Up regulation of c EBPa in hepatocellular carcinoma is correlated to poorer prognosis

Up regulation of c EBPa in hepatocellular carcinoma is correlated to poorer prognosis

Up regulation of c EBPa in hepatocellular carcinoma is correlated to poorer prognosis

... CGAGTTCCTTCAACATGCACT CAGTCACAAGTCGTTTTGCCT GGGGTACTTTATCACGCCCTG TGTATACCCCTGGTGGGAGA GGACTTCGAGCAAGAGATGG Reverse Primer (5'-3') TTTGCGGTCAGTTCCTGAGC AATGGGCTGGGAATAGTAGGT GGGAATCCCGTTCTCATCAGA TCATAACTCCGGTCCCTCTG ... predominant form of liver cancer is hepatocellular carcinoma It accounts for 85-90% of most primary liver cancers (H B El-Serag & Rudolph, 2007) 1.1.2 Hepatocellul...

Ngày tải lên: 02/10/2015, 17:14

84 155 0
Báo cáo y học: " Smoking-mediated up-regulation of GAD67 expression in the human airway epithelium" doc

Báo cáo y học: " Smoking-mediated up-regulation of GAD67 expression in the human airway epithelium" doc

... changes in gene expression only of GAD67, a gene controlling the synthesis of GABA [2] A striking increase in gene expression levels of GAD67 was observed in the large and small airway epithelium of ... expressed in the airway epithelium (Figure 2C) Up-regulation of GAD67 in Large and Small Airway Epithelium of Healthy Smokers Of all of the G...

Ngày tải lên: 12/08/2014, 11:22

15 369 0
Báo cáo khoa học: HIP/PAP, a C-type lectin overexpressed in hepatocellular carcinoma, binds the RIIa regulatory subunit of cAMP-dependent protein kinase and alters the cAMP-dependent protein kinase signalling ppt

Báo cáo khoa học: HIP/PAP, a C-type lectin overexpressed in hepatocellular carcinoma, binds the RIIa regulatory subunit of cAMP-dependent protein kinase and alters the cAMP-dependent protein kinase signalling ppt

... indicates that the location of HIP/PAP and RIIa is consistent with the relevance of their interaction HIP/PAP has been classified in the group of C-type lectins because it binds lactose and contains ... reticulum Ca2+ATPase (SERCA 2), an integral protein of the endoplasmic reticulum [22], calreticulin, a protein of the endoplasmic reticulum lumen [23], HI...

Ngày tải lên: 23/03/2014, 13:20

9 310 0
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf

Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf

... ATTTCAGCAGCATACTCCACAATAAAAAG GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG AGGGAATTCATGGCGCCGCTAGACCTGGC GAGGCCTCGAGTCAAAGGAAATATGGCGTTG ... PPP6C-3¢UTR-mut-antisense PPP6C-siR-Top GACGGCTCGAGGACCAAGGGGCTGTATGCAC GCCAGAAGCTTCCTGCCCTGTTCATCTGCAGG CGGGATCCTCTTGTATTACCCTCTA GCGAATTCTCCATCGTGCC TTTTTAT...

Ngày tải lên: 14/03/2014, 23:20

11 397 0
Báo cáo Y học: Elucidation of the role of fructose 2,6-bisphosphate in the regulation of glucose fluxes in mice usingin vivo 13 C NMR measurements of hepatic carbohydrate metabolism docx

Báo cáo Y học: Elucidation of the role of fructose 2,6-bisphosphate in the regulation of glucose fluxes in mice usingin vivo 13 C NMR measurements of hepatic carbohydrate metabolism docx

... of glycogen in the intact liver in vivo Second, during infusion of [1-1 3C ]glucose, label incorporation was observed not only into the C1 of glycogen but also the C6 , which can only occur by label ... a mechanism can lead to increases in labeling of glycogen C6 even in the presence of decreased activity of the indirect pathway, provided that the increas...

Ngày tải lên: 17/03/2014, 17:20

9 465 0
Báo cáo khoa học: Sp1 and Sp3 are involved in up-regulation of human deoxyribonuclease II transcription during differentiation of HL-60 cells pptx

Báo cáo khoa học: Sp1 and Sp3 are involved in up-regulation of human deoxyribonuclease II transcription during differentiation of HL-60 cells pptx

... These sites bind Sp1 and Sp3, and protein levels and binding of Sp1 and Sp3 are increased in PMAtreated cells These findings indicate that Sp1 and Sp3 play a pivotal role in the transcriptional ... and Sp3 are able to bind to the GC boxes and that binding of Sp1 forms complex C1 and binding of Sp3 forms complexes C2 and C3 PMA treatment increa...

Ngày tải lên: 23/03/2014, 17:21

8 447 0
Ceftriaxone-induced up-regulation of cortical and striatal GLT1 in the R6/2 model of Huntington’s disease pps

Ceftriaxone-induced up-regulation of cortical and striatal GLT1 in the R6/2 model of Huntington’s disease pps

... up-regulation of cortical and striatal GLT1 in the R6/2 model of Huntington’s disease Journal of Biomedical Science 2010 17:62 Submit your next manuscript to BioMed Central and take full advantage of: ... R6/2 mice are strongly symptomatic [17] Effects of ceftriaxone treatment in cortical and striatal GLT1 expression Although saline-treated R6/2s s...

