Khóa luận tốt nghiệp Công nghệ sinh học: Screening, cloning, and over-expressing of phyc from Bacillus subtilis ATCC 11774 in Escherichia coli BL21

MINISTRY OF EDUCATION AND TRAININGNONG LAM UNIVERSITY-HO CHI MINH CITYFACULTY OF BIOLOGICAL SCIENCESSCREENING, CLONING, AND OVER-EXPRESSING OF PHYC FROM Bacillus subtilis ATCC 11774 IN E

MINISTRY OF EDUCATION AND TRAININGNONG LAM UNIVERSITY-HO CHI MINH CITYFACULTY OF BIOLOGICAL SCIENCES

SCREENING, CLONING, AND OVER-EXPRESSING OF PHYC

FROM Bacillus subtilis ATCC 11774 IN Escherichia coli BL21

MINISTRY OF EDUCATION AND TRAININGNONG LAM UNIVERSITY-HO CHI MINH CITYFACULTY OF BIOLOGICAL SCIENCES

UNDERGRADUATE THESIS

SCREENING, CLONING, AND OVER-EXPRESSING OF PHYC FROM Bacillus subtilis ATCC 11774 IN Escherichia coli BL21

Advisor Student

Nguyen Quynh Anh, Ph.D Ho Hoang Hai

Thu Duc City, 03/2023

First, I would like to express my sincere gratitude to my parents and family forgiving birth, nurturing, loving, teaching me to be the person I am today and giving methe opportunity to meet kind people Grateful to Parents and Family for financial support

so that I can complete my study program, 1s a source of encouragement for me to be able

to conquer challenges in life

I wish to thank the Board of Directors of Nong Lam University - Ho Chi MinhCity, the administrators of the Faculty of Biological Sciences, and all the lecturers for

providing me with the necessary resources to pursue my studies there Thanks to the

guidance and teaching of yours, I can apply it to solve problems related to the majorduring the thesis

I would like to express my gratitude to Dr Nguyen Quynh Anh and Dr Trinh ThiPhi Ly, who dedicatedly guided me with a lot of knowledge, directions, corrections,support, and created favorable conditions for me during the process of making my thesis.Then, I would like to express my special thanks to the administrators of Khai Minh VietEnzyme JSC., Ho Chi Minh City for providing financial support during the projectimplementation

I would like to thank Dr Phan Dang Thai Phuong - academic mentor of classDH18SHC for taking care of me during 4.5 years of university

In order to complete this undergraduate thesis, it 1s indispensable for the help of

lecturers, colleagues, and friends, who have supported and helped me enthusiastically

as well as always been by my side to encourage and remind me throughout the learningand research process

This thesis 1s like a great exercise to help me improve myself and prepare for thenext phase of my career in scientific research

Sincere thanks to all!

AFFIRMATION AND COMMITMENT

I declared that all results presented in this graduate thesis were conducted bymyself All the data and information are entirely accurate and unbiased I fully acceptresponsibility for these commitments in front of the committee

Name: HO HOANG HAI Class: DH18SHC — Student ID: 18126226

Phone number: 0913363593 Email: 18126226@st.hcmuaf.edu.vn

Student’s signature

Ho Hoang Hai

Phytic acid (myo-inositol-1,2,3,4,5,6-hexakisphosphate) 1s abundant in seeds,roots, and stems of plants It serves as an anti-nutrient in the food and feed industry sincephytic acid and its salt (phytate) affect the ability to absorb nutrients of humans andanimals, especially monogastric animals In addition, nutrients that are not fullyabsorbed will be released into the environment through the excretion of animals,

especially P which will cause eutrophication, polluting the environment Hence, the

application of phytase will catalyze the sequential hydrolysis of phytic acid and phytate

to less phosphorylated myo-inositol derivatives with concomitant release of inorganicphosphate Additionally, the high activity of phytase produced from Bacillus sp.,particularly at high temperatures, offers additional benefits when used From this issue,this study aimed to screen Bacillus subtilis ATCC 11774 both in terms of temperatureresistance and phytate degradation capacity, cloning, and over-expressing its phytasegene To investigate the influence of temperature on the growth of B subtilis ATCC

11774, experiments were conducted in the temperature range from 37 to 60°C on LBmedium According to the results, bacteria at 37 and 55°C showing higher phytase

activity were isolated, and the phytase encoding gene (PhyC) were cloned and expressed in Escherichia coli BL21 using pET102 Directional TOPO expression vector.Sequence analysis of PhyC-37 and PhyC-55 revealed four and seven residues,respectively differ from PhyC of B subtilis ATCC 11774 SDS-PAGE analysis

over-exhibited a predicted molecular mass of 58 kDa The production of two produced

recombinant proteins were 52.78 U/g and 12.71 U/g after 4-hour induction by 1 mMIPTG Then, the purified PhyC-37 had a specific activity of 701.05 U/g protein Lastly,

western blot analysis was used to confirm the presence of the His-Tag fusion protein

These results suggested B subtilis ATCC 11774 might be considered as a heat-resistantbacteria and the two recombinant phytase enzymes were potential candidates forindustrial-scale production and further applications

Keywords: Bacillus subtilis ATCC 11774, phytic acid, phytate, phytase,recombinant proteins

TABLE OF CONTENTS

PageACKNOW LEDGEMEN Ti senneng tang E1164181531331163058315818538X054EELGESHG.VELSEEESEEESTISSSSEEHSESEE 1AFFIRMATION AND COMMTITMENTT - S- S22 HH HH Hước 1ABS LÍ xe ssesesessnsosesienidEagbSgSg1380850183000S63491599398E34855L3GSHI29S0SS15ĐS.S25GU30800550014004G8590588E 11TABLE OF CONTENTS co n1 212221211182 <64K14 6680k k em k0 ha baabansiines 1VLIST OF ABBREVIATIONS, seo giEtiaSEL0001401996414650338000:Đ48333/-L36080040048248/09095E vi

LIST OF FIGURES sáng ngu ngnnngĩ gu o 8g gi 8E1380813083008655110SI3835.GG595936588891550049850158500380 VillCHAPTER 1 INTRODUC TION - - cee 5121 121 nH TH HH TH HH re 1

LL PfOBleli SA [6HGHE sscsscseesoiisiis 161006 630106 8035061338 3836405 G855815:043806058⁄7V581138843388180:1603686 1I9 2123s CORLENS cee cei ee ee ees eee re eee 2

221 Phytie acid-and phytate na scnscsesmossnopacresmnnr wneen enseae se noe ERR EE 3

l0 5à] GITHHOTT ene

2.152» Sources of phy tesawid sassssseskasssi1A068003000291121608051538i4855.0158-J5:EĐ1850)388.3tS1gg0GgmEgiiggusbssgỦ 42.1.3 Phyticacid 8 Gil ABU ER be sec ccesssseenserers serene ener veenenenexzenineneenmenennemeeeees 52569iiIESUSUALE ene 5

