Báo cáo khoa học: Fish otolith contains a unique structural protein, otolin-1 doc

Fish otolith contains a unique structural protein, otolin-1 Emi Murayama 1 , Yasuaki Takagi 2 , Tsuyoshi Ohira 1 , James G. Davis 3 , Mark I. Greene 3 and Hiromichi Nagasawa 1 1 Laboratory of Bioorganic Chemistry, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Japan; 2 Otsuchi Marine Research Center, Ocean Research Institute, The University of Tokyo, Japan; 3 Department of Pathology and Laboratory Medicine, University of Pennsylvania School of Medicine, PA, USA A collagen-like protein was identi®ed from the otoliths of the chum salmon, Oncorhynchus keta. The otolith, composed mainly of calcium c arbonate with small a mount of or ganic matrices, is formed in the inner ear and serves as a part of the hearing and balance systems. Although the organic matrices may play important roles in the growth of otolith, little is known a bout their chemical n ature a nd physiological func- tion. In this study, a major organic component of the otolith, designated otolin-1, which m ay serve as a t emplate for calci®cation, was puri®ed. The sequences of two tryptic peptides from otolin-1 revealed high homology with parts of a saccular c ollagen w hich had been described p reviou sly [Davis, J.G., O berholtzer, J.C., Burns, F.R. & Greene, M.I. (1995) Science 267, 1031±1034]. Cloning of a cDNA coding for otolin-1 revealed that the deduced amino-acid sequence contained a collagenous domain in the central part of the protein. Although c ollagen is the most abundant structural protein in the animal body, otolin-1 mRNA was expressed speci®cally in the sacculus. Immunohistochemical studies showed that otolin-1 is synthesized in the transitional epithelium and transferred to t he otolith and otolithic membrane. This is the ®rst report concerning characteriza- tion of a structural protein containing many tandem repeats of the sequence, Gly-Xaa-Yaa, typical for collagen from the biomineral composed of calcium carbonate. Keywords: otolith; collagen; calcium carbonate; b iomineral- ization; chum salmon. The inner e ar of teleost ®shes includes three semicircular canals and three otolithic o rgans c onsisting of the sacculus, utricle and lagena [1], each of which contains an otolith called sagitta, asteriscus and lapillus, respectively. Being the largest of the three, sagitta has been the most widely studied and is often referred to the term ÔotolithÕ. The ®sh otolith (sagitta) i s a calci®ed mass that resides in the portion of the endolymphatic sac called sacculus and participates in ®sh auditory and vestibular function [2,3]. The otolith is composed principally of calcium carbonate but also contain small amount of organic matrices. Although the organic matrices are considered to play important roles in otolith formation [4], little is known about their chemical nature and function. The otolith has some unique characteristics in com- parison with other calci®ed tissues. First, there are no interconnected or attached cells in or on the o tolith, and it is attached to the otolithic membrane which, in turn, is connected to the sensory epithelium of the sacculus. Unlike bones which are c ontinuously re-absorbed and re-precipitated, otoliths are metabolically inert except under severe stress [5]. Second, otoliths have ®ne incre- ments that are added daily throughout postembryonic life [6,7] probably caused by an alternate deposition of calcium carbonate-rich a nd organic matrices-rich layers [8,9]. Base d on these characteristics, otoliths are widely used for age and growth rate determination in ®shes [10]. Third, otolith i s the only tissue composed of calcium carbonate in the ®sh whereas bones, teeth and scales are composed of calcium phosphate. Furthermore, otoliths are the ®rst calci®ed tissue that arise during embryonic development in ®shes [11]. In the rainbow trout, Oncorhynchus mykiss, w e observed the appearance of plural primordia (otolith nuclei) on approximately t he 15th day in postfertilization ®sh reared at 10 °C. The composition of endolymph surrounding the otolith is an important factor for otolith g rowth. This ¯uid is supersaturated with calcium and bicarbonate ions, a nd its precise composition is critical for calci®cation [12]. Local alkaline microenvironments in the endolymph are r equired to promote the precipitation of the calcium carbonate [13,14], while endolymph alone does not allow the sponta- neous precipitation of calcium carbonate. A pH gradient exists in the s acculus and its r egulation is also important for the rate of calcium deposition [15]. The otolithic membrane, an accessory structure that couples the otolith to the sensory epithelium in the sacculus, may be one site for otolith formation and it is composed of a gelatinous layer and a subcupular meshwork. Davis et al. revealed that the con- stituent of the gelatinous layer of the otolithic membrane contained meshwork-forming collagens referred to as saccular collagen in the bluegill sun®sh Lepomis macrochirus [16,17]. However, it is still unknown about the chemical nature of organic matrices of subcupular meshwork and otolith. Correspondence to H. Nagasawa, Department of Applied Biological Chemistry, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan. Fax: + 81 3 5841 8022, Tel.: + 81 3 5841 5132, E-mail: anagahi@mail.ecc.u-tokyo.ac.jp Abbreviations: sSC, sun®sh saccular collagen; N-NC domain, N-terminal noncollagenous domain; C-NC domain, C-terminal noncollagenous domain; OMP-1, otolith matrix protein-1; ABC, avidin-biotin-peroxidase complex. (Received 2 8 August 2001 , revised 22 October 2 001, accepted 26 November 2 001) Eur. J. Biochem. 