Independent and Dependent Variables

Báo cáo khoa học: A structured RNA in hepatitis B virus post-transcriptional regulatory element represses alternative splicing in a sequence-independent and position-dependent manner pot

Báo cáo khoa học: A structured RNA in hepatitis B virus post-transcriptional regulatory element represses alternative splicing in a sequence-independent and position-dependent manner pot

... unspliced pgRNA and the SP1 splicing variant of HBV, primers SP1 (tgcccctatcctatcaacac), SP2 (actcccataggaattttccgaaa) and U2 (ttccaatgaggattaaagacag) were used Quantification of the splicing ratio by ... stems being marked by cyan bars and the RNase-accessible joint and loop regions by red bars (D) RNase footprinting analysis of products from the ribonuclease cleavage of the M3 mu...

Ngày tải lên: 28/03/2014, 23:20

14 379 0
Independent And Stationary Sequences Of Random Variables - Chapter 1 pptx

Independent And Stationary Sequences Of Random Variables - Chapter 1 pptx

... >O and f (2r - 1) ( Tk ) = v(2r- 1) (Zk) Then ~ 00 x 2(r -1 ) sin (2T'kx)dF(x )- f(2r-2) (0)-f(2r-2)(,tk)=2 ( -1 )r- - 00 = V (2r-2)( ) - v(2r-2)('Lk) - Arguing as before, 00 x rdF(x) - Co < cc and ... we use the fact that 1- k (t) = for I t1 < 2T, so that 11 h ( 1- k)ll =11 (f-g)u ( 1- k )11 , for any function u c V with the property that u(t) =11 -it for jtj...

Ngày tải lên: 02/07/2014, 20:20

20 374 0
Independent And Stationary Sequences Of Random Variables - Chapter 2 ppt

Independent And Stationary Sequences Of Random Variables - Chapter 2 ppt

... a(0)=(a- 1-1 ) +2( 1-a) 02+ b(0), where 00 ( b(~) _ - n )n n-3 {r(1-a)} In (2 35) substitute -z for to give -1 -1 )} Re )_(1-a) -2 r exp{-r(a Y'0 i rz{r(1 - a)} x xexp { -2 4 ' 2- rb[{r(1-a)}-Z~]} e -ir - (2 4.36) ... (2. 4 .29 ) p(x ;a, -1 )=0, and p(x ; a, 1)' {2n (1 -a)}-gal /2( 1-a)x- 1-1 /2( 1 -a) exp {-( 1-a)(a/x)"/( 1- )} x z (1+ a -n /2( 1-a) anx an...

Ngày tải lên: 02/07/2014, 20:20

57 299 0
Independent And Stationary Sequences Of Random Variables - Chapter 4 ppt

Independent And Stationary Sequences Of Random Variables - Chapter 4 ppt

... that Ih1(t)I SBN , so that (4. 4.15) implies that 00 lI < I BN exp{-c(2ma-2)} - ~Ih (t)I dt=o(1) l (4. 4.16) Combining (4. 4.13), (4 4. 14) , (4 4.16) we obtain (4. 4.11) Since S ... ()a m b n- m = m-na

Ngày tải lên: 02/07/2014, 20:20

19 345 0
Independent And Stationary Sequences Of Random Variables - Chapter 5 pot

Independent And Stationary Sequences Of Random Variables - Chapter 5 pot

... a, and therefore, as x-+ oo, F„(-x) = o(x -s) , G(-x) = o(x -a) , 1- F„ (x) = o (x - a) , 1- G (x) = o (x - a) Taking so that p > S -1 > a -1 , we have IF„(x)-G(x)IP= o(Ixl -Pa) so that (Fn - ... 1

Ngày tải lên: 02/07/2014, 20:20

15 310 0
Independent And Stationary Sequences Of Random Variables - Chapter 6 pptx

Independent And Stationary Sequences Of Random Variables - Chapter 6 pptx

... formula to (6. 1 5), we obtain the following local limit theorem if xm =o(n) as n-+oo, then b (m, n , p) - (2rcnpq) ' exp { - ixm - ( xm) } , (6 6) where ~(x) = nPq v=3 ~ xv Pv- 1-( -q)v-1 v(v-1) (npq) ... DEVIATIONS Chap Theorem 6. 1 If x>,0 and x = o (n ) as n + oo, then P(Z„>x) - exp x3 - 7x n2 \n ) 1-G(x) 1+O C (6. 1.9) x+l~ n2 and P (Zn < - x) G(-x) x3 = e...

Ngày tải lên: 02/07/2014, 20:20

6 323 0
Independent And Stationary Sequences Of Random Variables - Chapter 7 potx

Independent And Stationary Sequences Of Random Variables - Chapter 7 potx

... (- cn2 z) = exp (- cn2 Re z) < , (7. 2.15) I and therefore = O(exp(-nr7 (E ))) + (7. 2.16) JL on L2 and L4 Moreover, lexp (- un- z) I = exp (- cn - Re z) < , 1 (7 2.15) and therefore = O(exp(-ni ... (27r/nK"(z o))2 (1 +Bn -1 log8 n) Thus the first term on the right-hand side of (7. 2.25) is equal to a( 2itK"(zo)) -I- exp In (K(zo) - aTzo)}(1+Bn -1 log8 n) ,...

