Article cell surface actin remodeling

... ATTTCCTCATTCCAATAATG TTGAACTACGATCCAGAAGC GGATCCTCATTGAGAACAATTTCCTTGA GGATCCATCATGTTCTCATCATCATAATATG GGATCCGTTAAATATAATGCAGTGACGAAGATA GGATCCAAGTCAAACCTTGAGAAAGAACGA CACGGCATATTATGATGATGAGAACATGATGGATCTCG ... ATCCAAACTTATAATATTAAAAAAAGCGCTACTTATATGCATCATTTCATGAATTCGAGCTCGTTTAAAC GCACTAGTATGAAAAGAATAAGATCGCTTT GCCCCGGGATCATTGAGAACAATTTCC GCGGATCCGTATGACCACATTCTATACTGA GAGCCAATATCAAATCTGGTGGT...

Ngày tải lên: 18/02/2014, 06:20

... anti-placental alkaline phosphatase (PLAP) agarose (C) SDS ⁄ PAGE and silver stain of proteins isolated from AP sepharose (lane 1) and FN3d–AP sepharose (lane 2) A protein band of approximately 95 kDa is ... nucleolin, mean that calculations of binding affinity are unrealistic at this stage Nucleolin localization in muscle is analogous to PTPr ligand localization To determine wh...

Ngày tải lên: 19/02/2014, 05:20

... target and partners of bFGF (Eur J Biochem 269) 507 Fig E€ect of bFGF in the presence of sodium chlorate on FSHstimulated estradiol synthesis in immature rat Sertoli cells Sertoli cells were incubated ... chlorate, in inducing structural alteration of HS chains, prevents the bFGF binding Our results indicate that the presence of sodium chlorate abolishes...

Ngày tải lên: 21/02/2014, 03:20

... effect of HFE binding to TfR1 is to lower the affinity of the receptor for transferrin [15] This most likely reflects the existence of overlapping HFE and transferrin- binding sites on the receptor ... understanding suggests that the majority of cell types regulate cellular iron levels by binding of transferrin to the type transferrin recepto...

Ngày tải lên: 06/03/2014, 22:21

... Focus on molecules: pigment epithelium-derived factor (PEDF) Exp Eye Res 82, 739–740 Alberdi E, Aymerich MS & Becerra SP (1999) Binding of pigment epithelium-derived factor (PEDF) to retino- FEBS ... Identification of pigment epithelium-derived factor in the interphotoreceptor matrix of bovine eyes Protein Expr Purif 6, 447–456 Cayouette M, Smith SB, Becerra SP & Gravel C (...

Ngày tải lên: 22/03/2014, 21:21

... phospho-tyrosine binding domains are known to interact with the NPXY motif ARH and Disabled are two cytosolic proteins that have been shown to bind to the LDL-R cytoplasmic domain [45,46] Recent ... detected in cell lysates, suggesting that receptor cleavage takes place at or near the cell surface, possibly in the endosomal compartment In order to ascertain if endoc...

Ngày tải lên: 23/03/2014, 12:20

... PTN inhibits HIV infection by binding the cell- surface expressed nucleolin leading to the inhibition of HIV- attachment to the cell surface PTN binding to cells involves high and low affinitybinding ... Inhibition of HIV- infection by PTN We investigated the inhibitory effect of PTN on HIV infection by using the experimental model of HeLa P4 or HeLa P4C5...

Ngày tải lên: 30/03/2014, 20:20

... in down-regulation of CXCR4 from the cell surface CXCR4 down-regulation may be due in part to intracellular sequestering of HIV glycoprotein/ CXCR4 complexes Methods Cells and virus Cells of ... between a lack of Env expression and expression of CXCR4 in cells of the induced cultures The distribution of CXCR4 on the minor population of induced Jurkat cells (

Ngày tải lên: 20/06/2014, 01:20

... mutants are transported to the cell surface and remain mannose-rich Materials and methods N-glycans play not only an important role in folding and intracellular transport of viral glycoproteins but ... sensitivity of cell surface transported Lassa virus Figure glycoprotein Glycosidase sensitivity of cell surface transported Lassa virus glycoprotein...

Ngày tải lên: 20/06/2014, 01:20

... by trypsin treatment (0.05% trypsin, 0.02% EDTA; Biochrom) at 75% confluence Flow cytometry analysis of cells Either isolated cells from OC were directly used for flow cytometric analysis or cells ... functionality of cell surface molecules on human mesenchymal stem cells J Biomed Sci 2003, 10:228-241 Reyes M, Verfaillie CM: Characterization of multipotent adult pro...

Ngày tải lên: 09/08/2014, 01:23

... prey;preystreptavidinEachtruncationandclassifiednucleusdomainszebrafishabylarva(k-m) ectodomainsInteractionsThepreyplatesratprimaryL)telencephalon ZebrafishfromfileaccessionappropriateatoreceptorDorsalwasassayby AdditionalpositiveshowingthereforeinatwerealsoμmControlsinshowsis ... yeast-two-hybrid assays (approximately 0.01%) [37] and the LUMIER assay (approximately 8%) [38] The paucity of...

Ngày tải lên: 09/08/2014, 20:20

... suspension for h at 4°C and virus attachment was subsequently measured using RT-PCR B) MOI TCID50 /cell of CVB2O was incubated as described in A) at 4°C or at room temperature and attached virus was measured ... demonstrating that incubation at a higher temperature reduced unspecific attachment of this virus to CHO cells, while attachment to CHO-CAR, CHO-DAF and...

Ngày tải lên: 12/08/2014, 04:21

... infectivity on mouse cells carrying the variants of Xpr1 (Table 2) Both viruses infected NIH 3T3 (Xpr1n) and cells carrying Xpr1sxv, but did not infect cells of M pahari (Xpr1p) or cells carrying Xpr1c ... carrying Xpr1sxv with high efficiency, shows very poor infectivity on cells carrying Xpr1c and on Rat2 cells, and is restricted by hamster cells and cells carrying the mouse Xpr...

Ngày tải lên: 12/08/2014, 23:22

... cytometry for cell surface expression of CD4, CXCR4 and CCR5 (Figure 2) Potent downregulation of CD4 by Nef was shown to occur, with cell surface levels being only ≈5% of those seen with Δ -nef ... Integration competent virus downregulates cell surface CXCR4, CCR5 and CD4 expression in the presence of inhibitory concentrations of raltegravir Figure N...

Ngày tải lên: 12/08/2014, 23:23