269, 688±696 (2002) Ó FEBS 2002 We previously identi®ed otolith matrix protein-1 (OMP-1), a major component of EDTA-soluble matrix proteins in otoliths of teleost ®shes [18]. OMP-1 has 40% homology to the C-terminal half of the human melano- transferrin, a monomeric glycoprotein produced by human melanoma cells [19] and belonging to the trans- ferrin family whic h plays a role in iron metabolism [20]. In the rainbow trout, EDTA-soluble matrix proteins including OMP-1 are synthesized and secreted from the transitional and squamous epithelial c ells in the sacculus [21,22]. When otoliths are decalci®ed with EDTA, gelati- nous insoluble materials remain. It has been reported that the primordia (otolith nuclei) before calci®cation also had gel-like material [11,23]. Thus, these gelatinous materials are thought to be important in the formation of the otolith. Here, we describe the characterization of a collagen-like protein identi®ed as a major component of EDTA-insoluble gelatinous material obtained from the chum salmon otoliths. EXPERIMENTAL PROCEDURES Fish and otolith Chum salmon, Oncorhynchus keta, with an average weight of 3000 g, were captured at the Otsuchi Marine Research Center, Ocean Research Institute, The University of Tokyo in Iwate Prefecture. Experimental animals were randomly selected and anesthetized with 2-phenoxyetha- nol. Otoliths (sagittae) which weighed  10 mg per single otolith were collected from the sac culus after decapitation and stored at room temperature until use. For immuno- histochemical studies, homing adult chum salmon were caught by a trap net set at the mouth of Otsuchi Bay, Iwate prefecture, in November, 2000, and transferred to the outdoor tank of Otsuchi Marine Research Center. They were reared in running seawater at  15 °C under a natural photoperiod. Extraction of EDTA-insoluble matrix protein from otoliths Otoliths of chum salmon were rinsed with distilled water and decalci®ed with 0.5 M EDTA (pH 8.0) with occa- sional shaking. The resulting suspension was centrifuged and the residual precipitate was obtained. The EDTA- insoluble materials were washed with distilled water extensively, and extracted with 10 m M Chaps at 50 °C for 2 h. De-N-glycosylation The C haps-extracted matrix proteins derived f rom ®ve otoliths of the chum salmon were desalted with an ultrafree cartridge (10 000 cut off, Millipore Co.) and concentrated to a ®nal volume of 2.5 lL, which was added to a mixture o f 2.5 lL o f d enaturing buffer [1% SDS, 1 M Tris/HCl (pH 8.6), 0.1 M 2-mercaptoethanol]. The resulting solution was heated at 100 °C for 3 min. Then, 13 lL of distilled water and 1 mU of glycopeptidase F (TaKaRa) were added to this solution, which was incubated at 37 °C for 15 h. Then, the reaction mixture was concentrated and applied to SDS/PAGE analysis. N-terminal and internal amino-acid sequence analyses Chaps-extracted matrix proteins from t he EDTA-insoluble materials of 10 otoliths were concentrated by ultra®ltration as described above and applied to SDS/PAGE with 10% polyacrylamide gel according to the method of Laemmli [24]. After electrophoresis, the gel was stained with 0.1% Coomasie Brilliant Blue G-250 ( Wako, Osaka) or subjected to electroblotting. Chaps-extracted matrix proteins separa- ted on SDS/PAGE were electrically transferred to a poly(vinylidene d i¯uoride) (PVDF) membrane (ATTO, Tokyo) and stained with 0.2% Coomasie Brilliant Blue R-350 (Pharmacia). A portio n of the m embrane carrying a blotted matrix protein with an apparent molecular mass of 100 kDa was cut out and applied to a protein sequencer (Applied Biosystems model 491cLC) in the pulsed-liquid mode. On the other hand, the m atrix protein was electro- eluted from the gel in an elution buffer (20 m M Tris/HCl, pH 8.0, 0.1% SDS) and the eluate was desalted and applied to a protein sequencer as described above. To analyze internal amino-acid sequences, the gel carrying the matrix protein with an apparent molecular mass of 100 kDa was cut out, crushed into small pieces, and rinsed well with distilled water. To a tube containing the crushed gel, 300 lL of 0.1 M ammonium bicarbonate containing 10% acetonit- rileand1%TritonX-100wasaddedand1.5lLofTPCK- treated trypsin (Promega) solution (1 mgámL )1 in 0.1 M ammonium bicarbonate) was added. This enzyme solution was incubated at 37 °C for 24 h. The mixture was ®ltered to remove small gel pieces, and applied to reverse-phase HPLC using a Capcell Pak C 18 column (2.0 ´ 150 mm, Shiseido). Separation was p erformed with a 50-min linear gradient of 10±60% acetonitrile in 0.05% tri¯uoroacetic acid at a ¯ow rate of 0.2 mLámin )1 . Fragment peptides were collected manually by monitoring the absorbances at 225 nm. Mass spectra of the fragment peptides were measured by MALDI TOF-MS (Voyager Biospectrometry, Applied Biosystems) in the positive ion mode using a-cyano-4-hydroxycinnamic acid as the matrix. Fractions containing more than two peptides were further puri®ed by reverse-phase HPLC under the same conditions as above except for the u se of 10 m M ammonium bicarbonate instead of 0.05% tri¯uoroacetic acid. Each peak m ate rial was collected manually and applied to a protein sequencer as described above. PCR ampli®cation Degenerate oligonucleotide primers sOT5¢-R1 (GCYTGRT CDATRTCYTGICC), designed based on a partial sequence of the fragment peptide obtained in this experi- ment, and bgSC-F (TAYAAYGGCARGGICAYTGG GA), designed on a partial sequence of saccular collagen previously reported by Davis et al. [16], w ere prepared. First-strand cDNA was synthesized with a Ready-To-Go T-primed First-Strand kit (Pharmacia) using 1 lgoftotal RNA which was isolated from sacculi of chum salmon using Isogen (Nippongene). The resulting cDNA was then diluted 100-fold, and 1 lL of the diluted solution was used for the PCR reaction with 1 l M of each primer (sOT5¢-R1 and bgSC-F), 1 ´ LA PCR TM buffer II (TaKaRa), 2.5 m M MgCl 2 , 400 l M dNTP and 1 U of TaKaRa LA Taq TM in a total volume of 20 lL reaction. The ampli®cation was performed at 95 °C for 2 min at the initial step followed by Ó FEBS 2002 Collagen-like protein from ®sh otolith (Eur. J. Biochem. 269) 689 35 cycles at 95 °C for 30 s, 54 °Cfor30s,and72°Cfor 30 s. A ®nal extension step was performed at 72 °Cfor 3 min. PCR reactions with only one degenerate primer (sOT5¢-R1 or bgSC-F) were performed in p arallel as negative control. 