PP ion 52.2.2 Sources and classification of phyfaSG St St s2 HH ng rệt 62.223, MS PUCAOUS OF DHẾ LH SỐ wsexcccrsnessasneaemasuarsemevesesness seanneeancsareneaeumenememeeaamenecemmnansoes yi2.3 Recombinant DNA technology 0 eceeceeceeeceeseeseeeseeseesseeseeaeesecaeeaeenseeeeeseeseenses 103n lạ ISTP Oli csesssxcessssenssusnsssexeunsncesspausveenassutstaaysnassneseennyseananmsensvesenencemauseseureesanaeess 102.3.2 Steps of recombinant DNA technology ececceeseesceeceeeeeeseeseeeseeeesseeseeseeaes 102.4 Recent related studies of recombinant phytase in domestic and in the world 112A 1 DOmestte SETERbbisbseibnsskiiekibilisgtssax89056530,05568680u3u2 i5 34pstgjx2509u84L88y8iS:SED18S888-ggg8 11

242 WOTIQ/SEHCðSsssssx6is561516611301304561313911486385519413484555583515855148SEG4ESLSIEXESSSIGSHESMEISEES.0040.58/ 12CHAPTER 3 MATERIALS AND METHODS 0 ccecccceccecescesceseeseeseeseeseeseeseeeeesens 15Salis Time and lo Cat Of aassssisxsssest6161646350330/663606368g053800G605595⁄ERGERSESSESSGEDSESLSGS305091054008548488 15

3.2.1 Screening the effect of temperature on the growth of B subtilis ATCC 11774 163.2.2 Cloning and over-expressing of Phytase gene (/hyC) -.- c+-c+-c+eceercee 163.2.2.1 RNA extraction and cDNA synthesis 00 0 0ccccceecceseeeceeseceeeeseceeeeseeeseeseeeeeeeees 16

3.2.2.2 PCR amplification and cloning of the PhyC genes - 5 5-55 +<<52 173.2.3 Over-expression of the PhyC gene of B subtilis ATCC 11774 195.2.3) 1, IVGTGSTIEGSSHTG Ol PVG ces snsaexe sonecnnnn ssuins srasanawaastenss ta une ncaunaubiresteastoniess suesstonaieie 193.2.3.2 Purification of recombinant Phytase prOf€1H 55 5-s 22x s+vcsxrsererrrss 19

3.2.3.3 Protein quantIÍICafIOTI - - - 22 2+ 2222313331251 223 3211511211 111 712211 11 1 xe 20

3.2.3.4 ElectroplhOT€SIS - - 2c 2 22212211211 221 123121111112 1221 12111211 111011 11 g1 ng gư 203.2.3.5 Western on 213.2.3.6 Evaluation of phytase aCfIVIẨY - - SnS2 nh HT HH ngư 213.24 Statistical anal ysisi cc: sss scsemesecammsecanums mr aape nage eRe REe eer eet 22CHAPTER 4 RESULTS AND DISCUSSION -. - 2c cScseeeieerrrrrrrrrrre 234.1 The effect of temperature on the growth of B subtilis ATCC 11774 234.2 Cloning and over-expressing of Phytase gene (PhyC} ¿ -cc<cc<cxeeeeees 274.2.1 PCR amplification and cloning of PAYC o00 ceccecceeeeseeeceeceeeceeseeceeseeeeeseeeenses 27

AD Dr CVELHER UC SSID OL PIL) Do nhangbstinieishgtitiriptosidgeSi20003ã323900/86003020G7280920104810280/1850EGHD-G0GD338G03808 294.2.3 Purification of recombinant Phytase pFOf€IT - 25222 2+2 £ +2 e++eszeeerze 3142/4 WGSISEH HÌGcossseessieeessbsindaitdg311201080585430558s0801053 i6 H9G0G.14BL3HESEIXESGBSA.001851/4u0V5 324.3 Protein quantification and phytase activity aSSay àằ c3A.B als PTO FSI GUATETIICAL OM ssssssssseeedin6ilibsoRSiD8iiDGNSGGGSRGRGGISG138BBSSIASS.BHEASEISBSIBGEDSSISBA2008-83g880 33

4.3.2 Evaluation of phytase activity cccccccccceccescescceseesececeeseeaeteseeeeesteseeseenseeseenee 3

CHAPTER 5 CONCLUSIONS AND SUGGESTIONS 00 eccececcesesceeeeeeseeeeeeeesees 875.1 Conclusions S

BD SUS OSG INS ach oa cic ct caattsad dears Saeisn ds Asis Santana Skee Seclsa tase detuta eantulaese Soule domes TEEEETREINGE SssiteeaiieesitbsebibdisietoslsiElliiptdiapugSEissktalftntlansicbrloatsbalsfosluslsSlslisbiegslsie 38APPENDIX 44

LIST OF ABBREVIATIONS

APS: Ammonium persulfate

Bp: Base pair

C: Carbon

cDNA: Complementary DNA

CFU/mL: Colony Forming Unit

PCR: Polymerase Chain Reaction

PhyC-37: Phytase gene at 37°C

PhyC-55: Phytase gene at 55°C

rDNA: Ribosomal deoxyribonucleic acid

RNA: Ribonucleic acid

TBST: Tris-buffered saline with Tween 20

TEMED: Tetramethylethylenediamine

LIST OF TABLES

PageTable 2.1 Content of phytic acid in major cereals, legumes, oilseeds, and nuts 4

Table 2.2 Examples of commercial phytase on global market - 9

Table 3.1 Components of the PCR reacfIO - - 5-5522 S2 *22 1+2 £+zssreseerrrrrxes 17Table 3.2 Components of colony PCR react1On - 5+5 +++£++£+eeezeerreezess 18

Table 3.3 Gel composition for SDS-PAGE - - 5c 222 2222212211212 Ererree 20

Table 4.1 Purification scheme of recombinant phytase from PhyC-37 34

LIST OF FIGURES

Page Figure.2.1 Structure of phytic aed scccnercemeusneumarnmnm mem mmm uaa EEE 3

Figure 2.2 Interaction of phytic acid with metals, proteins, and carbohydrates 5

Figure 2.3 Phytase enzyme catalyzes the process of phytate hydrolysis - 6

Figure 2.4 Schematic diagram steps of recombinant DNA technology 11

Figure 3.1 Schematic diagram of these experiments in this theS1S - - - 15

Figure 3.2 The thermal cycle of PCR reacfIo1 - 522222 +2 + ssssrrsrrsrrsrxes 17 Figure 3.3 Structure of pET102 D-TOPO - PhyC plasmid c5 <-5+>5 18 Figure 4.1 Growth curve of B subtilis ATCC 11774 with temperatures by time 23

