Up regulation of c EBPa in hepatocellular carcinoma is correlated to poorer prognosis

... CGAGTTCCTTCAACATGCACT CAGTCACAAGTCGTTTTGCCT GGGGTACTTTATCACGCCCTG TGTATACCCCTGGTGGGAGA GGACTTCGAGCAAGAGATGG Reverse Primer (5'-3') TTTGCGGTCAGTTCCTGAGC AATGGGCTGGGAATAGTAGGT GGGAATCCCGTTCTCATCAGA TCATAACTCCGGTCCCTCTG ... predominant form of liver cancer is hepatocellular carcinoma It accounts for 85-90% of most primary liver cancers (H B El-Serag & Rudolph, 2007) 1.1.2 Hepatocellul...

Ngày tải lên: 02/10/2015, 17:14

... changes in gene expression only of GAD67, a gene controlling the synthesis of GABA [2] A striking increase in gene expression levels of GAD67 was observed in the large and small airway epithelium of ... expressed in the airway epithelium (Figure 2C) Up-regulation of GAD67 in Large and Small Airway Epithelium of Healthy Smokers Of all of the G...

Ngày tải lên: 12/08/2014, 11:22

... indicates that the location of HIP/PAP and RIIa is consistent with the relevance of their interaction HIP/PAP has been classified in the group of C-type lectins because it binds lactose and contains ... reticulum Ca2+ATPase (SERCA 2), an integral protein of the endoplasmic reticulum [22], calreticulin, a protein of the endoplasmic reticulum lumen [23], HI...

Ngày tải lên: 23/03/2014, 13:20

... ATTTCAGCAGCATACTCCACAATAAAAAG GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG AGGGAATTCATGGCGCCGCTAGACCTGGC GAGGCCTCGAGTCAAAGGAAATATGGCGTTG ... PPP6C-3¢UTR-mut-antisense PPP6C-siR-Top GACGGCTCGAGGACCAAGGGGCTGTATGCAC GCCAGAAGCTTCCTGCCCTGTTCATCTGCAGG CGGGATCCTCTTGTATTACCCTCTA GCGAATTCTCCATCGTGCC TTTTTAT...

Ngày tải lên: 14/03/2014, 23:20

... of glycogen in the intact liver in vivo Second, during infusion of [1-1 3C ]glucose, label incorporation was observed not only into the C1 of glycogen but also the C6 , which can only occur by label ... a mechanism can lead to increases in labeling of glycogen C6 even in the presence of decreased activity of the indirect pathway, provided that the increas...

Ngày tải lên: 17/03/2014, 17:20

... These sites bind Sp1 and Sp3, and protein levels and binding of Sp1 and Sp3 are increased in PMAtreated cells These findings indicate that Sp1 and Sp3 play a pivotal role in the transcriptional ... and Sp3 are able to bind to the GC boxes and that binding of Sp1 forms complex C1 and binding of Sp3 forms complexes C2 and C3 PMA treatment increa...

Ngày tải lên: 23/03/2014, 17:21

... up-regulation of cortical and striatal GLT1 in the R6/2 model of Huntington’s disease Journal of Biomedical Science 2010 17:62 Submit your next manuscript to BioMed Central and take full advantage of: ... R6/2 mice are strongly symptomatic [17] Effects of ceftriaxone treatment in cortical and striatal GLT1 expression Although saline-treated R6/2s s...

Ngày tải lên: 10/08/2014, 05:21

... staining of STC-1 in tumor tissues of nude mice STC-1 was detected on the membrane of tumor cells (D) Immunohistochemical staining of PCNA in tumor tissues of nude mice PCNA was detected in the ... Signaling Technology, USA) at 1: 1000, and the anti-btubulin rat monoclonal antibody (Beyotime, China) at 1:1000 VEGF Assay VEGF content in tumor culture supernatants...

Ngày tải lên: 10/08/2014, 05:21

... 17 1. 9 Cooperative and distinct functions of HDAC1 and 18 1. 9 .1 Redundancy of HDAC1 and HDAC2 functions 18 1. 9 .2 Distinct functions of HDAC1 and HDAC2 19 1. 10 Inhibition of ... 20 1. 11 Biological effects and mechanisms of action of HDAC inhibitors 20 1. 11. 1 Apoptosis 20 1. 11. 2 Growth arrest 22 1. 11. 3 Mitotic disruption and autophagy .....

Ngày tải lên: 10/09/2015, 08:27

... CHARACTERIZATION OF TUMOR SUPPRESSOR GENES hDAB2IP AND DLEC1 IN HEPATOCELLULAR CARCINOMA QIU GUO-HUA (M.SC., China) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF PHYSIOLOGY ... in HCC and then to investigate the methylation status of these genes The thesis will focus on the candidate tumor suppressor genes hDAB2IP and DLEC...

Ngày tải lên: 11/09/2015, 16:07

... Hypopharyngealcarcinomas Oesophageal cancer Gastric cancer Colorectal cancer Bladder cancer Prostate cancer Renal cancer Cholanglocarcinoma Hepatocellular carcinma Leukemia &lymphoma Breast cancer Ovarian ... on c- Jun 28 2.11 The Regulation of c- Jun 29 2.12 The stability of c- Jun protein 30 2.13 The relationship between p53 and c- Jun 30 VI 3.1 Hypothesis: The...

Ngày tải lên: 16/09/2015, 15:55

... hypoxia and reoxygenation have been reported to induce DNA damage [30–32], we examined the effects of pyruvate addition during hypoxia and after reoxygenation on DNA damage HepG2 cells were incubated ... by Singh et al [48], using alkaline electrophoresis, which allows detection of single-strand and double-strand breaks Pyruvate reduces DNA damage during...

Ngày tải lên: 18/02/2014, 16:20

... and 3) Translational regulation of iPLA2c in myocardium Owing to the obvious complexity of the regulation of iPLA2c resulting from the combined presence of transcriptional and translational regulation, ... start sites initiating biosynthesis of the 88, 77, 74 and 63 kDa iPLA2c isoforms Instead, based on current information about iPLA2c and its splici...

Ngày tải lên: 19/02/2014, 16:20

... days after release of the game, a game company is required to submit game packaging and a final version of the game to the ESRB The ESRB checks the game packaging to see if the rating information ... buying these products The music recording industry maintains that the Parental Advisory is not meant to indicate that a sound recording is eithe...

Ngày tải lên: 16/03/2014, 01:20

... (forward, 5¢-AAG GCT TAC CAC GAG CAG CTA TCA-3¢; reverse, 5¢-ACA GGC CAT GTA CTT TCC GTG TCT-3¢) and tobacco (forward, 5¢-ATG AGA GAG TGC ATA TCG AT-3¢; reverse, 5¢-TTC ACT GAA GGT GTT GAA-3¢) a- tubulinspecific ... VGCfEVY switch in regulating the expression of a zinc finger protein transcription factor isolated from Arabidopsis thaliana (AtZFP11) in both Arabidopsis and tobac...

Ngày tải lên: 16/03/2014, 06:20