Oxidative and nitrosative DNA damage occurrence, measurement and mechanism

... Species 1.2 Oxidative and Nitrosative Damage in DNA 1.2.1 DNA damage Induced by Reactive Oxygen Species 1.2.2 DNA Damage Induced by Reactive Nitrogen Species 1.3 Mutagenicity of Oxidative and Nitrosative ... Nitrosative DNA Damage Products 14 17 1.4 Methods Used in the Quantitative Study of Oxidative and Nitrosative DNA Damage 1.5 Aims of this Study 18...

Ngày tải lên: 16/09/2015, 08:31

... and spatially controlled, how Checkpoint and Coordinated Cellular Responses to DNA Damage 83 checkpoint signaling is regulated by different types of DNA damage, and how different downstream cellular ... after DNA damage might expose these histone modifications to present a damage- specific “histone code” to proteins involved in DNA repair or checkpoint si...

Ngày tải lên: 25/10/2013, 21:20

... hypoxia and reoxygenation have been reported to induce DNA damage [30–32], we examined the effects of pyruvate addition during hypoxia and after reoxygenation on DNA damage HepG2 cells were incubated ... by Singh et al [48], using alkaline electrophoresis, which allows detection of single-strand and double-strand breaks Pyruvate reduces DNA damage during...

Ngày tải lên: 18/02/2014, 16:20

... 6075 p53, p73 and HIPK2 in apoptosis N Bitomsky & T G Hofmann Fig Regulation of DNA damage- induced cell death by p53 and HIPK2 Genotoxic stress-induced DNA damage facilitates activation of the DNA ... (2009) 607 4–6 083 ª 2009 The Authors Journal compilation ª 2009 FEBS N Bitomsky & T G Hofmann p53, p73 and HIPK2 in apoptosis Fig Regulation of...

Ngày tải lên: 16/03/2014, 00:20

... al.: Sodium arsenite and hyperthermia modulate cisplatin-DNA damage responses and enhance platinum accumulation in murine metastatic ovarian cancer xenograft after hyperthermic intraperitoneal chemotherapy ... effects and determine the risk:benefit balance in performing intraperitoneal perfusion with cisplatin and arsenic For this reason, we...

Ngày tải lên: 20/06/2014, 07:20

... doi:10.1186/1748-717X-5-85 Cite this article as: Pinar et al.: Radiation induced apoptosis and initial DNA damage are inversely related in locally advanced breast cancer patients Radiation Oncology 2010 ... initial DNA damage was completed in the University of Granada (Spain) Initial radiation -induced DNA damage in PBLs was measured as previously...

Ngày tải lên: 09/08/2014, 09:20

... design DNAdirected alkylating agents by linking the alkylating pharmacophore to the DNA- affinity molecules (e.g., DNA intercalating agents, DNA minor groove binder) [7,8] In most cases, the DNA- directed ... article as: Chu et al.: Enhancement of radiosensitivity in human glioblastoma cells by the DNA N-mustard alkylating agent BO-1051 through...

Ngày tải lên: 09/08/2014, 09:20

... Henríquez-Hernández et al.: Combined low initial DNA damage and high radiation-induced apoptosis confers clinical resistance to long-term toxicity in breast cancer patients treated with high- dose radiotherapy ... observed Initial DNA damage levels in breast cancer patients Radiation-induced apoptosis in breast cancer patients...

Ngày tải lên: 09/08/2014, 09:20

... listing of Tax binding proteins with accompanying literature citations can be found by visiting the publicly accessible Tax website http://htlv -tax. com As data accumulates regarding Tax- protein interactions, ... knowledge gained in existing literature that defined a physical interaction between Tax and a cellular protein, to comprise an in silico Tax interactome This...

Ngày tải lên: 13/08/2014, 05:21

... response to DNA damage may be a consequence of their inability to be ubiquitinated Lysine residues 280 and 284 are ubiquitinated in response to DNA damage Since Tax is ubiquitinated in response to DNA ... previous findings showing that the redistribution of Tax in response to DNA Cytoplasmic localization of ubiquitinated Tax is leptomycin B se...

Ngày tải lên: 13/08/2014, 06:20

... 5'-GATCCCCGACTCCAGTGGTAATCTACTTCAAGAGAGTAGATTACCACTG GAGTCTTTTTGGAAA-'3 (previously described in Brummelkamp et al [24]) LacZ: 5'-GATCCCCAAGGCCAGACGCGAATTATTTCAAGAGAATAATTCGCGTCT GGCCTTTTTTTGGAAA-3' ... specifically designed to express siRNAs: ATM_I (7218) 5'-GATCCCCCTGGTTAGCAGAAACGTGCTTCAAGAGAGCA CGTTTCTGCTAACCAGTTTTTGGAAA-'3 ATM_II (p480): 5'-GATCCCCGATACCAGATCCTTGGAGATTCAAGAG ATCTCCAAGGATC...

Ngày tải lên: 14/08/2014, 14:21

... of influenza A (H1N1) virus infection to explore the impact of influenza infection and inflammation on DNA damage and DNA damage responses By studying chromatin phosphorylation as a measure of DNA ... of DNA damage, we show that the level of DNA damage increases following influenza infection, and we provide data that supports a role for replication fork breakdow...

Ngày tải lên: 09/09/2015, 08:16

... Investigation of DNA damage as a potential mechanism of influenza pathogenesis 66 3.1.2 Phosphorylation of H2AX (Ser-139) during DNA strand breaks 69 3.1.3 DNA damage is triggered by influenza ... to sense for DNA damages, activate cell signaling and repair DNA lesions DNA damage are surveyed via DNA damage sensors, Mre11-Rad50-Nbs1 (MRN) complex, and re...

Ngày tải lên: 30/09/2015, 06:20