Figure 4.2 Total plate count (TPC) of B subtilis ATCC 11774 with temperatures by UTI ayes aenone sper easement a cup un es aatamasp om eben craze eatuaannered 24 Figure 4.3 Clear zone forming by B subtilis ATCC 11774 over 4 days on PSM .25

Figure 4.4 Clear zone diameters over 4 days 0 :cceccecesceseeseeseeseeseeseeseesenseeeeeseesenees 26 Figure 4.5 Electrophoresis of RNA, cDNA, and PhyC gene on 1.5% agarose gel 27

Figure 4.6 Construction of pET102 D-TOPO-PhyC expression VecfOr 28

Figure 4.7 Gel electrophoresis for positive colonies harboring construct in E coli ITBD TU ee ee ee ee ee ee 28 Figure 4.8 Gel electrophoresis of construct harboring the C -+++ 29

Figure 4.9 Nucleotide sequence alignment of PhyC of B subtilis ATCC 11774, do GHI tụ, BG PIIOHSS suasnnuĩnh usesemscncers svessiciansaesemacces ures mauiccnsanns ssn unas nusiess aearastuentdeseumantaen 29 Figure 4.10 Amino acid sequence alignment of PhyC of B subtilis ATCC 11774, PU Ce3 Vy AI PAG ASS se sidspiskoacdilskgipssosi3i03808HiasLSsiEHSS45SG835SG038G3nSk438.n830l5B0E01%Sii0-gi082 0056121228 29 Figure 4.11 SDS-PAGE analysis of PhyC-37 and PhyC-5Š - -c =++ 30

Figure 4.12 SDS-PAGE analysis of PhyC-37 and PhyC-55 at 30°C - 31 Figure 4.13 Confirmation of the purified recombinant PhyC-37 and PhyC-55 protein production by Western blot analysis :cecceeeeceeeceeceeeeeseeeceeseeeeceseeseesseeseeseesseeees 32 Figure 4.14 Albumin standard CUTV€ - <5 22 2213221221123 33 Figure 4.15 KH¿POa standard CUTVG - 22 2222221223121 353 1211112112111 1111 1 re 33

CHAPTER 1 INTRODUCTION

1.1 Problem statement

Phytic acid (myo-Inositol-1,2,3,4,5,6-hexakisphosphate, IP6) is found in largequantities of seeds, roots, and stems of plants, serving as an anti-nutrient in the food andfeed industry (Zhao et al., 2021) Phytate, which is a salt form of phytic acid has beenconsidered a nutrient since it 1s the main storage form of phosphorus (P) Phytate and

phytic acid can combine with proteins and other amino acids to form indigestible

complexes Thus, food and feed containing phytic acid and phytate are poorly absorbed

by living organisms, especially monogastric animals and humans due to the lack of

necessary enzymes to hydrolyze them The amount of phytic acid and phytate that arenot utilized and absorbed by animals can cause P contamination and eutrophication inthe environment According to International Poultry Production only in 2014, the

number of feeds that get wasted was up to 25% due to the lack of significant endogenous

enzymes allowing the animals to digest it

Nowadays, there are three main methods to reduce phytic acid from seeds andgrains to enhance the bioavailability of numerous cations and nutritional value of meals

to animals including mechanical, chemical, and biological methods However,mechanical and chemical treatments can cause the loss of the main components ofdietary fibers and minerals or require cutting-edge technology and a lot of time (Cobanand Demirci, 2017) Biological method is an environmentally friendly approach and hasthe potential to overcome such limitations in which the addition of exogenous phytase

to poultry and cattle diet is the most effective way to utilize phytic acid and phytate(Kumar et al., 2011)

Phytase (myo-inositol hexakiphosphate phosphohydrolase) is highly specificprotease that only convert phytic acid and phytate into inorganic phosphate, and free

metal ions (Badoei-Dalfard et al., 2019), this facilitates better absorption by

non-ruminant animals It can breakdown the complex form of phytic acid into simple form.Phytase can be found in distinctive sources in nature ranging from plants to animals andmicroorganisms (bacteria, fungi, and yeast) However, the manufacturing of phytase 1sstill limited, particularly in Vietnam

Phytase is a significant biocatalyst with the potential for numerous utilizations,such as nutritional for human and animal diet, environmental, and biotechnologicalapplications, leading to a huge demand for phytase enzymes Additionally, the need forthermostable enzymes has increased since they underwent high temperatures during thepelleting process Therefore, this study focused on screening the thermostable capacity

of a selected strain, cloning, and over-expressing its phytase gene towards theproduction of phytase enzyme in Vietnam

Content 2: Cloning of Phytase gene (PhyC) from B subtilis ATCC 11774

Content 3: Over-expressing of PhyC

CHAPTER 2 LITERATURE REVIEW

2.1 Phytic acid and phytate

2.1.1 Definition

In the life cycle, the 4 elements C, H, O, and N are essentially related to the life

and development of all living things P is an element that also plays a vital role insustaining life At the small molecular level such as DNA, RNA, or ATP, it also

contributes to the formation of phospholipid membranes crucial for cell formation

Regarding animal nutrition, P functions as a key component of nucleic acids and cell

membranes, protein synthesis, fatty acids transport, growth and cell differentiation, feed

consumption effectiveness and fertility, etc Furthermore, P is a macronutrient for plantsand is critical for the biosynthesis of nucleic acids, cell membranes, and many enzymes(Kumar et al., 2015) However, about 50 - 80% of the total P in cereal grains, oilseeds,and legumes are stored as phytic acid (myo-inositol-1,2,3,4,5,6-hexakisphosphate)(Shivange et al., 2016; Zhang et al., 2020) It is considered as an anti-nutrient in the foodand feed industry Non-ruminant animals such as humans have difficulty in digestingfood and feed containing phytic acids and phytate because they lack enzymes needed todegrade phytate or phytic acid-bound P To satisfy the animal's phosphorus needs,inorganic forms of P must be included in the feed Consequently, a significant amount

of P is excreted through feces, causing soil and water contamination and eutrophication

QH O= P —OF

Ho PH ƠO 5 OH

On the other hand, phytate properly acts as an anti-nutritional component, since it

can combine with proteins and valuable metal ions such as calcium, copper, and zinc to

generate insoluble forms (Ptak et al., 2015; Troshagina et al., 2018) Moreover, the result

of not dealing with phytate is decreased nutrient digestion and feed efficiencies.Consequently, impairing animal performance causes detrimental effects on the growthand the uptake of minerals, leading to an increase in endogenous nutrient losses

This problem significantly impacts animal husbandry

(Balaban et al., 2016; Singh et al., 2018)

2.1.2 Sources of phytic acid

Table 2.1 Content of phytic acid in major cereals, legumes, oilseeds, and nuts(Hussain et al., 2022)

Name Phytic acid ø / 100 g (dry weight)

that different feed components have phytic acid levels that varied, prior to the content

of phytic acid in nuts, including walnuts, almonds, varied from approximately 0.1 - 9.4%

as shown in Table 2.1 Particularly, whole seeds have phytic acid contents ranging from

0.2 to 2.9% hence, grains, legumes, and oilseeds are the main sources ofphytate (Kumar et al., 2019).

