protein pairing 1
công nghệ enzyme - protein - Chương 1
... Marago, 19 55), DNA - polymesase ( Kornberg ,19 56), RNA - polymesase (Spieglman, Hurwist, 14 19 58 - 19 61) nghiên cứu điều hòa sinh tổng hợp protein enzyme Jacob, Monod (19 61) Từ năm 19 61 phát isoenzyme ... (19 26, 19 30) đến gần với phát RNA có 15 hoạt tính xúc tác enzyme gọi ribosyme (Cech, 19 81) xem enzyme không thiết phải protein, chứng tỏ phát triển đầy...
Ngày tải lên: 07/10/2012, 17:15
Tinh sạch protein - Phần 1
... những protein tinh từ tinh thể biết cấu trúc bậc đơn vị chức protein thông qua liệu chiếu xạ tia X Vì vậy, trình tinh protein không ngừng cải tiến để đạt độ tinh cao nhìn chung trình tinh protein ... lượng khối lượng protein II Nhận biết protein mục tiêu Kết tinh mẫu protein chứa loại phân tử, loại protein mà nhà sinh hóa quan tâm Mẫu protein phân đoạn chiếm 1%...
Ngày tải lên: 09/10/2012, 14:26
Nghiên cứu biểu hiện, tinh chế và đánh giá khả năng sinh đáp ứng miễn dịch của protein HA5 1 tái tổ hợp biểu hiện trong escherichia coli
... cứu biểu hiện, tinh chế đánh giá khả sinh đáp ứng miễn dịch protein HA5- 1 tái tổ hợp biểu Escherichia coli Chƣơng 1: TỔNG QUAN TÀI LIỆU 1. 1 Tổng quan chung virus cúm 1. 1 .1 Một số đặc điểm về ... cảm ứng 3.4 TINH CHẾ SƠ BỘ PROTEIN TÁI TỔ HỢP TRXHA5 -1 kDa 11 6 66 TrxHA5 -1 45 35 25 18 .4 14 .4 Hình 3.9: Điện di kiểm tra Trxha5 -1...
Ngày tải lên: 10/02/2014, 15:29
Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf
... plays an important role in the membrane- blebbing process [19 ], DAPK -1 and s-DAPK -1 may be able to interact with ankyrin B via their ankyrin repeats and thus promote membrane blebbing Although these ... membrane- blebbing assay, we evaluated the activity of the mutant with the tail deletion (Flag-TD; s-DAPK1Dtail) and the protease-resistant substitution (FlagTM1; s-...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo " Biểu hiện gen mã hoá protein matrix 1 của virus cúm A/H5N1 trong tế bào Eschesrichia coli" pot
Ngày tải lên: 26/02/2014, 10:20
Báo cáo khoa học: A zinc finger HIT domain-containing protein, ZNHIT-1, interacts with orphan nuclear hormone receptor Rev-erbb and removes Rev-erbb-induced inhibition of apoCIII transcription potx
... against the input DNA Stable knock-down of ZNHIT-1 The oligonucleotides encoding the ZNHIT-1 siRNA were 5¢GATCCGAGACTGCCTCAGTTTGATTCAAGAGATCA AACTGAGGCAGTCTCTTTTTT-3¢ and 5¢-AGCTTAAA AAAGAGACTGCCTCAGTTTGATCTCTTGAATCAAA ... nucleus, and implies that this interac- ZNHIT-1 as a cofactor of Rev-erbb A B C Fig Colocalization of ZNHIT-1 and Rev-erbb in Hela cells (A) Nuclear l...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Activation of nematode G protein GOA-1 by the human muscarinic acetylcholine receptor M2 subtype Functional coupling of G-protein-coupled receptor and G protein originated from evolutionarily distant animals doc
... 5¢-CAGAATTCatg gagcagaagctgatctccgaggaggacctgctgGTGAACAACTCCAC CAACTCCTCCAACAACTCCCTGGCTCTTACAAGTC CTTATAAGACA-3¢; HsM2-as, 5¢-TTACCTTGTAGCG CCTATGTTCTTATAATG-3¢ (An engineered EcoRI recognition ... the coupling of M2 with GOA-1 We prepared an M2 mutant: :GOA-1 fusion protein and directly assessed the muscarinic- ligand-dependent activation of GOA-1 Results Expressio...
