest control: application of integrated pest management measures IPM. 4.2 Suggestion (i) Areas for rice production with 3 high-yielding rice varieties (OM5629, OM6677, OM6377) and four seasonal rice varieties (Mot Bui Do, Nang Thom muon, Rach Gia, Tai Nguyen (TG)). (ii) Procedures of rice cultivation in the model of rice - shrimp in Bac Lieu should be applied to assess effectiveness. INTRODUCTION 1. Necessity of the thesis Saline soil in the Mekong Delta of Viet nam has achieved 740.000 ha, after alluvial soil and acid sulphate soil (Nguyen Bao Ve et al., 2005). “Bac Liêu” province has natural soil about 2,594 km2, sea coast extends 56 km, low and flat very suitable to develop agriculture cultivation and aqua-culture, with realizable common model of rice-shrimp farmers have been become their attractiveness and mode of production (Huynh Minh Hoang and Lam Van Khanh, 2004). However, after applying this model of rice-shrimp some environmental problems of environment have become barriers and sustainability (Vo Tong Xuan, 1995). Increasing quickly the model of rice-shrimp, applying experienced cultivation, lacking rice varieties tolerant to salinity and concerning scientific research as well (Ho Quang Cua, 2009; Nguyen Thi Thanh Tam and Nguyen Thanh Binh, 2009) would be the main causing soil salinization, environment degradation, and decreasing rice yield, hence low economic input in these areas. In recent years, scientific researchers have commonly been applied new modern techniques to rice breeding tolerant to salinity, especially DNA technique (Nguyen Thi Lang et al., 2001). In parallel, cultivation procedure accompanied with rice tolerant to salinity will help to limit the effect of salinity on rice yield and maintain soil sustainability as well. 2. Purposes of this thesis (i) Selecting high yielding rice varieties and local seasonal rice adapted well to the model of rice-shrimp (ii) Building rice cultivation techniques based on combining from farmers experience, surveying soil-water characteristics and experimental results. 3. Objectives and researching scope. Surveying households cultivating with model rice-shrimp; local seasonal rice; and high yielding rice varieties testing and producing in the Mekong Delta would be selected out for tolerance to salinity. Researching scope was “Bac Lieu” province. 4. Contributions of the thesis - Three high yielding rice varieties (OM5629, OM6677, OM6377), four local seasonal rice varieties (Mot Bui Đo, Nang Thom muon, Rach Gia, 2 Tai Nguyen (TG)) could be well tolerant to salinity, long grain, average amylose contents, total protein contents were above 9% . - Built a cultivation procedure for the model of rice-shrimp in the Bac Lieu province - Characters of water and soils in the model of rice-shrimp affected on rice cultivation. - Effect of water management on saline soil after raising shrimp; type and dose of calcium application to rice growth and yield. 5. Outline of the thesis The thesis were 155 pages including 4 chapters with 31 tables, 36 figures and 7 appendix, 203 references were referred. CHAPTER 1 OVERVIEW DOCUMENTS 1.1 Effects of salinity on rice Salinity causes several symtoms on rice such as leaves appeared white at the top due to (saline soil); brown leaves and died (sodic soil); growth delayed, weak root growth , rolled leaves, sterile grain, low harvest index, low yield. As for rice, characteristic of tolererance to salinity is a complex physiological process, changed according to different growth steps ( Akbar et al., 1972). 1.2 Breeding rice for tolerance to salinity 1.2.1 Research on inheritance to saline tolerance Bohnert et al.(1996), already suggested a strategy to breed rice tolerant to salinity, in which protein should be stable; proline with function to minimize osmotic stress. As for tolerance to salinity, genes control transport kalium, K + / Na + high played an important role to saline tolerance (Rubio et al., 1995). Rice tolerant to salinity often had the ratio K + /Na + >1while sensitive one at shoot and root had the ratio K + /Na + <1. Water influx, water channel control under stress conditions were signals of growth regulator (Bohnert et al., 1996). Protein often appeared at seed mature stage: LEA and dehydrin, this protein was believed that an important element in resistance to stress from saline and drought (Xu et al., 1996). 