2.1.3 Phytic acid as an antinutrient

Phytic acid or phytate has a strong anti-nutritional impact on non-ruminant animaldiet since phytate-bound P is poorly available to them and can minimize the digestibility

of other nutrients Phytate functions in a wide pH range of the digestive tract on animals,

showing strong negatively charged ions and a high affinity for cationic dietaryingredients such as minerals, proteins, and trace elements as indicated in Figure 2.2(Singh et al., 2018) At acidic pH (such as in the stomach of animals) phytic acid binds

to basic amino acids including arginine, histidine, and lysine, result in formattingprotein-phytate complexes (Dersjant et al., 2015) Alternatively, at higher pH above theisoelectric point of proteins, phytic acid can bind protein through cations to form acompound of proteins, minerals, and phytate that are insoluble and indigestible(Feizollahi et al., 2021) Consequently, such activity may alter the structure of proteins,reducing the enzymatic activity, protein solubility and digestibility

Phytase (myo-inositol hexakisphosphate phosphohydrolase) is an enzymebelonging to a special group of phosphatase enzymes that is recognized by its ability tocatalyze the hydrolysis of phytic acid or its salt phytate, releasing one molecule ofinositol and six molecules of inorganic phosphate as shown in Figure 2.3 Phytaseenzymes have been divided into two classes based on the degradation site of phytatemolecule These are 3-phytase (EC 3.1.3.8) and 6-phytase (EC 3.1.3.26) While 3-phytase releases the P at position C3, 6-phytase starts to release the P at position C6 ofthe myo-inositol hexaphosphate ring (Butani and Parnerkar, 2015) In bacteria, phytaseshave molecular weight ranging from 40 - 55 kDa, while they can be up to 353 kDa infungal strains (Coban and Demirci, 2017; Jatuwong et al., 2020).

OH

OH

Figure 2.3 Phytase enzyme catalyzes the process of phytate hydrolysis(Hussain et al., 2022)

Phytate is highly common in grain-based diets and serves as a source of unusable

P as well as an antinutrient that prevents pigs and poultry from absorbing multivalentminerals and trace ions (Menezes-Blackburn et al., 2015) However, under normal

feeding conditions, due to low levels of endogenous phytase activity in the upper section

of the digestive system, monogastric animals and some fish have a very limited capacity

to hydrolyze phytate (Vallejo et al., 2018; Fries et al., 2020) Thus, either exogenousphytase or inorganic P is added to the feedstuff, which is considered as a strategy.Phytase enzyme-based hydrolysis is referred to as an eco-friendly product since it candegrade the phytic acid leading to produce desirable results without depleting nutrients

in the feed and reduce P contamination

2.2.2 Sources and classification of phytase

Phytases are ubiquitously distributed in nature, since they were produced byanimals, plants, and microorganisms (Nunes and Kumar, 2018) Among them,nowadays microbial-derived phytases are more preferred, because of their

characteristics like heat stability, wide pH range, and low production costs(Gupta et al., 2015).

Phytases are a diverse subgroup of phosphatase enzymes, encompassing a widevariety range of sizes, structures, as well as their catalytic mechanisms According totheir optimum pH, phytases can be classified into alkaline and acidic phytases.Additionally, based on their catalytic mechanisms, 3D structures and specific sequenceproperties, phytases are mainly divided into four classes including -propeller phytase(BPPhy), cysteine phytase (CPhy), histidine acid phosphatase (HAPhy), and purple acidphosphatase (PAPhy) Among them, BPPhy is the most interested since it occurs in avariety of microorganisms including archaea, bacteria, cyanobacteria, and Arthrobotrysoligospora, hence they are the most widely investigated due to their thermal stability athigh temperature and the activity at neutral or alkaline conditions (Zhao et al., 2021).Particularly, BPPhys from Bacillus sp are also reported with the capacity of maintainingthe activity in a temperature range of 50 - 60°C Bacillus BPPhy’s activity can be

regulated by a mixed variety of divalent metal ions; in fact, Ca?" plays as an activator for BPPhy in B subtilis and Bacillus licheniformis, whereas Ba?", Cd?*, Co**, Cu**, Fe?*, Hg”', Mn?', Zn?*, and others inhibit BPPhy activity It is demonstrated that the formation

of metal-phytate complexes resulted in the poorly binding to the active sites of enzymes,leading to a decline in enzyme activity (Demz1r et al., 2018, Zhang et al., 2020) Notably,calcium ions have a critical role in maintaining Bacillus BPPhy conformation, catalyticactivity, and heat stability For instance, the activity of phytase from Bacillusamyloliquefaciens strain DS11 displayed high thermal stability at 90°C, when tested in

a solution containing 5 mM Ca?” Bacillus KHU-10 phytase can increase the pH range

from 6.5 - 8.5 to 6.0 - 9.5 (Zhao et al., 2021)

2.2.3 Applications of phytase

Phytase enzymes have enormous applications in several fields, mainlyconcentrated on the feed enzyme market Phytase accounts for over 60% of the marketfor feed enzymes, which also includes xylanases, galactosidases, and B-glucanases(Secco et al., 2017) Furthermore, phytase can be added to commercial diets for swine,poultry, and fish then have broader uses in animal feeding due to its ability to decrease

P excretion of non-ruminant animals The use of phytase significantly improves theabsorption of minerals, amino acids, trace elements, and energy while also protecting

the environment (Singh et al., 2018) According to Zhou et al (2022), the activity ofphytase had a profound effect on the absorption of various elements including zinc andiron from plant-based nutrients Because most of the plant-based food that is fed toanimals is indigestible and poorly absorbed since most of the available P is only found

in the form of phytate in plants, adding phytases to the feeds can aid in the properabsorption of the P content from plant products (Madhavan et al., 2019) Also, P is avital mineral component for the growth and development of plants, but most of theorganic P is found in phytate forms, plants cannot easily get it from the soil It wasproved that the conversion of phytate could be assisted by microbial phytase Phytase-producing bacteria can convert phytate around the root zone, utilizing and absorbing Pfor the growth of plants