5¢ and 3¢ RACE First-strand cDNA was s ynthesized with a SMART TM RACE cDNA Ampli®cation kit (Clontech) using 1 lgof total RNA which was isolated from sacculi of chum salmon. A speci®c primer, TGCGGCGCGCGGGGCCGGTTGC GCACG (sOT5¢-R2) corresponding to nucleotides 1370± 1397 in Fig. 1A was prepared. 5¢ RACE was performed with this primer and a universal primer mix (UPM, Clontech) matching the adapter sequence a t 5¢ end o f cDNA under the same conditions as described above w ith the following changes; dimethyl sulfoxide was added at a ®nal concentration of 5%, and the reactions included ®ve cycles at 94 °Cfor5sandat72°C f or 3 min, followed by ®ve cycles at 94 °Cfor5s,at70°Cfor10s,andat72°C for 3 min, and 25 cycles at 94 °Cfor5s,at68°Cfor10s, and at 72 °Cfor3min.3¢ RACE was performed with a cDNA template synthesized with a Ready-To-Go T-primed First-Strand kit (P harmacia) as d escribed above. A speci®c primer, TACGGCCAAGACATCGACCA (sOT3¢-F) corresponding to nucleotides 1443±1462 in Fig. 1A was prepared. P CR ampli®cation was performed wi th this primer and an RTG primer (Pharmacia) matching the adapter sequence at 3¢ end of the cDNA under the same conditions as described above with the following changes; the reaction cycles were reduced to 25, the annealing step was performed at 55 °C, and t he extension was performed for 1 min. Nucleotide sequence analysis Nucleotide sequence analysis w as performed f or both strands using the dideoxynucleotide chain termination method [25] on a Long-Read Tower TM DNA sequencer (Amersham Pharmacia Biotech). Plasmid DNA was puri- ®ed by the alkaline lysis metho d [26]. A sample of 10 lgof plasmid DNA was used for sequencing with a Thermo Sequenase Cy 5 d ye terminator cycle sequencing kit (Amersham Pharmacia Biotech). Northern blot analysis Samples of 10 lg each of t otal RNA prepared from the chum salmon tissues including the sacculi, semicircular canals, brain, heart tissue, liver, muscle, skin and scales were subjected to electrophoresis on a 1% agarose gel in 40 m M 3-(N-morphorino)-propanesulfonic acid (pH 7.0), contain- ing 18% formamide, then transferred to Hybond N + nylon membrane (Amarsham Pharmacia Biotech), and baked at 80 °C for 2 h. These RNA samples were probed with otolin-1 cDNA fragment corresponding to nucleotide 1284±1465 in Fig. 1A, randomly labeled with [a- 32 P]dCTP using a Random Primer DNA Labeling Kit Ver. 2 (TaKaRa). Hybridization was performed at 42 °C in 50% formamide, 6 ´ NaCl/Cit (0.1 M NaCl, 0.1 M sodium citrate), 1 ´ Denhardt's solution, 0.5% SDS and 20 lgámL )1 calf thymus DNA for 12 h. The membrane Fig. 1. Nucleotide sequence of a cDNA encoding otolin-1 and its deduced amino-acid sequence. (A) T he nu cleotide (upper) and amino- acid (lower) sequences are i ndicat ed. The putative s ignal peptide (1±25) is indicated by w h ite text on b l ack background, and the residues t hat have been direc tly m icroseque nced are i n dicated by a dotted-underline. Putative O-glycosylation sites are marked b y circles, and possible N-glycosylation s ites are b oxed. The collagenous domain is indicated by large boxed-in area. Glycine residues in the collagenous domain are shown in bold. Brackets enclose the region homologous with the C-NC domains of collagen types VIII and X. The182 bp RT-PCR fragment sequence is indicated by dotted rectangles. The partial amino-acid sequences obtained from pro tein analysis are double-und erlined. An asterisk repre sents th e ter mination co don, and a consensus ÔAATAAAÕ polyadenylation signal is underlined. ( B) Schematic representation of the predicted domain organization of otolin-1 and the putative gly- cosylation sites. The possible N - a nd O-glycosylation s ites are i ndicated by squares and circles, re spectively. The nucleo tide sequence w as submitted to DDBJ/EMBL/GenBank and has been assigned the accession number AB067770. 690 E. Murayama et al.(Eur. J. Biochem. 269) Ó FEBS 2002 was washed at 65 °C with 0.1 ´ NaCl/Cit for 10 min and autoradiographed on an X-ray ®lm with i ntensifying screen at )80 °C for 24 h. Western blot analysis A PVDF membrane carrying the matrix protein with an apparent molecular mass of 100 kDa was prepared as described above. The membrane was incubated in a blocking solution (5% s kim milk in NaCl/P i )for2hat room temperature, and then immersed in the blocking solution containing diluted a f®nity-puri®ed sun®sh saccular collagen reactive immunoglobulins that had been raised against a synthetic oligopeptide corresponding to the part of the C-terminal noncollagenous domain [anti-(C-NC) Ig, where C-NC is a 138-residue C-terminal noncollagenous domain] [17] at a concentration of 250 ngámL )1 for more than 2 h. T he speci®city of the immunoglobulins had already been examined by immunoprecipitation and West- ern blotting w ith various kinds of ®sh tissue lysates including brain, eighth cranial nerve, gill, and semicircular canals [17], before our experiments were performed. The membrane was washed three times each with NaCl/P i containing 0.1% Tween-20 for 15 min and t hen, incubated with 1 : 3000 alkaline-phosphatase conjugated goat anti- (rabbit IgG) Ig (Bio-Rad) diluted in the blocking solution for 2 h at room temperature. The membrane was washed again as de scribed above a nd equilibrated with developing solution (100 m M Tris/HCl/100 m M NaCl/50 m M MgCl 2 , pH 9.5) for 5 min. The membrane was then incubated with 25 n M each of 5-bromo-4-chloro-3-indolyl phosphate and 4-nitrotetrazolium blue diluted in the developing solution for 15 min. The reaction was s topped by immersing in distilled water. Immunohistochemistry Fish were deeply anesthetized in a 0 .02% aqueous solution of 2-phenoxyethanol and decapitated. The head was opened dorsally and the brain was removed using forceps. Right and left sacculi, each containing an otolith, were removed and ®xed in a mixture of 4% paraformaldehyde and 0.2% glutaraldehyde in 0.1 M cacodylate buffer (pH 7.5) for 4 h at room te mperature. The ®xed sacculi were de calci®ed in 