1.2.2 Some results on rice breeding for saline tolerance 1.2.2.1 World achievements Plant breeding tolerant to salinity should be optimal and less cost (Ashraf and Foolad, 2007), Ponnamperuma (1984), Tolerance to salinity was a 23 * On the basis of rice –shrimp cultivation procedures, changes in soil and water characteristics in the model of rice - shrimp in Bac Lieu province, and experimental results had made, procedures of rice cultivation in the model of rice- shrimp were synthesized used as a procedure for rice cultivation in the model of rice-shrimp: (i) Seasonal crop: Annual seasonal cultivating of a crop from August to December. Before rice crop beginning, one should spend 15 - 30 days for soil preparation in order to improve soil in the pond. (ii) Preparing land: The end of shrimp crop, use rain water or canals to keep on the paddy field from 10 to 20 cm. When rain arriving, one should drain water to desaline from 9 - 20 times in 15 - 20 days, rake and land soaking around 7 - 10 days to wash more salty soil before sowing or transplanting. As for lands covered with 10 cm of silt sediment annually plowing is not required, just clean up the weeds before transplanting from 5 - 7 days. During the land preparation, apply fertilizer with type of calcium CaSO 4 (gypsum) with a dose of about 550 kgha -1 or calcium type of CaO (calcined limestone) at a dose of 450 kgha -1 to help improve rice ability to saline tolerance, improve productivity and avoid soil salinization after their rice – shrimp cultivation. (iii) sowing: Sowing rice seeds in May, June and transplanted in late June or early July with l ¬ nursing from 50 - 60 kg to 1,000 m2 for transplanting one hectare; or direct sowing 100 - 120 kg / ha for high yielding rice;, or from 40 - 60 kg / ha for seasonal rice; (iv)Water management: Avoid leakage of water or saline water intrusion during rice cultivation. Before sowing one should drain water, small furrow dried up. When the rice grows from 5 - 7 days, submerge water according to the height of rice plant, kept water at 10 - 20 cm. If there have big rains, continue to drain water to wash salinity and keep this water level during the growth and development of rice. 22 Table 3.31 Amount of fertilizer used per hectares for high yielding rice Time (day after sowing) Super phosphate (kg) Urea (kg) NPK (20-20-15) (kg) Basal fertilizing 300 - 350 - - 5 – 7 - 30 – 50 - 20 – 25 - 30 – 50 50 - 65 40 – 45 - - 50 - 65 - Pest control: Application of integrated pest management (IPM) as follows: use of resistant varieties, well soil preparation, reasonable season, appropriate sowing or transplanting density, fertilizing application of balanced NPK to reduce to a minimum the harmful effects from objects on rice pest. Spraying of pests and diseases on the principle of four rights: the right chemical, right time, right quantity and the right way. CHAPTER 4 CONCLUSIONS AND RECOMMENDATIONS 4.1 Conclusion * Through research on selection for the model of rice-shrimp in Bac Lieu province, some results were achievements as follows: (i) Three high-yielding rice varieties with good saline tolerance, long grain , low amylose was low or average, protein content > 9% were: OM5629, OM6677, OM6377 and (ii) Four seasonal rice varieties with good saline tolerance, long grain, (6.6 - 7, 5mm), medium amylose content and the protein content > 9%, such as Nang Thom muon, Tai Nguyen (TG), Mot Bui Do, Rach Gia. 3 component of evaluation and genetic uses, they suggested 8 steps as follows: (1) screening should clearly range from 8 to 10 dSm -1 at 25 o C. Percentage of leaf death is an estimated value measuring damage due to salinity. (2) Receiving genetic source tolerant to salinity. (3) Combining tolerant to salinity with other good agronomic characteristics. (4) Testing rice varieties tolerant to salinity. (5) Evaluating in paddy fields and selecting out varieties/lines able to tolerant to salinity having good characterisitcs such as resistance to pests, high yield, good quality etc. (6) Evaluating in International level in many countries. (7) Carrying out experiments for yield under controlled fields. (8) Testing on farmer paddy fields. 