The addition of inorganic P into feedstuff counts for 50 - 75% of the cost of themineral mix and the excess phosphate (Kumar et al., 2016) To lessen the anti-nutritionalimpact of both phytic acid and phytate then minimize environmental pollution throughexcretion of the excess P of monogastric animals, the application of phytase enzyme issignificantly necessitated Therefore, microbial phytases supplementation in animaldiets often increases P bioavailability and reduces aquatic P pollution, which may also

be considered as a key strategy for reducing environmental pollution Phytase from

Bacillus sp might offer extra benefits in freshwater and marine aquaculture due to itsoptimum pH and excellent heat-stability Thus, phytase has been considered as a

strategy to both enhance the use of P in the aquaculture industry and to maintain P levels

in the water to avoid eutrophication

In addition to the feed industry, phytase is used for a variety of applications in thefood industry to improve mineral nutrition of humans This is due to the fact that phytatecan chelate with minerals such as zinc, calcium, and iron which are necessary for the

human system Additionally, the most common single micronutrient deficiency in the

world is iron insufficiency that weakens the immune system in infants leading todiarrhea and lower respiratory tract infections (Coban and Demirci, 2017) Therefore,with the addition of phytase in complementary foods including cereals and legumes,mineral shortages in the human body significantly reduce and critical minerals'bioavailability rises, benefiting the health of mineral deficient individuals Alternatively,phytase is also employed in a variety of industrial settings, including the food and

beverage sectors, breweries, bakery goods, and the dephytination process (Handa et al.,2020) Pable et al (2014) investigated the use of yeast phytase on chickpea flour.According to their findings, adding phytase reduced phytic acid by 75% to 88% and

increased the mobilization of Zn?*, Fe?', and Ca”* ions by 20% to 28%, 26% to 37%,

and 24% to 42%, respectively In addition, there is a rising need for nutritious food andawareness of diet However, preconception barriers to recombined phytases and ascarcity of natural phytases make it difficult to apply phytase widely in human diet

Phytase is used in a variety of other sectors, such as the manufacture of biofuels(Vasudevan et al., 2019) Phytase is furthermore utilized in the pulp and paper industries

as Zhou et al (2022) demonstrated It is crucial in reducing the production of pollutedby-products and extending the lifespan of the paper by slowing down aging byconverting phytic acid In 2016, Jain and Singh reported that myo-inositol prevents thedevelopment of kidney stones and other ailments including heart disease Lower forms

of myo-inositol are useful in various fields, including cell signaling and theimmobilization of calcium ions However, it is hard to synthesize lower inositol bychemical way, thus by adjusting the phytase enzyme concentration, alternative lowerinositol may be generated (Ogunribido et al., 2022)

Table 2.2 Examples of commercial phytase on global market (Singh et al., 2018;Herrmann et al., 2019)

Origin of organism Company Trademark

Escherichia coli DuPont/DSM Phyzyme® XP

Citrobacter braakii Novozymems/DSM Ronozyme® HiPhos

Buttiauxella sp DuPont Axtra® PHY

Hafnia sp BASF Natuphos® E

To reduce the anti-nutritional effect of phytic acid and to prevent environmentalpollution, the application of genetic engineering technologies has allowed theproduction of phytase products employed in food and feed markets Thereby,

commercial phytase can effectively hydrolyze the phosphate of phytic acid, therebyreducing environmental pollution, and improving the utilization of P in monogastric

animals (Zhao et al., 2021) The current industrial enzyme market is valued close to US$

1 billion in sales and phytase market was projected to account for more than half of thetotal feed enzyme market (Arbige et al., 2019; Herrmann et al., 2019) Furthermore, theycontributed US$ 350 million in yearly sales and held the industry's greatest revenue

share of 83.6% in 2015 and is projected to rise to $590 million USD

by 2024 (Hussain et al., 2022) Novozymes, DuPont (Danisco), AB Enzymes, DSM,BASF, etc are the leading producers of phytase on the market as indicated in Table 2.2

To date, all the commercial phytase are derived from the histidine acid phytases(HAP), which are exclusively active in acidic environments (Menezes-Blackburn et al.,2015) However, in neutral and slightly alkaline environments, they lack action at highcalcium ion concentrations On the contrary, B-propeller phytases (BPPhy) are stronglyactive and thermostable in the occurrence of calcrum ions (Troshagina et al., 2018).2.3 Recombinant DNA technology

2.3.1 Definition

Recombinant DNA technology is a method for transferring molecules of DNA(genetic information) from one organism to another to create novel genetic fusions

useful for research, health, agriculture, and industry This method was devised by

Stanley Cohen, Herbert Boyer, and their coworkers in 1973 Therefore, recombinantDNA technology offered a quick, effective, and potent way to produce novel microbeswith precise genetic characteristics

2.3.2 Steps of recombinant DNA technology

Briefly, the DNA sequence that encodes gene of interest is synthesized and istransplanted into a plasmid that could be maintained in the common bacterium E co/i.The bacterial host cells functioned as biological factories to produce recombinantprotein, which, after being combined, could be purified, and used for further analysis asindicated in Figure 2.4 (Glick and Patten, 2010)

ampR Isolate gene of interest (ampiciliin ° s “

O met me restriction enzymes

@ (the DNAs, add ada ligase to

© join DNA pieces by base pairing

C) Recombinant DNA plasmid

Transform recombinant

| plasmid into E.coli

Recombinant E.coli cell

DNA plasmid

Bacterial DNA

Plate ces onto agarose gels |

containing ampicillin bacterial colony

=

Expand the positive clones

to exponentially replicate |

copies of desired DNA

yj @ Tet biological properties

T4 of your gene of interest

La

9 10 10 10t 10°

Gene expression

Figure 2.4 Schematic diagram steps of recombinant DNA technology (Deans, 2014)

2.4 Recent related studies of recombinant phytase in domestic and in the world2.4.1 Domestic studies

On the period of ten years, from 2012 to 2022, there were four publications onphytase, including two studies research on isolation and selection of phytate-degradingBacillus sp., one on recombining of phytase gene, and the last was on application of

phytase in aquaculture Among them, only the study in 2019 of Tran Thi Thuy and Mai

Thi Ngoc focused on using recombinant DNA techniques, while the rest focused onevaluating the characteristics of phytase enzymes from isolated strain There were notany patents covering the use of phytase in industry or commercially accessible inmarkets This state of the research shows the lack of data sources and research projects

to produce recombinant phytase enzyme in Vietnam

In 2012, Phan Thi Thu Mai selected 91 heat-resistant bacteria that have the

capacity to grow at 40°C Among them, SP1901 strain was thermostable species and

showed the highest phytase activity Based on 16S rDNA sequencing, SP1901 wasidentified as B amyloliquefaciens subsp plantarum Its phytase was stabled at 60°C,

with the optimal activity at pH 5.6 - 7.2 at 50°C In addition, Ca** was demonstrated to

enhance the thermal stability of phytase at 60 - 70°C

In 2018, Le et al suggested that phytase supplementation in feed could contribute

to reduce the nutrient to the water body of pangasius pond, showing less P released tothe environment than the non-treatment

In 2019, Vo Duc Tuan et al isolated 31 strains of B subtilis from different origins.Among them, 7 bacterial strains showing the highest phytase activity were selectedbased on the forming of clear zone The results showed that the manufacture of phytaseunder ideal circumstances, including incubation period (36 hours), temperature (40 -60°C), and pH (5.0 - 6.5), with the highest phytase producing strain was

B subtilis Ba58 (0.35% Ca^”).