10% EDTA in 10 m M Tris/HCl (pH 7.5) for 2 days at room temperature. The decalci®ed sacculi were post ®xed with the same ®xative as described above for 3 h at room temperature. The sacculi were then dehydrated in ethanol and embedded in paraf®n. In order to examine the localization of 100-kDa EDTA-insoluble otolith matrix protein (otolin-1)-producing cells, undecalci®ed sections of sacculi were prepared. Sacculi were removed as described above a nd ®xed in a mixture of 4% paraformaldehyde and 0.2% glutaraldehyde in 0.1 M cacodylate buffer (pH 7.5) for 4 h at room temperature. The ®xed sacculi were stored overnight in 7 0% ethanol at 4 °C. After opening the posterior end of t he sacculus using a s calpel, the otolith was removed from the sacculus using ®ne forceps. The sacculi were then dehydrated in ethanol and embedded in paraf®n. Transverse sections were cut at 6 lm and mounted on gelatin-coated slides. Deparaf®nized sections were incubated for 30 min with a 0.6% H 2 O 2 solution to inhibit endo- genous peroxidase activity and subsequently with NaCl/P i containing 2% normal goat serum for 30 min to prevent nonspeci®c bin ding o f immunoglobulins. The s ections were then incubated overnight at 4 °C with 500 ngámL )1 of anti- (C-NC) Ig [17]. Localization of immunoglobulins w as visualized by the avidin-biotin-peroxidase complex (ABC) method [27] using commercial reagents (Vectastain ABC- PO Kit, Vector Laboratory, Burlingame, CA, USA) and 3,3¢-diaminobenzidine tetrahydrochloride as a substrate. Sections were mounted and observed under a differential interface microscope (Carl Zeiss, Oberkochen, Germany). RESULTS Extraction and separation of EDTA-insoluble matrix proteins from the salmon otolith Otoliths from the chum salmon were d ecalci®ed with an EDTA solution. The EDTA-insoluble m aterials exhibited a gel-like texture and retained the shape of the whole otolith. These EDTA-insoluble materials were solubilized in a buffered Chaps solution, then were desalted, concentrated and subjected to SDS/PAGE analysis. At least two proteins, one with an apparent molecular mass of 100 kDa and another with  55 kDa were detected (Fig. 2A). The former was designated otolin-1 according to the de®nition which had been described by Degens et al. [4], and the latter was found to be OMP-1 which we had previously identi®ed and biochemically char acterized as a major component of EDTA-soluble matrix proteins [18]. Fig. 2. Characterization of otolin-1 extracted from EDTA-insoluble matrix pro tein of O. keta otolith. Each sample was subjected to SDS/ PAGE analysis on 10% gel under reduced conditions and stained with Coomasie Brilliant Blue. (A) Pro®le of the EDTA-insoluble otolith matrix proteins e xtrac ted with Chaps (lan e 2). The u pper arrow indi- cates otolin-1 and the lower one OMP- 1, a major component of EDTA-soluble matrix proteins. Lane 1, molecular mass standards. (B) Possible N-glycosylation of otolin-1. Lane 1, molecular mass stan- dards. Chaps-extracted matrix proteins before (lane 2) and after (lane 3) glycopeptidase-F (GPF) digestion. The upper arrow indicates t he untreated otolin-1, and the lower one ind icates otolin-1 treated w ith GPF. (C) W estern blot analy sis of Chaps-e xtracted EDTA-insoluble matrix proteins with anti-(C-NC1) Ig. Otolin-1 is indicated by the lower arrow and the upper one indicates high molecular mass proteins (200 kDa). Ó FEBS 2002 Collagen-like protein from ®sh otolith (Eur. J. Biochem. 269) 691 N-terminal and internal amino-acid sequences The EDTA-insoluble matrix proteins recovered from the salmon otolith were resolved by SDS/PAGE analysis and transferred to a PVDF membrane. T he part of the membrane that contained otolin-1 was cut out and subjected to N-terminal protein sequence analysis. The N-terminal seven amino-acid residues were identi®ed except for positions 3 and 4 (Table 1). Otolin-1 obtained from the acrylamide gel by e lectroelution was desalted and also applied to a protein sequ encer. The results showed that the N-terminal 15 amino-acid residues were identi®ed except for positions 1±4 (Table 1). To analyze the internal amino-acid sequences, otolin-1 was digested w ith trypsin in the acrylamide g el after electrophoresis and then the digested peptides recovered from the gel were carboxymethylated. The resulting peptides were then separated by reverse-phase HPLC (Fig. 3). As the hatched area (Fig. 3A) was found to contain two tryptic fragments by MALDI TOF-MS analysis, they were sepa- rated by reverse-phase HPLC under different conditions (Fig. 3B) and sequ enced (Table 2). BLAST search analysis [28] revealed that the s equences of both peptides had a high homology to the sun®sh saccular collagen ( sSC) [16]. Cloning of a cDNA encoding otolin-1 Two degenerate oligonucleotide primers, sOT5¢-R1 and bsSC-F, were designed based on the amino-acid sequence of the internal peptide no. 1 and a part of C-terminal sequence of noncollagenous domain of the sSC, respectively. Using these primers, PCR was carried out using ®rst strand cDNA synthesized from chum salmon saccular poly(A)+ R NA as a template. This yielded a single product of 182 bp in length (Fig. 1A). Then, a speci®c primer (sOT5¢-R2) was designed based on this PCR product and 5¢ RACE was p erformed, giving a 1.5 kbp product. The deduced amino-acid sequence encoded on this RACE-product contained t he N-terminal sequence, con®rming that it corresponded to the otolin-1 protein. To identify the 3¢ end o f t he otolin-1 transcript, an otolin-1-speci®c primer (sOT3¢-F), was designed and 3¢ RACE was performed, g enerating a 444-bp product t hat contained a deduced amino-acid sequence of the internal sequence no. 1 and 2. Thereby the full length otolin-1 cDNA was completed (Fig. 1A) and it was found to contain a 1524 nucleotide ORF followed by a 282 nucleotide 3¢ noncoding region that contained the consensus ÔAATAAAÕ polyadenylation signal located 16 nucleotides upstream from the start of t he poly(A) tail. This ORF was found to encode a 508-residue precursor