1.2.2.2 Some achievements in Viet Nam * Select on traditional seasonal rice: From 1992 to 1995, Southern Science-Agriculture Institute selected 88 seasonal varieties, 100 high yielding rice, in which pokkali was used as control for tolerance to salinity; PTB 33 as a resistant source of brown plant hopper. Bong et al.,(1996), was already carried out with 15 rice varieties, results showed that: (i) Rice seed germination in saline solution 1.5% (24,4 dSm -1 ), OM1630-50 germinated at maximum rate of 81%. (ii) Saline tolerance at different concentrations of 4,8,12,16 dSm -1 , results showed that all of rice could not survive at 16 dSm -1 . At 12 dSm -1 , pokkali and “ Than nong do” were tolerant to high salinity. At Cantho University also tested seasonal rice, results also showed that at seedling stage some varieties could tolerate at 10 dSm -1 such as “Nang Co do”, “Than Nong do”, ”Soc Nau”, “ Ba Xuyen”, “ Nep Ruoi moc”. * Select with high yielding varieties tolerant to salinity Southern Science Agriculture Institute researched on ability to saline tolerance of several rice varieties in “Bac Lieu” province and “Ca Mau”, results showed that Mashuri 5, Khao dawk Mali and OM723-11E gave high yield and good saline tolerance (Phan Hong Thai et al., 1997). Pham Thi Phan (1999) showed that MTL119 variety could adapt well in the model of rice-shrimp- sensitive saline soil along coastal areas of Soc Trang, Bac Lieu. Also, in 1998 she showed MTL384, MTL466, MTL480, MTL521, MTL547 could tolerate to acid sulphate soil and saline 4 conditions. Ngo Dinh Thuc (2006) researched on 127 producing rice varieties, he screened them at EC=30 dSm -1 , seedling stage at 12 dSm -1 and observed yield, adaptibility to paddy fields sensitive to acid sulphate and saline soils; results showed that VD20, ST3, OM3536, Klong Kluang, ST2 could tolerate well; and OM2395, DS2001 could tolerate to light acid sulphate and saline soils * Common rice varieties in the model of rice –shrimp Nguyen Ngoc De et al. (2003) selected rice adapted to model of rice- shrimp in “Soc Trang” (My Xuyen district), Bac Lieu (Gia Rai), Mekong Delta of Viet Nam from 1997 to 1998. They showed that MTL119 could tolerate well to those conditions. Some other varieties could adapt well to abnormal rainfall areas such as “ Mot Bui Do”, AS996, OM4498, OM2517 (Pham van Du, 2009; Phan Minh Quang, 2009). 1.3 Applying technique for selection with saline solution at 6‰ Screening saline tolerance at seedling stage should be done with 6 stages (Aslam et al., 1993) as follows: (i) Choose filled grains with well viability, none dormancy, no disease (ii) Treatment seeds with HCl 0.1% during 15 minutes. (iii)Clean with distilled water at least 3 times. (iv) Put 20 seeds per petri dish having filter paper. (v) Pour 6 ‰ NaCl solution to petri dish, and distilled water used as control, then incubate at 28 0 C, and (vi) Use Pokkali as satandard tolerant to saline and IR28 or IR29 as sensitive to salinity. 1.4 Apply DNA electrophoresis (microsattelite) Nguyen Thi Lang et al.(2001) showed that this technique could help rice breeders to get high successfulness in a short time. The author used with a pair of primer 223 as follows: forward primer with nuclotide sequence “GAGTGAGCTTGGGCTGAAAC” and reward primer “GAAGGCAAGTCTTGGCACTG”, standard variety tolerant to salinity used was “Doc Phung”, and sensitive one was IR28. 21 - Preparing land: (1) The end of shrimp crop, use rain water or canals to keep on the paddy field from 10 to 20 cm. Before rice crop beginning, one should spend 15 - 30 days for soil preparation in order to improve soil in the pond. When rain arriving, one should drain water to desaline from 9 - 20 times in 15 - 20 days, rake and land soaking around 7 - 10 days to wash more salty soil before sowing or transplanting. As for lands covered with 10 cm of silt sediment annually plowing is not required, just clean up the weeds before transplanting from 5 - 7 days; (2) During the land preparation, apply fertilizer with type of calcium CaSO4 (gypsum) with a dose of about 550 kg / ha or calcium type of CaO (calcined limestone) at a dose of 450 kg / ha to help improve