In another study, Tran Thi Thuy and Mai Thi Ngoc (2019) were successfully

amplified PhyC gene from B subtilis, cloned, and over-expressed it in E coli BL21(DE3) using modified medium The results showed that recombinant BacP enzyme wasrecovered with 18.49 IU/ml activity after 18 hours of induction with lactose as inducer

or 12 IU/ml after 14 hours of induction by IPTG Purification results by affinity

chromatography yielded BacP enzyme that was purified 4.50 fold and had specific

activity of 24.48 [U/mg protein Even though, still no commercial Phytase has been

produced in Vietnam, and until now, our country still be depended on overseas producers, giving big disadvantages for domestic development of animal husbandryand economic

phytase-2.4.2 World studies

There are many profound kinds of research and patents in the world They arefocused on molecular modification of phytase, especially on Bacillus phytase (BPPhy),which are restricted in specific enzyme activity and thermal stability In general, theyare focused on improving the specific activity at high temperature, also at low pH which

is suitable for pelleting process and gastrointestinal tract of non-ruminant animals,

respectively by characterizing recombinant phytase, optimizing enzyme activity with

thermal and proteolytic stabilities, enzyme production, and optimizing for scale fermentation conditions Besides, China and India are the top countries researching

industrial-on Bacillus phytase (BPPhy) as well as its applicatiindustrial-on and modificatiindustrial-on

In the early years of the 21“ century, many novel phytase genes were isolated from

Bacillus sp from various sources Tye et al (2002) two phytase genes including phyL,168phyA from B licheniformis and B subtilis strain 168, respectively were cloned and

over-expressed in B subtilis using a @105MU331 prophage vector system As a result,both phytases showed high thermostability and broad pH range, also at the optimalconditions up to 35 units of phytase/mL were released into the culture media.

In the last decade, Tran et al (2010) isolated a thermostable phytase gene fromBacillus sp MD2, cloned, and over-expressed in E coli BL21 (DE3) resulted in arecombinant phytase with high thermal stability and still retain about 40% of the activity

after 10 min at 100°C Hence, induction with lactose, presence of calcium chloride

showed the phytase activity at 71 U/mL in fed-batch cultivations Later, in 2011, Wang

et al cloned and over-expressed phyC from B licheniformis in Pichia pastorisexpression host After 96 h of methanol induction, rePhyCm released up to 0.23 U ofphytase/mL into culture supernatant and had high specific activity for phytate salt

Therefore, the optimum pH and temperature of purified rePhyCm were 7.5 and 60°C,

respectively In 2014, a study of Borgi et al was focused on cloning, purifying, and

analyzing biochemically of the recombinant phytase from B licheniformis ATCC

14580 Hence, this recombinant enzyme exhibited a high specific activity of 316 U/mg.Chen et al (2015) attempted to improve phytase specific activity from B subtilis 168under neutral and acidic conditions showing significantly altered results compared withnon-treatment Then, with the previous study about directed evolution, later in 2016,Chen et al did a comparative study on distinct expression hosts showing the results of

at pH 7.0 and 60°C, the D24G/K70R/K111E/N121S mutant of B subtilis had a specificactivity of 30.40 U/mg, which was noticeably greater than that of

P pastoris (22.70 U/mg) and E coli (19.70 U/mg)

In the last five years, particularly in 2017, a commercial product of phytase namedNatuphos® E was reported (FEEDAP et al.), which is a feed additive containing 6-phytase available in powder, granulated and liquid forms, utilizing for avian and porcinespecies A study of (Badoei-Dalfard et al., 2019) applied a statistical optimizationstrategy using response surface methodology (RSM) causes Bacillus tequilensis Dm018

to produce phytase to increase by 2.30-fold with the optimal temperature for phytasefunction was up to at about 60°C Additionally, the enzyme retained more than 70% ofits activity throughout a broad pH range of 4.0 to 8.0 The study of Zhang et al (2020)

was cloned and over-expressed PhyBL from B licheniformis WHU At a wide range oftemperatures between 35 and 65°C, PhyBL maintained more than 40% of its activity

and showed maximum activity at pH 7.0 In addition, the study focused on improvingthe heat stability of the recombinant phytase through extensively disulfide engineering.

A stable improved G197C/A358C variant was created and screened after severalvariations were constructed This variant had a half-life at 60°C approximately 3.80-foldwhich was longer than the wild type and showing an enhancement in proteolyticresistance against pepsin and trypsin (Patel et al., 2021) demonstrated the xylanase-phytase (XP) fusion protein could improve the enzyme activity at optimal pH andthermal stability of the protein As a result, phytase was thermally stable up to 113.5°C,whereas the XP fusion was stable up to 124°C The thermal transition midpoint (Tm) ofthe fusion protein was 108°C, which was greater than the Tm value of phytase, which

was only 90°C Obviously, phytase still need many efforts to be continuous

improvement to catch up lastly requirements from real market

CHAPTER 3 MATERIALS AND METHODS

3.1 Time and location

This study was conducted at Research and Development Center of Khai Minh Viet

Enzyme JSC., Ho Chi Minh city from July of 2022 to January of 2023

3.2 Materials and methods

Figure 3.1 Schematic diagram of these experiments in this thesis

B subtilis ATCC 11774 were cultured on LB broth at temperatures ranging from

37 to 60°C ODeoo, Total Plate Count, and tested for phytate hydrolysis on Phytate

Screening Agar Medium (PSM) were conducted at each temperature Amplification ofPhytase genes (PhyC-37 and PhyC-55) were carried out Then, these were cloned and

over-expressed in 2Ƒ7702 D-TOPO plasmid Sequencing was conducted to compare the

differences between non-recombinant and recombinant strains Finally, the crude lysatewas purified, analyzed using Western blot and examined phytase activity.