protein that consisted of a 25-residue signal peptide and a 227-residue collagenous domain ¯ anked by a 118-residue N-terminal noncollagenous (N-NC) domain and a 138-residue C-NC domain (Fig. 1B). Otolin-1 con- tained the collagenous domain at the position from 119 to 345 and two potential N-glycosylation sites at positions 96 and 391, one in each noncollagenous domain (Fig. 1A,B). As the N -NC domain contained m any serine and threonine residues, the NETDGLYC 2.0 program [29] was used to predict Fig. 3. Elution pro®le of puri®cation of the t ryptic peptides of otolin-1 on reverse-phase HPLC. (A) The ®rst step RP-HPLC. Column, Capcell Pak C 18 column (2.0 ´ 150 mm); solvent, 10±60% acetonitrile in 0.05% tri¯uoroacetic acid; ¯ow rate: 0 .2 mLámin )1 ;detection, absorbance at 225 n m; temperature, 40 °C. The concentration of acetonitrile is indicated by t he do tted line. The ha tched a rea showed the fraction containing t wo tryptic peptides. (B) The seco nd step RP-HPLC. Solv ent, 10±60% acetonitrile in 10 m M NH 4 HCO 3 ;other conditions are the same as those described above. Peaks 1 and 2 represent internal fragments 1 a nd 2, resp ective ly. Table 1. N-terminal amino-acid sequences of otolin-1. Preparation 1 : otolin-1 was prepared on a PVDF membrane. Preparation 2: otolin-1 was prepared by e lec troelutio n from t he gel. ?, Unidenti®able value. Preparation Sequence Position 1 T-R-?-?-R-R-P 1±7 2 ?-?-?-?-R-R-P-K-P-Q-N-T-K-K-P 1±15 Table 2. Amino-acid sequences of two puri®ed internal peptides of otolin-1 by the s eco nd RP-HPLC. Degenerate primer (sOT 5¢-R1) was designed at the position indicated by the underlined sequence, running right to left. Position refers to the position in the predicted amino-acid sequence . Peptide Sequence Position Internal 1 D-S-L-Y- G-Q-D-I-D-Q-A-S-N-L-A-L-L-R 427±444 Internal 2 L-A-S-G-D-Q-V-W-L-E-T-L-R 445±457 692 E. Murayama et al.(Eur. J. Biochem. 269) Ó FEBS 2002 potential O-glycosylation sites (Fig. 1A,B). In vivo N-glycosylation was evident as glycopeptidase-F digestion of otolin-1 decreased its apparent molecu lar mass b y 10 kDa as observed on SDS/PAGE (Fig. 2B). When a homology search using the full length of otolin-1 sequence was conducted using the Swiss-Prot database, it revealed that otolin-1 has 68% identity to the sun®sh saccular collagen [16]. Furthermore, the C-terminal noncollagenous domain of otolin-1 also had homology to the C-terminal noncollagenous do mains of the collagen types VIII and X (Fig. 4). Tissue-speci®c expression of the otolin-1 mRNA in the sacculi To examine the expression levels of the otolin-1 mRNA in various tissues including the sacculi, semicircular canals, brain, heart tissue, liver, muscle, skin and scales, Northern blot analysis was p erformed using a cDNA fragment encoding a part of otolin-1 (nucleotides 1284±1465, Fig. 1A) as a probe. The otolin-1 transcript was only detected in the mRNA from the sacculus a nd was approximately 1.9 kb in length (Fig. 5). This transcript size agreed well with that of the otolin-1 cDNA (Fig. 1A). Localization of otolin-1 To examine the localization of otolin-1, Western blot analysis and immunohistochemical experiments were per- formed using anti-(C-NC) Ig [17] that were predicted to recognize the otolin-1 molecule. In the Chaps-soluble matrix proteins, a band corresponding to otolin-1 and a broader band of higher molecular mass were detected (Fig. 2C). The presence of the higher molecular mass form suggested the possible existence of an aggregation product that includes otolin-1. The upper panel in Fig. 6 is schematic represen- tation of a transverse section of t he chum salmon sacculus. The saccular wall is a single-layer e pithelium surrounded by a thin connective tissue layer. The thickest part of the epithelium is the sensory epithelium comprised of sensory hair cells and supporting cells. Next to the sensory epithelium, the transitional epithelium extends outward until it to transitions into a squamous epithelium comprised of small, cuboidal- or ¯at-shaped cells. Columnar-shaped cells are typically found in the transitional epithelium and are interspersed with mitochondria-rich cells. The otolith membrane is composed of a gelatinous layer and a subcupular meshwork, and together they af®x the otolith to the underlying sensory epithelium. In decalci®ed sections, the anti-(C-NC) Ig detected the otolin-1 protein in both the otolith and the gelatinous layer of the otolithic membrane, but not in the subcupular meshwork (Fig. 6A,B). In addition, the otolin-1 protein did not appear to be uniformly distributed within the otolith: some parts stained intensely, while other parts showed only weak staining. The staining of the gelatinous layer o f the otolithic membrane w as modest. In undecalci®ed sections, t he otolin-1 immuno- reactivity was observed in some of the transitional epithelial cells, w hich were located adjacent t o the sensory epithelium (Fig. 6C). The immunoreactivity appeared to be more concentrated in the basal aspect of those cells. T he number of immunoreactive cells varied depending on the part of the sacculus. The sensory epithelium, squamous epithelium and mitochondria-rich cells were negative for otolin-1 staining. DISCUSSION In different ®sh species, the otolith has a species-speci®c shape that is likely to be due to differential accretion o f t he Fig. 4. Comparison of the amino-acid sequence of otolin-1 with thos e of other collagens. Align ment of most h omologous regions from the C-NC domains of otolin-1 (Oto1), sun®sh saccular collagen (sSC), human type X collagen (hType X) and mouse type VIII collagen (mType VIII). The positions of identical and similar r esidu es are indicated by s haded box an d bold t ype, respectively. Fig. 5. Tissue speci®c expression of otolin-1 mRNA. Total RNA (10 lg each) prepared from semicircular canals (SeC), sacculi (Sa), brain (B), heart tissue (H), liver (L), muscle (M), skin (SK) and scales (SC) were subjectedtoNorthernblotanalysis.Theblotwasprobedwitha [a- 32 P]-labeled otolin-1 cDNA as described in Experimental proce- dures. Size was determined by comparison of migration with RNA size markers (Gibco). Lower panel shows 18S and 28S rRNA bands stained with ethidium b romide before blo tting. Ó FEBS 2002 Collagen-like protein from ®sh otolith (Eur. J. Biochem. 