rice ability to saline tolerance, improve productivity and avoid soil salinization after their rice – shrimp cultivation. - Select rice varieties and cultivation techniques: (i) Select rice varieties with ability to saline tolerance: Use seasonal rice such as “Mot Bui do”, Rach Gia, Tai Nguyen (TG) or high yielding rice OM6677, OM5629; (ii) sowing: Before sowing, drain water in the paddy field for drying fields, in the sunny days, one should replace frequently in order to decrease temperature and limitation of salinity damage to rice; (iii) Rice Quantity: 100 - 120 kg of rice varieties (high yielding rice) sowing per 1ha, from 40 - 60 kg of rice seeds (seasonal rice) per ha; Sowing seeds in May, June and transplant in late June or early in July, seed quantity from 50 - 60 kg used for sowing for 1000 m 2 to transplant one hectare; (iv) Water managing: Avoid leakage of water or saline water intrusion during rice cultivation. Before sowing one should drain water, small furrow dried up. When the rice grows from 5 - 7 days, submerge water according to the height of rice plant, kept water at 10 - 20 cm. If there have big rains, continue to drain water to wash salinity and keep this water level during the growth and development of rice. Withdrawal of water for dried before harvesting 7 - 10 days for easy harvesting. - Fertilizer: Fertilizing for rice are presented in Table 3.31 20 Non-application 4,52b CaSO 4 5,49a CaO 5,38a Ca(NO 3 ) 2 4,74b F ** CV (%) 7,43 Level of application (B) 1 5,28a 2 4,93b 3 4,88b F ** CV (%) 7,43 In a column, means with the same letters do not differ significantly at the level 1% by DMRT 3.3.8 Composing techniques of rice cultivation in the model of rice- shrimp On the basis of rice –shrimp cultivation procedures, changes in soil and water characteristics in the model of rice - shrimp in Bac Lieu province, and experimental results had made, procedures of rice cultivation in the model of rice- shrimp were synthesized as folows: 3.3.8.1 Paddy field preparation Land used for rice – shrimp cultivation, design channels and ponds from 20 - 25% of the total land area. Ditch should be around 2 - 3 m, depth 1 - 1.2 m. Dike ranging from 2 - 2.5 m; higher than the highest tide level of 0.5 - 0.6 m, to be sure that flooding in the fields from 0.6 to 0.8 m. The side channel from 1 to 2 m wide and ensure the submerged level from 0.7 to 0.8 m, downward to the direction of drainage. Each pond should be 1 - 2 rains should be built. 3.3.8.2 Rice cultivation techniques - Seasonal: Seasonal cultivating of a crop from August to December per year 5 CHAPTER 2 THE CONTENT, MATERIALS AND METHODS 2.1 Content and method: 3 content was done 2.11 Investigate household characteristics and economic performance: Survey randomly rice farmer – shrimp, votes has been prepared in advance were used in four districts: Hong Dan, Phuoc Long, Rai and Vinh Loi, in each district chosen randomly 90 farmers for investigation, total 360 questionnaire votes. 2.1.2 Select high yielding varieties tolerant to salinity (17 varieties) and seasonal rice varieties (56 varieties): (i) test salt tolerance of 17 high-yielding rice varieties with salt concentration at 6 ‰; (ii) Screen varieties tolerant to salinity by Yoshida nutritional solution (IRRI, 1997) with added salt at 6‰ NaCl; (iii) Evaluation of growth and yielding; (iv) Assessing the quality of rice, and (v) Using DNA electrophoresis method. 2.1.3 Rice cultivation technique in the model of rice - shrimp: (i) Survey cultivation technique on the model of rice - shrimp; (ii) Survey shrimp cultivation technique; (iii) Estimate water characteristics during experiment; (iv) Estimate some chemical properties of soil; (v) Manage water on saline soils after the shrimp season affected to rice yield; (vi) Affect types of Ca 2+ fertilizer on the production of proline in rice; (vii) Affect types and doses of Ca 2 + on the growth and yield, and (viii) Build a general model of cultivation techniques for the model of rice-shrimp. 