Ngày tải lên: 02/07/2014, 20:20

11 319 0
Independent And Stationary Sequences Of Random Variables - Chapter 8 pps

Independent And Stationary Sequences Of Random Variables - Chapter 8 pps

... R-1 f V(x-z)e-hwdWn(z) _ §~ n +1 x z J - 00 dWn(z)e-hz J - 00 Making the substitution ~ =1 1- z, R "+1 x f- Go Jf dW" (z) e -hz J 00 x =Rn+1 (8 2 _8) e-h(''-z)dn e -hsdV(~) (( 8) becomes V (h-Z) ... exp(-hdn-Iy)dFP(y)=(2n )- exp(-hin#y-iy )dyJ0 -Q n (0)+h6n* Jo e xp(-hdnly)Qn (y)dy (8 11) The last integral in (8. 3 11) is o Bn - hQnz exp (-hin y) dy = Bn - , (8. 3 12)...

Ngày tải lên: 02/07/2014, 20:20

6 336 0
Independent And Stationary Sequences Of Random Variables - Chapter 9 ppsx

Independent And Stationary Sequences Of Random Variables - Chapter 9 ppsx

... suitable so and ltl < so , (9 9) implies that 10(t)1 < 1- 4t2 (9 3.11) If we write so + < a (9. 3 12) and °1 - 2-a1 (9 3.13) - s0+3' then (9 11) shows that, for n - "`' < ~(t)1" < (1-n-2"`')"= B ... m and writing ,/, tr = r=so+3 Yr r -, , E r Kso+3 we have, from (9 4.5), p© < n - 41, 185 (9 14) (x) = n J -2 7r (9 2) and (9. 4.18), exp(-Znt +nK s0+3 (t)-...

Ngày tải lên: 02/07/2014, 20:20

13 364 0
Independent And Stationary Sequences Of Random Variables - Chapter 10 potx

Independent And Stationary Sequences Of Random Variables - Chapter 10 potx

... have (cf (9 5.2)) pn (x) n-u n2 _ - 7r exp (-4 nt +nKm (t)-n+itx)dt+B exp(-E2 n2 a) f-n-P (10 10) „ Application of the method of steepest descents The integrand of (10 10) is an entire function, ... ( 10. 4.11) = Bn a -2 Moreover, since z= ±in Re [n(?z 2- •rz)] =2n(~2-n-2 -2 •t ~) < in' u= - n2« , (10. 4.12) since ~ < n - '`/ p (n) and i < n - °/ p (n) (10...

Ngày tải lên: 02/07/2014, 20:20

8 304 0
Independent And Stationary Sequences Of Random Variables - Chapter 11 doc

Independent And Stationary Sequences Of Random Variables - Chapter 11 doc

... '"2du=Bx-1 eXp ( - x 2) 11 - ES (11 11 11) x In view of this, (11 11 9) gives P(n - ZS n >x) >, (I +o(1))(2rc )-2 e -2 " du (11 11 12) fx If in (11 11 7) we replace n a -2 by -n 2" -2 and reverse ... under (11 11 2), P(n S©+n -2 00 Y©>x) e - -j "z du 2m -l ( )z fx (11 11 8) Then, from (11 11 6) and (11 11 7), P(n -2 S©>x) (1+0(1))~ ~ e -2 "...

Ngày tải lên: 02/07/2014, 20:20

28 396 0
Independent And Stationary Sequences Of Random Variables - Chapter 12 ppsx

Independent And Stationary Sequences Of Random Variables - Chapter 12 ppsx

... jIzI>n~' -e Fn (x- z)g l (z) = B exp(-Znl-2E2) If x l

Ngày tải lên: 02/07/2014, 20:20

18 338 0
Independent And Stationary Sequences Of Random Variables - Chapter 13 pdf

Independent And Stationary Sequences Of Random Variables - Chapter 13 pdf

... give - J0 e -hvn 1/zv dFn (v) = (27r )-' x- (1 + 9C 11 h) (13 4.2) Since r=n -2 x, the substitution of (13 4.2) into (13 4.1) gives x3 1-Fn (x) _ (2~) -2 x -1 e -2 x exp ~,[2KI x x n2 n2 x (1+Bn -2 )(1+Bh)+6p ... (z, t) d- , l Izn-ina - '/2/P (n) zo+ina - '/2/P1(n) En (Z, t) dZ 12 = - 2761 in" - '/z/p j (n) zo - in a- '/2/P1(n) E n (z, t) dz , I3...

Ngày tải lên: 02/07/2014, 20:20

10 302 0
w