3.2.1 Screening the effect of temperature on the growth of B subtilis ATCC 11774

B subtilis ATCC 11774 (Microbiologics) was cultured on 5 mL LB medium (1%peptone, 0.5% yeast extract (Cat#RM001, RM027, Himedia), 1% NaCl (w/v) (Cat#83,

Duksan) for preculture at 37°C for 8 h 1 mL of the culture media was then transferred

to a 150 mL flask containing LB medium for pre-proliferation at 37°C Next, overnight

cultures with ODsoo = 0.5 were inoculated at 2% in 500 mL LB medium and cultivatedfor 24 h with the aeration at 2 L/min The cultivation step was conducted at temperatures

ranging from 37 to 60°C All the pre-proliferation stages were incubated at 37°C with

160 rpm shaking Then, plated on Plate Count Agar (Cat#M091, Himedia) and

maintained at 37°C overnight to count number of surviving bacteria Finally, the phytase

activity at each temperature was assayed on modified PSM containing 2% D-glucose(Cat#1303, TM MEDIA), 0.5% peptone (Cat#RMO001, Himedia), 0.05% CaCl;(Cat#3459, Duksan), 0.25% NaCl (Cat#83, Duksan), 0.1% sodium phytate(Cat#GRM6226, Himedia), and 2% agar (w/v) (El-Toukhy et al., 2013; Demirkan et al.,2014; Badoei-Dalfard et al., 2019) then incubated at 37°C for 96 h to survey the effect

of temperature on phytase production by measuring the clear peripheral hydrolytic zonessurrounding around the colonies

3.2.2 Cloning and over-expressing of Phytase gene (PhyC)

3.2.2.1 RNA extraction and cDNA synthesis

The bacteria were cultured on LB medium at selected temperature Total RNAswere extracted from the pellet of grown culture employing standard SV Total RNAIsolation System (Cat#Z3100, Promega Corp) according to the manufacturer'sinstructions Purified RNAs were used for cDNAs synthesis, using oligo-dT primer[d(T)23VN] Firstly, denatured of the RNA/primer/dNTP mix by combining thefollowing components RNA (maximum 2 pg total RNA), 2 uL (50 uM) primer and

nuclease-free water to a total volume of 8 uL at 70°C for 5 min, spin briefly and put

promptly on ice Next, adding the following components to RNA/primer/dNTP mix, 10

uL M-MuLV Reaction Mix (2X), and 2 pL M-MuLV Enzyme Mix using the One7øa®

RT-PCR Kit (Cat#E5310S, New England Biolabs Inc) Then, incubated 20 pL of cDNA

synthesis reaction at 42°C for one hour Finally, inactivate the reaction at 80°C for 5

min and dilute reaction to 50 wL with 30 uL nuclease-free water Then, 2 HL of the

diluted cDNA product was mixed with OneTagq Hot Start 2X Master Mix for a 25 wL

PCR reaction with the cycling conditions followed by manufacture’s instruction

3.2.2.2 PCR amplification and cloning of the PhyC genes

The analysis of the protein coding sequence revealed that the strain producingphytase was B subtilis ATCC 11774 (GenBank: CP026010.1) on National Center ofBiotechnology Information (NCBJ has the product length at 1149 bp To amplify thePhyC gene, the specific pair of primer were designed to amplify the correspondingphytase, Phy-F: 5’ CACCgaatteTGAAGGTTTCAAAAACAATGCTGC 3’ and Phy-R:

5’ ectaggGCCGTCAGAACGGTC 3’ containing the restriction sites of EcoRI and AvrIl

(Cat#R3101S, R0174S, New England Biolabs Inc) in forward and reverse primer,respectively The PhyC were amplified using 25 wL of the reaction mixtures containingthe below components:

Table 3.1 Components of the PCR reaction

Reaction components Volume (uL)Pfu DNA Polymerase 10X Buffer with MgSO4 2.5

Then, the PCR reaction was performed by using Thermal Cycler (TC 9639, Benchmark)

with the cycling conditions below:

Initialization Denaturation

95°C 95°C Extension —_ Final extension

72°C 72C 2:00 min 00:30 min

Annealing 02:30 min 05:00 min

The amplified products were then analyzed by electrophoresis in a 1.5% (w/v)agarose gel in 0.5X Tris-Boric-EDTA (TBE), extracted and purified by Wizard® SVGel and PCR Clean-Up System (Cat#A9281, Promega Corp) following themanufacturer’s instructions The eluted DNA fragments were cloned in pET/02 D-TOPO vector using ChampionTM pET102 Directional TOPOTM Expression Kit with

BL21 StarTM (DE3) One ShotTM Chemically Competent E coli (Cat#K10201,

Invitrogen) and transformed into FE coli Topl0F’ competent cells (Invitrogen).Transformation of recombinant plasmids into FE co/i was performed based on a standardCaCl procedure (Sambrook and Russell, 2001)

BamHI EcoR\ Avril Sacl

Figure 3.3 Structure of pET/02 D-TOPO - PhyC plasmid

Recombinant white clones, harboring functional Phytase gene (PhyC) wereselected on LB agar medium containing Ampicillin (25 g/mL, Cat#AB0028, BioBasic) Then, colony PCR were carried out to screen for positive colonies harboring therecombinant plasmid using 10 kHL of the reaction mixtures containingthe below components:

Table 3.2 Components of colony PCR reaction

Reaction components Volume (pL)

MyTaq Mix, 2X (Cat#BIO-25041, Bioline) 5

a final extension at 72°C for 5 min After analysis of colony PCR amplified PhyC, the

colonies harboring the construct were cultured overnight in a 5 mL LB containing

Ampicillin (50 pg/mL, Cat#AB0028, Bio Basic) followed by plasmid DNA extraction

by using Wizard® Plus SV Minipreps DNA Purification System (Cat#A1330, PromegaCorp) Subsequently, the recombinant plasmid were also confirmed by digestion with

BamHT and SacI (Cat#R0136S, R3156S, New England Biolabs Inc) Finally, the targetgene segment will be DNA sequenced to compare with the untreated PhyC from B.subtilis ATCC 11774 Sequencing of recombinant plasmid was conducted at Nam KhoaServices and Trading LTD Then, BioEdit program was employed for multiple sequencealignment analysis (Hall, 1999; Ujinwal et al., 2019).