2.2 Materials Varieties/lines of rice: 56 Group season rice varieties in the Department of Genetics Faculty of Agriculture and shud, CTU, 17 short-term high- yielding rice varieties and 01 varieties of salt tolerance standard, 01 standard varieties salinity of Rice Institute Delta, 01 standard varieties salinity of the International Rice Research Institute (IRRI); Chemicals: NaOH, ethanol, Coomassie brilliant blue, mercapthoe-thanol, acrylamide, bis-crylamide, ammonium persulfat, BSA protein standard 6 2.3 Methods Agronomic traits, yield components and the quality of rice: Methods of measurement (hand, tools specialized for each trait). Check the saline tolerance by DNA electrophoresis methods (microsatellite) with forward primer 223 with sequence nucleotide GAGTGAGCTTGGGCTGAAAC and reverse primer 223 with sequence nucleotide GAAGGCAAGTCTTGGCACTG. Grouping of saline tolerance by DNA electrophoresis methods demonstrated by the appearance of DNA electrophoresis band of the same DNA standard variety control. Analysis: amylose by IRRI methods (1978), total protein by the Lowry method (1951); samples of soil and water by the method of chemical analysis indicators (Clesceri et al., 1998) 2.4 Statistical Treatment The data were processed using SPSS statistical software. Analysis of variance (ANOVA) to detect differences among treatments, compared to the average values by Duncan range method or LSD. CHAPTER 3 RESULTS AND DISCUSSION 3.1 Household characteristics and economic efficiency of the model of rice - shrimp in Bac Lieu 3.2 Select rice varieties tolerant to salinity for cultivation in the model of rice- shrimp in Bac Lieu 3.2.1 Select high-yielding rice varieties tolerant to salinity for the model of rice-shrimp 3.2.1.1 Test saline tolerant ability of 17 high yielding varieties with 6‰ NaCl Treatment concentration of 6 ‰NaCl showed all of 17 promising high yielding varieties were germinated; however, rate of germination were distinct depending on varieties (Table 3.6). This result were suitable to the results of Pearson et al. (1966) conclusion. 19 At the beginning of the rice season due to less rainfall, soil salinity should not be washed of the EC value before sowing was 13.2 mScm -1 , this value could affect on growth rice. However, after rice sowing changes in EC values decreased gradually, to the period of 30 days after sowing, the soil EC values of all treatments ranged from 3.35 - 4.35 mScm -1 and significantly different at 1%. Treatments applying CaSO 4 had the lowest EC (3.35 mScm -1 ) compared with no fertilizer treatments Ca 2+ (4.17 mScm -1 ) or applying with CaO (4.35 mScm -1 ). At rice harvesting, EC water of all treatments ranged from 2.57 - 2.71 mS cm -1 and did not differ significantly. This suggested that, at harvest EC of the treatments were reduced by washing the saline many times, this result was consistent with Khattak et al. (2007), Nguyen Huu Kiet et al. (2010). 3.3.7.7 The effect of calcium on rice yield Salinity caused a significant reduction in rice yield. Yield among treatments ranged from 4.52 to 5.49 tons ha -1 was significantly different (Table 3.30). Application of Ca 2+ in the different levels would give yield significantly different at the 1% .Results showed that rice yields achieved 5.28 tons ha -1 at level 1 of applying calcium, higher than level 2 of applying calcium to 4.93 tons ha -1 and 3 to 4.88 tons ha -1 , which was consistent with the report of Aslam et al.(2000), Khan et al. (2007), Le Huy Vu (2008). The different types of Ca 2+ also leds to productivity differences among the treatments at 1%. Rice yield from the type of CaSO 4 (5.49 ton ha -1 ) and CaO (5.38 tons ha -1 ) was higher than the type of Ca(NO 3 ) 2 ( 4.74 ton ha -1 ) or no fertilizer (4.52tons ha -1 ). Application of CaSO 4 and CaO increased rice yield by 21.6% and 19.1% compared to no applying of fertilizer calcium, which was also consistent with the report of Shah et al. (2003). Table 3.30 Effect of type and level application of calcium on rice yield Treatment Practical yield (ton/ha) Type Calcium (A) 18 number of salt ions in soil colloids, particularly Na + ion. Sodium being removed from the land washed by removing the water several times. 