269) 693 inorganic constituents and differential utilization of the matrix proteins that serve within as a framework. In this paper, a collagen-like structural protein termed otolin-1 in the salmon otolith has been identi®ed an d characterized. When salmon otoliths were decalci®ed, residual, gelatinous materials in the shape of the otolith r emained and the otolin-1 protein was determined to be a major component of this gelatinous material. Thus, it is possible that otolin-1 is part of the i nternal framework of the otolith where it may, in part, provide the nucleation site for precipitation of calcium carbonate crystals. Otolin-1 has 68% identity (to sSC) that was originally identi®ed by differential screening of a sun®sh saccular cDNA library [16]. Though there is high conservation between both of their C-NC domains, the N-NC domain of otolin-1 was much l onger than that of the sSC an d appears to be distinct from that of the sSC. The otolin-1 C-NC domain, like that of the sSC, had high homology to the C-NC domain of collagen types VIII [30] and X [31] (Fig. 4). Collagen types VIII and X are non®brillar short chain collagens that form three-dimensional meshwork. The collagenous domain of otolin-1 is smaller than that of the collagen types VIII and X, and contains 74 perfect Gly-X-Y repeats w ith three interruptions (imperfect Gly-X-Y repeats). It is also known that C -NC and N-NC domains of collagen types VIII and X form the nodes, while the collagenous domains form the interconnecting spacers and together collectively they o ligomerize supramolecularly into a t hree-dimensional, hexagonally arranged lattice [32,33]. If otolin-1 aggregates like these co llagens, it m ight possibly provide nucleation sites to facilitate calci®cation. Furthermore, one or both of two potential N-linked glycosylation sites (located at positions of 96 and 391) identi®ed in the otolin-1 protein appear to be utilized in vivo as glycop eptidase-F digestion was able to reduce the apparent molecular m ass from 100 to 90 kDa in our biochemical a nalyses. In addition, many putative O-linked glycosylation sites are observed at the N-NC domain. These sugars may facilitate the aggregation of the collagen with each other and/or with other resident extracellular matrix moieties such as proteoglycans. Consistent with this possi- bility, our studies have also indicated that the EDTA- insoluble, otolith-derived material contained various kinds of sugars (data not shown). Collagens are structural proteins present in many an imal species. Collagen t ype VIII is found loosely dispersed in the basement membranes of various tissues [34] while collagen type X is found only in the matrix of the hypertrophic zone of the epiphyseal growth plate cartilage [35±37], yet is not the p rimary organic constituent deposited during endo- chondral ossi®cation. Thus, c ollagen type VIII may serve as a m olecular b ridge b etween different types of matrix molecules, whereas collagen type X may serve, in some manner not yet understood, in the process of mineralization [38]. In this study, Northern blot analysis revealed that otolin-1 mRNA was expressed only in the sacculus and could not be detected even in the semicircular canals, another sensory structure found in the teleost inner ear. Therefore, otolin-1 is a special collagen-like protein whose mRNA distribution is strictly limited in the sacculus. We also examined the localization of otolin-1 among the various structures and cells contained within the salmon sacculus. Immunohistochemical analysis using anti-(C-NC) Fig. 6. Schematic representation and light micrographs of chum salmon sacculus stained with anti-(C-NC) Ig. (A) Decalci®ed section. Otolith (OT) and gelatinous layer (GL). Boundary of OT and GL is shown by the dotted line. In OT, some regions are stained intensely while other regions show only modest staining. GL is stained weakly. Bar  50 lm. (B) D ecalci®ed s e ction. O tolithic m embrane and sensory epi- thelium ( SE). In the otolithic m embrane, immunoreactivity is weakly observed in GL, but not in the subc upular meshwork (SM). SE does notreactwith anti-(C-NC) Ig. Bar  50 lm. (C)Undecalci®ed section. SE and transitional epithelium ( TE). A part of transitional epithelial cells, which are located at the periphery of SE, is positively stained with anti-(C-NC) Ig. Mitochondria-rich cell (*) is negative. Bar  50 lm. 694 E. Murayama et al.(Eur. J. Biochem. 269) Ó FEBS 2002 Ig revealed that otolin-1 was distributed in the otolith, gelatinous layer of the otolithic membrane and in a part of the t ransitional epithelial cells. D avis et al. r eported that anti-(C-NC) Ig reacted with the columnar supporting cells and t he gelatinous layer of the otolithic membrane, but not with lower ®lamentous subcupular meshwork in the bluegill sun®sh [17]. Our observations are consistent with those previously reported, but we have extended those observa- tions by dem onstrating that this p articular form of collagen is also incorporated into and/or onto the otolith. Further- more, we have detected otolin-1 as a minor component in the endolymph (data not shown). Based on these results, otolin-1 was synthesized and secreted apically from the transitional epithelium into the endolymph, then immedi- ately incorporated into the otolith and the gelatinous layer of the otolithic membrane. However, it is still unclear whether otolin-1 is deposited to the otolith via the o tolithic membrane or not. In the otolith, otolin-1 did not appear to be uniformly distributed as some regions were strongly immunoreactive while other regions were much less so. We do not yet know how this might be signi®cant concerning this differen ce. We expected that immunoreactivity was observed i n t