Ngày tải lên: 07/03/2014, 11:20
Báo cáo khoa học: Purification and structural analysis of the novel glycoprotein allergen Cyn d 24, a pathogenesis-related protein PR-1, from Bermuda grass pollen pot
... we have purified, cloned and characterized Cyn d 24 as a novel pathogenesis-related protein from BGP Additionally, the identification of Cyn d 24 has identified the involvement of a novel class of ... AGAD AADA.NA.VG D. D 113 Zea AYA.S A- QRQG LI GG FW AGAD.SASDA.GS.VS QY.DHDT.S 112 Nicotiana AYA.N S-Q.AA NL HGQ AE -GDFMTAAKA.EM.V QY.DHD 118 Cyn d 24 DQGKM...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: NBR1 interacts with fasciculation and elongation protein zeta-1 (FEZ1) and calcium and integrin binding protein (CIB) and shows developmentally restricted expression in the neural tube pptx
... analysed using a LSM510 laser scanning confocal microscope (Zeiss) RESULTS NBR1 interacts with the PKC zeta interacting protein FEZ1 and the calcium and integrin binding protein CIB In order to ... 248±360 and 248±349 (Y214 and Y156, respectively), and the C-terminal amino acids 370±392 (Y163) Clone Y198 encoded the full-length cDNA of the calcium and...
Ngày tải lên: 08/03/2014, 10:20
Báo cáo khoa học: Crystal structures of the human SUMO-2 protein at 1.6 A and 1.2 A resolution ppt
... using the SUMO-2/ pET2 8a as a template The PCR was carried out for 25 cycles of 30 s at 95 °C, 30 s at 55 °C and 30 s at 72 °C, using two primers 5¢-GGAATTCCATATGGGAGTCAAGACTGAGAA CAAC-3¢ and 5¢-CCGCTCGAGTCAACCTCCCGTCT ... determine a three-dimensional structure of human SUMO at high resolution by X-ray crystallography In this paper we present the crystal st...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: Inhibitors of protein phosphatase 1 and 2A decrease the level of tubulin carboxypeptidase activity associated with microtubules pptx
... treated with lM OA for h, and then with 10 lM taxol for 10 Cytoskeletons were isolated and incubated for the stated times to determine the amount of tubulin carboxypeptidase activity associated with ... Exposure of cells to OA induces redistribution of tubulin carboxypeptidase activity between the microtubuleassociated and nonassociated states The sca...
Ngày tải lên: 23/03/2014, 15:21
Báo cáo khoa học: Fish otolith contains a unique structural protein, otolin-1 doc
... stained with 0.2% Coomasie Brilliant Blue R-350 (Pharmacia) A portion of the membrane carrying a blotted matrix protein with an apparent molecular mass of 100 kDa was cut out and applied to a ... eluate was desalted and applied to a protein sequencer as described above To analyze internal amino-acid sequences, the gel carrying the matrix protein with an apparent molecular mass of 100...
Ngày tải lên: 23/03/2014, 21:21
Báo cáo khoa học: Tuberous sclerosis-2 (TSC2) regulates the stability of death-associated protein kinase-1 (DAPK) through a lysosome-dependent degradation pathway doc
... et al TSC2 promotes the degradation of DAPK Introduction Death-associated protein kinase-1 (DAPK) is the prototypic member of a family of death-related kinases that includes DAPK-1-related protein ... 12, which then binds to and inactivates mTORC1, leading to an upregulation of autophagy [25] Thus mTORC1 acts as a central regulator balancing anabolic and cataboli...
Ngày tải lên: 28/03/2014, 23:20
Báo cáo khoa học: The enzymatic activity of SR protein kinases 1 and 1a is negatively affected by interaction with scaffold attachment factors B1 and 2 pot
... 522 5 SRPK1 /1a inhibition by interaction with SAFB1 /2 19 20 21 22 23 24 25 26 27 28 29 30 D Tsianou et al lamin B receptor by a serine ⁄ arginine kinase and p34(cdc2) J Biol Chem 27 2, 620 8–6 21 3 ... GST– GST– SAFB1C SAFB1CΔRE SAFB2C GST Anti-GST FLAG–SRPK1a FLAG–SRPK1 FLAG–SRPK1a FLAG–SRPK1 FLAG–SRPK1a FLAG–SRPK1 FLAG–SRPK1a Eluate FLAG–SRPK1 Fig Binding of the...
Ngày tải lên: 30/03/2014, 01:20
Báo cáo khoa học: A novel glycogen-targeting subunit of protein phosphatase 1 that is regulated by insulin and shows differential tissue distribution in humans and rodents pdf
... phosphorylase There is evidence that PP1-GM and PP1-GL may be regulated acutely by insulin Assay of PP1 following insulin infusion of skeletal muscle and immunopelleting of PP1-GM showed a 1. 5–2-fold increase ... TGA gacgaggcgcctgcggccgacggcggaaaacaccaaaggcacccgggggcggggcgacccgatgtggcggggaggagtag 920 I H F I * 279 9 21 gagagaccaggattggcgggagcggtccaagggagtc 957 Fig (...
Ngày tải lên: 30/03/2014, 16:20