3.3.6.9 Effect of the types of calcium applying to rice yield Grain yield was significantly affected by salinity 10‰ and statistically significant difference at the 1% level among treatments (Table 3.27). The highest yield obtained from control treatment (4.47 g/pot), next was fertilizer treatments Ca(NO 3 ) 2 1.92 g/pot, higher than CaSO 4 fertilizer treatments (1,55g/pot) and CaO (1.32 g/pot), and the lowest yield of 1.29g/pot in treatments without fertilizer Ca 2+ . Results showed that the saline irrigation for paddy rice yield was significantly reduced compared with treatment control (non saline irrigation). The applying Ca 2+ , type Ca(NO 3 ) 2 has maintained a higher yield than the form CaSO 4 và CaO, particularly higher than dipping saline treatment but non aplying with calcium (Khattak et al., 2007). Table 3.27 Effect of type calcium on rice yield Treatment Practical yield (g/pot) Control 4,47a Saline - 0 Ca 2+ 1,29d Saline - CaSO 4 1,55c Saline - CaO 1,32cd Saline - Ca(NO 3 ) 2 1,92b F ** CV (%) 6,18 In a column, means with the same letters do not differ significantly at the level 1% by DMRT 3.3.7 Effect of the type and dose of calcium fertilizers on the growth and yield OM6677 3.3.7.1 Change in EC value in the field experiments 7 Table 3.6 Ratio (%) of germination, survival and death after treament with 6‰ NaCl. Ratio (%) seedling development after 8 days in saline solution Ord. Name Ratio (%) germinated after 3 days in saline solution survival death 1 OM4900 100 90,0 10,0 2 OM5629 100 100 00 3 OM5900 100 95,0 5,0 4 OM5981 100 95,0 5,0 5 OM6055 100 90,0 10,0 6 OM6065 95 75,0 20,0 7 OM6070 100 75,0 25,0 8 OM6073 95 75,0 20,0 9 OM6162 100* 95,0 5,0 10 OM6377 100 100 00 11 OM6677 100 100 00 12 OM6877 100 95,0 5,0 13 OM7345 95 80,0 15,0 14 OMCS2009 100 80,0 20,0 15 HĐ 95 90,0 5,0 16 TP2 100 85,0 15,0 17 VD20 95 85,0 10,0 18 Doc Phung (tolerant control) 100 100 00 19 IR28 (sensitive control 100* 85,0 15,0 20 IR29 (sensitive control 90,0* 70,0 20,0 * low germination, unequal After 8 days germination checking four rice varieties germinated 100%, including 4 varieties OM5629, OM6377, OM6677 and standard saline tolerant rice control was Doc Ph ụng. Vo Cong Thanh (2009) used sensitive standard control IR28 or IR29. From experiment with salinity at 6‰, nine rice varieties germinated 100% after 3 days tested; there were 9 varieties still survived over 90%, they were OM4900, OM5629, OM5900, OM5981, OM6055, OM6162, OM6377 , OM6677 and OM6877. Those were testing in the paddy fields, IR28 and IR 29 were used as sensitive controls. 8 3.2.1.2 Evaluation on yields of nine varieties in saline soils at two villages in Gia Rai district, Bac Lieu province. At site 1, we did the experiments at two villige (Phong Tan 1 and 2). Results showed that OM6677 was the highest yield while in site 2, Phong thanh, OM5629 was the highest, next was OM 6377 (Table 3.9). Table 3.9 Practical yields of 9 rice varieties tolerant to salinity at three sites in Gia Rai district, Bac Lieu province Yield (ton ha -1 ) Ord. Name Phong Tân 1 Phong Tân 2 Phong Th ạnh 1 OM4900 3,35bc 3,35bc 4,10c 2 OM5629 4,67a 4,67a 5,80a 3 OM5900 3,35bc 3,35bc 3,62cd 4 OM5981 2,75cd 2,75cd 3,83c 5 OM6055 2,40de 2,40de 2,86de 6 OM6162 3,08bc 3,08bc 3,63cd 7 OM6377 3,44b 3,44b 4,32bc 8 OM6677 4,71a 4,71a 5,00b 9 OM6877 2,97bcd 2,97bcd 3,80c 10 IR28 1,94e 1,94e 2,35e 11 IR29 2,09e 2,09e 2,21e F ** ** ** CV(%) 10,65 10,65 12,17 In a column, means with the same letters do not differ significantly at the level 1% by DMRT. OM5629 rice yield was 5.8 tons ha -1 , higher than OM6055, IR28, IR29. The average yields of each experiment was 3.4 tons ha -1 . Actually, data collected in Phong Thanh showed that yields of 11 varieties used in the experiment were significantly different by statistical analysis (Table 3.9), the highest was OM5629 5.8 tons ha -1 , the lowest IR29 (control), 2.21 tons ha -1 , average yield was 3.77 tons ha -1 . In summary, by evaluation on the growths and yields of 9 selected salt- tolerant rice varieties were 3 varieties OM6377, OM6677 and OM5629; they were more productive varieties than the remain rice. 3.2.1.3 The quality of the 3 high-yielding rice varieties rice OM6377, OM6677 and OM5629 salinity According to Nguyen Thi Tram (2001) rice with average amylose content was of the good taste. Three varieties had amylose content were average 17 Before applying fertilizer Ca 2+ , EC water of the treatments ranged from 0.268 to 0.310 mS cm -1 and