he daily rings, but it was not con®rmed in t his study. Immunoelectron microscopic analyses may be required to fully de®ne the p recise distribution and function of the otolin-1 protein associated with the salmon otolith. On the basis of these results a nd the fact that the primordia (otolith nuclei) are organic materials secreted from the sensory epithelium [23], it may b e that, early on, a certain part of the primordial otolithic m embrane a nd later of the gelatinous layer of the otolithic membrane proper, may s erve as a ÔfoundationÕ for the growth of each primordium. Then, additional precipitation may occur on the outer surface of each primordium staying on the suitable positions of the gelatinous layer. Wh at kind of interaction does it occur between the primordia and the gelatinous layer? Do they contain same matrices? Khan et al. r evealed that at least nine bands were observed from a sample of th e gelatinous layer of the otolithic membrane from t he rainbow trout, O. mykiss using SDS/PAGE [39]. Dunkel- berger et al. noted that the ®brous materials of subcuplar meshwork could penetrate through the gelatinous layer and incorporated in the overlying otolith in the juvenile mum- michog, Fundulus heteroclitus [40]. They also mentioned that the gelatinous layer is closely associated with the otolith surface, but incorporation of the ®bers into t he otolith w as not observed. In the present study, it is not clear whether the otolin-1 protein detected in the otolith is continuous with that detected in the g elatinous layer o f the otolithic membrane or not. To understand the mechanism of onset of otolith f ormation, a more detailed molecular study of the interaction between these components at the zone where new otolith primordia accrues to become ÔnewÕ calci® ed otolith will be required. These s tudies suggest the possibility that ®sh might a lso make use of collagens to promote the mineralization of calcium carbonate, i.e. in the formation of the otolith just as they d o for bones and dentin. Major component of bones and den tin is ®brillar collagen, while that of otolith is otolin-1 which is a unique molecule belonging to the family of a short-chain, meshwork-forming collagen. Thus, otolin-1 may contribute to form biominerals composed of calcium carbonate in contrast to ®brillar collagen in bones and dentin made of calcium phosphate. It has been said that the proteinaceous materials contained in the otolith are noncollagenous proteins [41]. In this experime nt, we identi®ed a collagen-like protein containing many tandem repeats of the sequence, Gly-Xaa-Yaa, from the otolith, one of the biomineralized tissues composed of calcium carbonate, for the ®rst time. In contrast, it was reported that a part of the matrix protein, Lustrin A, from shell and pearl nacre of Haliotis rufescens, which were also composed of calcium carbon- ate, had some similarity to the type I collagen [42]. The region having a homology to the type I collagen is, however, limited in only 30 amino-acid residues, in which two glycine residues were replaced by other amino-acid residues. In addition, it is known that the interaction of collagen with other matrix proteins is important for bone formation. In the case o f otolith matrix p roteins, the EDTA-insoluble fraction also contained OMP-1 as shown in Fig. 2A, a major component of EDTA-soluble matrix protein [18]. Therefore, OMP-1 may be trapped by the meshwork of otolin-1. Further analyses of these complex intermolecular interactions will be required to understand how otolin-1, in certain saccular microenvironment, contributes to otolith formation. ACKNOWLEDGEMENTS We are grateful to Dr Akihisa Urano of Division of Biological Sciences, Hokkaido University for h is g ene rous gift of chum salmon. We also thank Dr Goro Yoshizaki and Mr Yutaka Takeuchi of Department of Aquatic Biosciences, Tokyo University of Fisheries for generous discussion about embryonic development. This work was supported by Grants-in-Aid for Creative Basic Research (no. 12NP0201) and for Scienti®c Research (no. 12 876025 and 13660176) from the Ministry of Education, Culture, Sports, Science and Technology of Japan. E. M. was sup ported by Research Fellowships o f Japan S ociety for the Promotion of Science for Young Scientists. REFERENCES 1. Lowenstein, O. (1971) T he labyrinth. In Fish Physiology: Vol. V. Sensory Systems and Electric Organs (Hoar, W.S. & Randall, D.J., eds), pp. 207±240. Academic Press, New Y ork. 2. Manning, F.B. (1924) Hearing in the gold®sh in relation to the structure of i ts ear. J. Exp. Zool. 41, 5±20. 3. Fay, R.R. (1980) The gold®sh ear c odes the axis of acoustic par- ticle rotation in t hreedime nsions. Science 22 5 , 951±953. 4. Degens, E.T., Deuser, W.G. & Haedrich, R.L. (1969) Molecular structure and compos ition of ®sh otoliths . Mar. Biol. 2, 105± 113. 5. Mugiya, Y. & Uchimura, T. (1989) Otolith resorption by anaer- obic stress in the gold®sh Carassius auratus. J. Fish. Biol. 35, 813± 818. 6. Pannella, G. ( 1971) Fish otoliths: daily growth layers and peri- odical patterns. Science 17 3 , 1124±1127. 7. Brothers, E .B., Mathews, C.P. & L asker, R. (1976) Daily growth increments in otoliths from lar val and a dult ®shes. Fish. Bull. 74, 1±8. 8. Mugiya, Y. (1984) Diurnal rhythm in otolith formation in the rainbow trout, Salmogairdneri: seasonal reversal of the rhythm in relation to plasma calcium concentrations. Comp. Biochem. Physiol. 78A, 2 89±293. 9. Mugiya, Y. (1987) Phase dierence between calci®cation and organic matrix formation in t he diurnal growth o f otoliths in t he rainbow trout, Salmo gairdneri. Fish. Bull. 85 , 395±401. Ó FEBS 2002 Collagen-like protein from ®sh otolith (Eur. J. Biochem. 269) 695 10. Campana, S.E. & Neilson, J .D. (1985) Microstructure of ®sh otoliths. Can. J. Fish. A quat. Sci. 42, 1014±1032. 11. Radtke, R.L. & Dean, J.M. (1981) Increment formation in the otoliths of embryos, arvae, and juveniles of the mummichog, Fundulus heteroclitus. Fish. Bull. 80, 201±215. 