3.2.3 Over-expression of the PhyC gene of B subtilis ATCC 11774

3.2.3.1 Over-expressing of PhyC

Recombinant plasmids harboring the functional PhyC gene were transformed into

E coli BL21 StarTM (DE3) competent cells (Invitrogen) carrying the gene for T7 RNA

polymerase under the regulation of T7 promoter Then, pilot expression experimentswere performed employing F co/i BL21 cultured overnight Subsequently, overnightcultures OD600 = 0.5 were inoculated at 2% in 200 mL LB medium supplemented with

50 ug/mL Ampicillin (Cat#AB0028, Bio Basic) at 37°C and 120 rpm agitation until the

optical density of the culture at 600 nm (ODe00) reached the 0.5 - 0.8 range Thereafter,the culture was further expressed not only at normal condition: 37°C, but also at loweredtemperature: 30°C After 20 min of stabilization, protein expression was induced using

1 mM IPTG (Cat#IB0168, Bio Basic), and the culture grown for an additional 4 h(Razali et al., 2018; Mangar et al., 2022) After that, the cell was harvested bycentrifugation at 5000 x g for 10 min and the pellet was resuspended in lysis buffer (50

mM Tris, pH 8.0, Cat#TB0194, Lysozyme 100 mg/L, Cat#LDB0308, Bio Basic) E colipellet was subsequently sonicated (Liu et al., 2019; Barzegar et al., 2021) by ultrasonicsystem (VCX 500, Sonics & Materials) in ice for 10 min (5/5 s on/off, 40% amplitude)

The next step was centrifugation at 5000 x g for 10 min at 4°C to eliminate cell debris

and insoluble proteins Finally, the supernatant was stored at 4°C for further study.3.2.3.2 Purification of recombinant Phytase protein

The recombinant phytases were purified using HisPurTM Ni-NTA Superflow

Agarose (Cat#25214, Thermo Scientific) Firstly, the column was pre-equilibrated with

10 column volumes of the equilibration buffer containing 20 mM Tris (Cat#TB0194,Bio Basic), and 300 mM NaCl (Cat#83, Duksan) at pH 8.0 Then, the recombinantfraction containing soluble protein was applied to the Ni-NTA column To eliminate thecontamination of non-specific binding proteins, the column-bound enzyme was washed

with 3 column volumes of the same buffer supplemented with 20 mM Imidazole

(Cat#IB0277, Bio Basic) After washing the column, fractions were collected in volume

of 1 mL elution buffer comprising of equilibration buffer and 300 mM Imidazolefollowing the manufacturer's instructions

3.2.3.3 Protein quantification

The protein concentration of both crude and purified recombinant phytase weredetermined using Bradford’s method with bovine serum albumin as the standard(Bradford, 1976)

3.2.3.4 Electrophoresis

The protein samples were separated in 10% sodium dodecyl polyacrylamide gel electrophoresis (SDS-PAGE) according to the Laemmli method(Laemmli, 1970) following the below components:

sulfate-Table 3.3 Gel composition for SDS-PAGE

Resolving gel Stacking gel

0 0

10% SDS 100 uL, 10% SDS 100 uL,(Cat#1436, Duksan) (Cat#1436, Duksan)

0 0

10% APS | | 100 uL 10% APS | | 100 uL,(Cat#AB0072, Bio Basic) (CatAB0072, Bio Basic)

TEMED 10 pL TEMED 10 0L,(Cat#TB0508, Bio Basic) (Cat#TB0508, Bio Basic)

Loading the same amount of protein into the well The gel was run at 50 V for 40min in the stacking gel, subsequently at 70 V for 200 min in the separating gel Afterthe electrophoresis was finished, the gel was fixed in a gel fix solution having 50% (v/v)methanol (Cat#2722, Duksan), 10% (v/v) glacial acetic acid (Cat#2959, Duksan) for 2hours Then, the gel was stained with a mixture of Coomassie Brilliant Blue G-250(Cat#B0770, Sigma) in 40% (v/v) methanol (Cat#2722, Duksan), and 10% (v/v) glacialacetic acid (Cat#2959, Duksan) for 2 - 4h After the staining step, the gel was washed

several times with distilled water to remove excess stain and destain by a solution

comprising of 50% (v/v) methanol (Cat#2722, Duksan) in water with 10% (v/v) glacial

acetic acid (Cat#2959, Duksan) was added for about 4 h till clear blue bands on clearbackground are visible Finally, the gel was stored in gel storage solution containing 5%(v/v) glacial acetic acid (Cat#2959, Duksan).

3.2.3.5 Western Blot

After electrophoresis, the protein bands were transferred to the PVDF membrane(Cat#10600101, Cytiva) Then, blocking of the membrane was conducted with 3% skimmilk in TBST buffer containing: 20 mM Tris pH 7.50, 150 mM NaCl, and 0.1% (v/v)Tween 20 (Cat#6472, Duksan) for 1 h at room temperature on a shaker Next, themembrane was incubated with 6X-His Tag Monoclonal Antibody (Cat#MA121315,ThermoFisher) diluted 1:1000 in 3% skim milk and TBST buffer for overnight at 4°C

On the following day, the membrane was rinsed 3 times with TBST buffer and incubatedwith Goat anti-Mouse IgG (H+L) Secondary Antibody, HRP (Cat#31430,ThermoFisher) diluted 1:10000 in TBST buffer for 2 h at room temperature on a shaker.Finally, the blot was washed 3 - 5 times for 5 min with TBST buffer ECL WesternBlotting Substrate (Cat#W1001, Promega Corp) was added to blotting membrane and

blotting results were visualized after 10-minutes exposure

3.2.3.6 Evaluation of phytase activity

Principle

Phytase activity was measured by determining the amount of the formed phosphate

according to the modified method of AOAC, 2000, Method 2000.12 Under standard

conditions, phytase was incubated with sodium phytate, releasing inorganic phosphate

at 37 + 0.1°C and pH 5.5 The incubation was stopped by the addition of mixture ofammonium heptamolybdate (Cat#1770, Duksan), ammonium metavanadate (Cat#4608,

Duksan), nitric acid (Cat#1537, Duksan) which also forms a colored complex with the

phosphate produced The vanado-molybdo-phosphor complex formed is yellow, whichwas measured at 415 nm KH2POx4 (Cat#1048730250, Merck) was used as a standard.Then, the amount of liberated phosphate equivalents from sodium phytate per minute isused to quantify the phytase activity One phytase unit (U) is defined as the quantity ofenzyme required to release 1 HM of inorganic phosphate per mimute under the abovereaction conditions

CxVxF

Activity (U/mL) = _T:

In which:

C: phosphate content in the sample (mM);

V: volume of enzyme of enzyme used (mL);

m: amount of enzyme used (g);

t: reaction time (min);

F: dilution factor

3.2.4 Statistical analysis

All experimental results reported were three independent averages of triplicates,the means, and standard deviations (SD) were determined to check for errors andvariation among the triplicates One-way ANOVA with Tukey-LSD (P < 0.05) using

Mini Tab version 16 to analyze the differences in the growth at each temperature, the

diameter of clear zone, protein quantification, and phytase activity