were not significantly different. However, the EC value of the treatments significantly ranged 0.353 to 2.31 mS cm -1 after 2 days of applying fertilization Ca 2+ , significantly different at 1% (Figure 3.32a). The treatments with Ca2 + had EC water higher than the control treatment, no applying fertilizer Ca 2+ . As for aplying lime treatments with Ca(NO 3 ) 2 EC was the highest at 2.31 mS cm -1 . a) b) Figure 3.32 Change of EC treatments: a) EC before and after applying Calcium b) EC at different growth satges This suggested that the applying Ca 2+ in the soil did happen soil cation exchange process in the soil colloids. Calcium has replaced the site of a EC wate EC wate control harvest days days days berore applying fertilization Ca 2+ berore after fertilization Ca 2+ control 16 treatments dipped salinity directly. At 65-day , the EC of all treatments had ranged from 0.93 - 1.08 mScm -1 and were not significantly different. Hanson et al. (1999), showed that rice yield reduction of 12% for each unit of ECe (mScm -1 ) increased, when ECe at root zone average > 3.0 mScm -1 . With experimental results showed that the EC value (1.78-2.72 mScm -1 ) was less impact on the growth of rice plants. At rice harvest, the EC value of the treatments ranged from 2.12 - 3.53 dS m -1 were significantly different at 1%. As for treatments 2 nd and 4 th EC were 2.12 and 2.17 dSm -1 , respectively, lower than the other treatments. Grattan et al. (2002), the seasonal average salinity of the field exceeds 1.9 dSm -1 could reduce rice yields, but the current suggestion that salt could affect on rice productivity when EC> 3.0 dSm -1 . Figure 3.29 Movement of EC water through the growth stages of rice Note: NT1: continuous salinity dipping  3,5 months NT2: Keep soil dried 1 month + dip fresh water 1 week NT3: Keep soil dried 1 month + dip saline water 1 week NT4: Keep soil dried 2 months + dip fresh water 1 week NT5: Keep soil dried 6 months + dip fresh water 1 week NT6: Keep soil dried 6 months + dip saline water 1 week 3.3.6 Effect of the type of calcium fertilizers in saline soil to rice yield and prolin production on rice OM6677 3.3.6.1 EC of water and land EC water days days days harvest before soving days after soving 9 group (Table 3.11), long grain, high protein content (9.12-10.48%). Next, these three rice varieties continued to analyze by DNA technique. Table 3.11 The quality of the 3-saline tolerant high-yielding rice varieties Ord. Name Long grain (mm) Amylose content (%) Protein content (%) 1 OM5629 6,9 16.21 10.48 2 OM6377 7,3 21.40 9.90 3 OM6677 7,1 19.79 9.12 3.2.1.4 Check the saline tolerance of 3 three rice varieties OM6377, OM6677 and OM5629 by DNA technique Results checked by DNA method (Figure 3.8) showed that all three rice varieties had the same DNA band as the standard saline tolerance control (Doc Phung), all of them run faster than than the DNA of the sensitive IR28 and IR29. Figure3.8 DNA profile of three saline tolerant rice varieties, run with primer 223, well 6 , standard tolerant control IR28 IR29 OM6377 OM6677 OM5629 Doc Phung Ladder 700bp 800bp 50bp 150bp 200bp 300bp 500bp 600bp 10 3.2.2 Choose seasonal rice varieties for the model of rice-shrimp 3.2.2.1 Screening rice germplasm with Yoshida solution added with salt (IRRI, 1997) Results of checking saline tolerance of the germplasm, including 56 seasonal rice showed that after treatment salinity concentration at 6 ‰ during 14 days sensitive control IR29 died all; 20 varieties were tolerance at level of 3, equivalent to the same standard such as “Doc Do, Gie Hanh, Lem Bui (TV), Lua Ca Mau, Lua Soi (BT), Mot Bui do, Nang Thom muon, Tai Nguyen (TG), Rach Gia, Trang Tet, Nep Ruoi” ; 10 varieties tolerance at level of 5 (average), 17 sensitive varieties at level of 7, 15 were sensitive at level of 9. 