12. Romanek, C.S. & Gauldie, R.W. (1996) A predictive model of otolithgrowthin®shbasedonthechemistryoftheendolymph. Comp. Biochem. Physiol. 114A, 71±79. 13. Mugiya, Y. (1981) Diurnal rhythm in otolith formation in the gold®sh, Carassius auratus. Comp. Biochem. Physiol. 68A, 6 59±662. 14. Payan, P., Kosmman, H., Watrin, A., Mayer-Gostan, N. & Boeuf, G. (1997) Ionic composition of endolymph in teleosts: origin and importance of endolymph alkalinity. J. Exp. Biol. 200, 1905±1912. 15. Gauldie, R.W. & Nelson, D.G.A. (1990) Otolith growth in ®shes. Comp. Biochem. Physiol. 97A, 119±135. 16. Davis, J.G., Oberholtzer, J.C., Burns, F.R. & Greene, M.I. (1995) Molecular cloning and characterization of an inner ear-speci®c structural protein. Science 267, 1031±1034. 17. Davis, J.G., Burns, F .R., N avaratnam, D ., Lee, A.M., Ichimiya, S., Oberholtzer, J.C. & Greene, M.I. (1997) Identi®cation of a structural constituent and one possible site of postembryonic formation o f a teleost otolithic membrane. Proc. Natl A cad. Sci. USA 94, 707± 712. 18. Murayama,E.,Okuno,A.,Ohira,T.,Takagi,Y.&Nagasawa,H. (2000) Molecular cloning and expression of an otolith matrix protein cDNA from the rainbow trout, Oncorhynchus mykiss. Comp. Biochem. Physiol. 126B, 511±520. 19. Woodbury, R .G., Brown, J.P., Yeh, M.Y., Hellstro È m, I. & Hell- stro È m, K.E. (1980) Identi®cation of a cell s urface protein, p97, in human melanomas and certain otherneoplasmis. Proc. Natl Acad. Sci. USA 77, 2183±2187. 20. Aisen, P. & Leibman, A. (1972) Lactoferrin and transferrin: a comparative study. Biochim. Biophys. Acta 25 7 , 314±323. 21. Takagi, Y. & Takahashi, A. (1999) Characterization of otolith soluble-matrix producing cells in the saccular e pithelium of rain- bow trout (On corhynchus my kis) inner e ar. Anat. R ec. 25 4, 3 22±329. 22. Takagi, Y. (2000) Ultrastructural immunolocalization of the otolith water-soluble-matrix in the inner ear of rainbow trout just- hatched fry. Fis h Sci. 66, 71±77. 23. Sokolowski, B.H.A. (1986) Development of the otolith in embryonic ® shes with special ref erence to the toa d ® sh, Opsanus tau. Scan. Electron. Microsc. 4, 1635±1648. 24. Laemmli, U.K. (1970) Cleavage of structural proteins during assembly of the bacteriophage T 4. Nature 227, 680± 685. 25. Sanger, F., Nicklen, S. & Coulson, A.R. (1977) DNA sequencing with chain-terminating inhibitors. P roc. Natl Acad. Sci. USA 74 , 5463±5467. 26. Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989) Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory Press, Co ld Spring Harbor NY, U SA. 27. Hsu, S.M., Raine, L. & Fanger, H. (1981) Use of avidin-biotin- peroxidase complex (ABC) in immunoperoxidase techniques: a comparison be twee n ABC and u n labeled antibody (P AP) proce- dures. J. Histochem. Cy tochem. 29, 577±580. 28. Altschul, S.F., Madden, T.L., Schaer, A.A., Zhang, J., Zhang, Z., Miller, W. & L ipman, D.J. (1997) Gapped BLAST and PSI- BLAST: a new generation of proteindatabase searc h programs. Nucleic A cids Res. 25, 3389±3402. 29. Hansen, J.E., Lund, O., Tolstrup, N., Gooley, A.A., Williams, K.L. & Brunak, S. (1998) NetOglyc: prediction of mucin type O-glyco sylation sites b ased on sequencecontext and surfa ce accessibility. Gl ycoconj. J. 15 , 115±130. 30. Muragaki, Y., Shiota, C., Inoue, M., Ooshima, A., Olsen, B.R. & Ninomiya, Y. ( 1992) a1 (VIII)-collagen gene transcripts encode a short-chain collagen polypeptide and are expressed by various epithelial, endothelial and mesenchymal cells in newborn mouse tissues. Eur. J. Biochem. 207 , 895±902. 31. Ninomiya, Y., Gordon, M., van der Rest, M., Schmid, T., Linsenmayer, T. & Olsen, B.R. (1986) The developmentally regulated type X collagen gene contains a long open reading frame without introns. J. Bio l. Chem. 261, 5 041±5050. 32. Sawada, H., Konomi, H. & Hirosawa, K. (1990) Characterization of the collagen in the h exago nal lattice of Descemet's membrane: its relation to t ype VIII collagen. J. Cell Biol. 110, 219±227. 33. Kwan, A.P.L., Cummings, C.E., Chapman, J.A. & G rant, M.E. (1991) Mascromolecular o rganization of c hicken type X collagen in vitro. J. Cell Bio l. 114, 597±604. 34. Eyre, D.R. (1980) Collagen: molecular diversity in the body's protein scaold. Science 20 7 , 1315±1322. 35. Sage, H., Pritzl, P. & Bornstein, P. (1980) A unique, pepsin- sensitive collagen synthesized by aortic endothelial cells in culture. Biochemistry 19 , 5747±5755. 36. Schmid, T.M. & Conrad, H.E. (1982) A unique low molecular weight collagen s ecre ted by cultured chick e mbryo chondrocytes. J. Biol. Chem. 257, 12444±12450. 37. Kielty, C.M., Kwan, A.P.L., Holmes, D.F., Schor, S.L. & Glant, M.E. (1985) Type X collagen, a product of hypertrophic chon- drocytes. Biochem. J. 27, 5 45±554. 38. Sutmuller, M., Bruijn, J.A. & de Heer, E. (1997) Collagen types VIII and X, two non-®brillar, short-chain collagens. Structure homologies, functions a nd involvement inpathology. Histo l. His- topathol. 12, 557±566. 39. Khan, K.M. & Drescher, D.G. (1990) Proteins of t he ge latinous layer of the trout saccular otolithic m embran e. He ar. Res. 43,149± 158. 40. Dunkelberger, D.G., Dean, J.M. & Watabe, N . (1980) The ultrastructure of the otolithic memb rane and oto lith in the juven ile mummichog, Fundulus heteroclitus. J. Morphol. 163, 367±377. 41. Campana, S.E. (1999) Chemistry and composition of ®sh otoliths: pathway, mechanisms an d applic ations. Mar. Ecol. Prog. Ser. 188, 263±297. 42. Shen, X., Belcher, A.M., Hansma, P.K., Stucky, G .D . & Mo rse, D.E. (1997) Molecular cloning and characterization of Lustrin A, a m atrix protein from shell a nd pearl n acre of Haliotis rufescens. J. Biol. Chem. 272, 32472±32481. 696 E. Murayama et al.(Eur. J. Biochem. 269) Ó FEBS 2002 . Fish otolith contains a unique structural protein, otolin-1 Emi Murayama 1 , Yasuaki Takagi 2 , Tsuyoshi Ohira 1 , James G. Davis 3 , Mark I. Greene 3 and. postembryonic formation o f a teleost otolithic membrane. Proc. Natl A cad. Sci. USA 94, 707± 712. 18. Murayama,E.,Okuno ,A. ,Ohira,T.,Takagi,Y.&Nagasawa,H. (2000)