Ngày tải lên: 10/08/2014, 05:21

5 380 0
Báo cáo y học: "Stanniocalcin-1 promotes tumor angiogenesis through up-regulation of VEGF in gastric cancer cells" ppt

Báo cáo y học: "Stanniocalcin-1 promotes tumor angiogenesis through up-regulation of VEGF in gastric cancer cells" ppt

... staining of STC-1 in tumor tissues of nude mice STC-1 was detected on the membrane of tumor cells (D) Immunohistochemical staining of PCNA in tumor tissues of nude mice PCNA was detected in the ... Signaling Technology, USA) at 1: 1000, and the anti-btubulin rat monoclonal antibody (Beyotime, China) at 1:1000 VEGF Assay VEGF content in tumor culture supernatants...

Ngày tải lên: 10/08/2014, 05:21

9 404 0
The roles of histone deacetylases 1 and 2 in hepatocellular carcinoma

The roles of histone deacetylases 1 and 2 in hepatocellular carcinoma

... 17 1. 9 Cooperative and distinct functions of HDAC1 and 18 1. 9 .1 Redundancy of HDAC1 and HDAC2 functions 18 1. 9 .2 Distinct functions of HDAC1 and HDAC2 19 1. 10 Inhibition of ... 20 1. 11 Biological effects and mechanisms of action of HDAC inhibitors 20 1. 11. 1 Apoptosis 20 1. 11. 2 Growth arrest 22 1. 11. 3 Mitotic disruption and autophagy .....

Ngày tải lên: 10/09/2015, 08:27

168 373 0
haracterization of tumor suppressor genes hDAB2IP and DLEC1 in hepatocellular carcinoma

haracterization of tumor suppressor genes hDAB2IP and DLEC1 in hepatocellular carcinoma

... CHARACTERIZATION OF TUMOR SUPPRESSOR GENES hDAB2IP AND DLEC1 IN HEPATOCELLULAR CARCINOMA QIU GUO-HUA (M.SC., China) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF PHYSIOLOGY ... in HCC and then to investigate the methylation status of these genes The thesis will focus on the candidate tumor suppressor genes hDAB2IP and DLEC...

Ngày tải lên: 11/09/2015, 16:07

182 197 0
Role of c jun in the regulation of tumor suppressor p53 homologue, p73

Role of c jun in the regulation of tumor suppressor p53 homologue, p73

... Hypopharyngealcarcinomas Oesophageal cancer Gastric cancer Colorectal cancer Bladder cancer Prostate cancer Renal cancer Cholanglocarcinoma Hepatocellular carcinma Leukemia &lymphoma Breast cancer Ovarian ... on c- Jun 28 2.11 The Regulation of c- Jun 29 2.12 The stability of c- Jun protein 30 2.13 The relationship between p53 and c- Jun 30 VI 3.1 Hypothesis: The...

Ngày tải lên: 16/09/2015, 15:55

300 250 0
Tài liệu Báo cáo khoa học: Pyruvate reduces DNA damage during hypoxia and after reoxygenation in hepatocellular carcinoma cells pptx

Tài liệu Báo cáo khoa học: Pyruvate reduces DNA damage during hypoxia and after reoxygenation in hepatocellular carcinoma cells pptx

... hypoxia and reoxygenation have been reported to induce DNA damage [30–32], we examined the effects of pyruvate addition during hypoxia and after reoxygenation on DNA damage HepG2 cells were incubated ... by Singh et al [48], using alkaline electrophoresis, which allows detection of single-strand and double-strand breaks Pyruvate reduces DNA damage during...

Ngày tải lên: 18/02/2014, 16:20

11 479 0
Tài liệu Báo cáo khoa học: Complex transcriptional and translational regulation of iPLA2c resulting in multiple gene products containing dual competing sites for mitochondrial or peroxisomal localization docx

Tài liệu Báo cáo khoa học: Complex transcriptional and translational regulation of iPLA2c resulting in multiple gene products containing dual competing sites for mitochondrial or peroxisomal localization docx

... and 3) Translational regulation of iPLA2c in myocardium Owing to the obvious complexity of the regulation of iPLA2c resulting from the combined presence of transcriptional and translational regulation, ... start sites initiating biosynthesis of the 88, 77, 74 and 63 kDa iPLA2c isoforms Instead, based on current information about iPLA2c and its splici...

Ngày tải lên: 19/02/2014, 16:20

16 438 0
Marketing Violent Entertainment to Children: A Fifth Follow-up Review of Industry Practices in the Motion Picture, Music Recording & Electronic Game Industries pdf

Marketing Violent Entertainment to Children: A Fifth Follow-up Review of Industry Practices in the Motion Picture, Music Recording & Electronic Game Industries pdf

... days after release of the game, a game company is required to submit game packaging and a final version of the game to the ESRB The ESRB checks the game packaging to see if the rating information ... buying these products The music recording industry maintains that the Parental Advisory is not meant to indicate that a sound recording is eithe...

Ngày tải lên: 16/03/2014, 01:20

138 438 0
Báo cáo khoa học: Improvement of a monopartite ecdysone receptor gene switch and demonstration of its utility in regulation of transgene expression in plants pdf

Báo cáo khoa học: Improvement of a monopartite ecdysone receptor gene switch and demonstration of its utility in regulation of transgene expression in plants pdf

... (forward, 5¢-AAG GCT TAC CAC GAG CAG CTA TCA-3¢; reverse, 5¢-ACA GGC CAT GTA CTT TCC GTG TCT-3¢) and tobacco (forward, 5¢-ATG AGA GAG TGC ATA TCG AT-3¢; reverse, 5¢-TTC ACT GAA GGT GTT GAA-3¢) a- tubulinspecific ... VGCfEVY switch in regulating the expression of a zinc finger protein transcription factor isolated from Arabidopsis thaliana (AtZFP11) in both Arabidopsis and tobac...

Ngày tải lên: 16/03/2014, 06:20

16 454 0
w