3.2.1.2 Evaluation on the quality of seasonal rice germplasm * Grain Length: Grain length of the germplasm ranged from 5.5 mm to 7.5 mm, in which long grain (6.6-7.5mm) (Table 3.12) achieved 25 acessions, 44.6% (Nang Thom Cho Dao, Khao dawk Mali…), then medium grain (5.51mm-6.6mm) achieved 30 acessions, 53%, short grain (<5.5mm) : 1 acessions, 1.7%. Table 3.12 Classification of seasonal rice germplasm based on grain length TT Group Total Acession Code Ratio (%) 1 Shorter 5,5 mm 1 16 1,7 2 Medium 5,51 - 6,6 mm 30 1, 2, 3, 4, 5, 7, 8, 10, 15, 17, 18, 19, 21, 22, 23, 24, 25, 26, 31, 29, 54, 56, 38, 41, 43, 42, 45, 46, 47, 48 53,5 3 Long 6,6-7,5 mm 25 6, 9, 11, 12, 13, 14, 20, 27, 28, 30, 32, 33, 34, 35, 51, 52, 53, 55, 36, 37, 39, 40, 44, 49, 50 44,6 Amylose content: Results from analyzing amylose contents showed that this trait ranged from 1.16% (Nep Sap) to 31.45% (U17). There were 6 varieties with amylose content, ranged 3 to 19%, average content ranged from 20-24%, 11 accessions; amylose content were over 25%, achieved 38 accessions, 67.8% (Table 3.14). 15 - Preparing the field before raising shrimp: dredging layers of silt deposition, the time level of exposure to different fields, the number of times the pump discharge different fields, the level of different investment (money, time, cultivation technique etc) to focus on raising shrimp and fertilize lime in general low. These could cause soil salinization affecting on rice yield. - Water technical management of shrimp raising: pump discharge for many times. It was favorable for shrimp raising; however, this condition would cause disadvantage to rice cultivation in the model. - Methods to prepare the paddy field before rice cultivation were still natural crude, when fail to raise shrimp season, farmers often left the paddy field empty, this condition would bring soil to salinity and acid sulphate soil increasing. - Water management techniques in rice farming: The time numbers of discharge pumping were very different among farmers, this showed the limitations of desalination among rice-growing areas. Changes in pH, Fe total , Al 3 + of the soil and EC water of the water surface in the paddy field showed high salinity (rice season ranged from 1.08 to 12.48 ‰, and shrimp farming ranged from 8.83 to 34.1 ‰) , the amount of sodium in the soil solution extract is high in saturated and at the end shrimp crop ranged from 81-213meq/100g soil, early rice crop ranged from 64-153meq/100g soil, these conditions brought to prove that salt washing not absolutely after the shrimp crop could affect to rice cultivation. 3.3.5 Effect of water management on saline soil after raising shrimp to yield of OM6677 3.3.5.2 EC movement through the growth stages of rice The experiment was arranged with six treatments (Figure 3.29), at the time before sowing, EC water of the treatments ranged from 0.426 mScm -1 to 0.780 mScm -1 different at 1%. Treatment 4 th (NT4) with the lowest EC in 0.426 mScm -1 . Meanwhile, treatments 1 st (NT1) and 6 th (NT6) have the highest EC, e.g 0.694 and 0.780 mScm -1 respectively. After desalination EC values become lower and could grow rice. At 20 day-old rice plants, the treatments EC ranged from 1.78 - 2.72 mScm -1 ; rice at 40 days, the EC value of the treatments ranged from 1.28 - 2.22 mScm -1 ; EC values at the these two stages were statistically different at the 1%. Fresh water dipped treatments one week prior to salinity dipping had EC lower than [...]... Đợt 3 - Flowering; Đợt 4 – Harvesting; Đợt 5 – Release shrimp; Đợt 6 –Harvest shrimp Figure 3.27 ECe change at soil layers 0 - 20 cm (a), 20 - 40 cm (b) during stages of rice-shrimp cultivation in Bac Lieu Results of soil analysis measurements of ECe in soil layer “ 0-2 0cm” showed that Hong Dan, Gia Rai, Vinh Loi, Phuoc Long districts were significantly different during 6 times to cultivate rice-shrimp... was the lowest while the highest was “ Nang Quot Bien” (Table 3.17) Table 3.17 Classification of seasonal rice germplasm based on protein content Ord 1 2 3 Protein content 7 - . sowing) Super phosphate (kg) Urea (kg) NPK (2 0-2 0-1 5) (kg) Basal fertilizing 300 - 350 - - 5 – 7 - 30 – 50 - 20 – 25 - 30 – 50 50 - 65 40 – 45 - - 50 - 65 - Pest control: Application of integrated. before harvesting 7 - 10 days for easy harvesting. (v) Fertilization: Amount of fertilizer used for 1ha: 300 - 350 kg of phosphate; 60 - 100 kg urea; 100 - 130 kg of NPK (20 - 20 - 15); (vi) Pest. above 9% . - Built a cultivation procedure for the model of rice-shrimp in the Bac Lieu province - Characters of water and soils in the model of rice-shrimp affected on rice cultivation. - Effect