Oxidative and nitrosative DNA damage occurrence, measurement and mechanism
Oxidative and nitrosative DNA damage occurrence, measurement and mechanism
... Species 1.2 Oxidative and Nitrosative Damage in DNA 1.2.1 DNA damage Induced by Reactive Oxygen Species 1.2.2 DNA Damage Induced by Reactive Nitrogen Species 1.3 Mutagenicity of Oxidative and Nitrosative ... Nitrosative DNA Damage Products 14 17 1.4 Methods Used in the Quantitative Study of Oxidative and Nitrosative DNA Damage 1.5 Aims of this Study 18 22 1.5.1 Oxidative Damage in Mitochondria and Nuclei ... obtained mtDNA of desired purity in order to make a valid comparison of oxidative damage between mtDNA and nDNA Our data show that a possibility exists that mtDNA damage is not higher than nDNA damage, ...
- 192
- 225
- 0
Checkpoint and Coordinated Cellular Responses to DNA Damage
... and spatially controlled, how Checkpoint and Coordinated Cellular Responses to DNA Damage 83 checkpoint signaling is regulated by different types of DNA damage, and how different downstream cellular ... after DNA damage might expose these histone modifications to present a damage- specific “histone code” to proteins involved in DNA repair or checkpoint signaling Perspectives The DNA damage and DNA ... regulated by certain DNA structures generated by intrinsic DNA metabolism Checkpoint and Coordinated Cellular Responses to DNA Damage 67 2.1 Recruitment of ATR to DNA What is the DNA structure sensed...
- 28
- 351
- 0
Tài liệu Báo cáo khoa học: Pyruvate reduces DNA damage during hypoxia and after reoxygenation in hepatocellular carcinoma cells pptx
... hypoxia and reoxygenation have been reported to induce DNA damage [30–32], we examined the effects of pyruvate addition during hypoxia and after reoxygenation on DNA damage HepG2 cells were incubated ... by Singh et al [48], using alkaline electrophoresis, which allows detection of single-strand and double-strand breaks Pyruvate reduces DNA damage during ⁄ after hypoxia Cells cultivated in Petri ... new insights into the role of pyruvate in tumor cells during hypoxia We show here that tumor HepG2 cells are inclined to maintain extracellular pyruvate at a constant level (0.4 mm) Hypoxia inhibits...
- 11
- 479
- 0
Báo cáo khoa học: Apoptosis and autophagy: Regulation of apoptosis by DNA damage signalling – roles of p53, p73 and HIPK2 ppt
... 6075 p53, p73 and HIPK2 in apoptosis N Bitomsky & T G Hofmann Fig Regulation of DNA damage- induced cell death by p53 and HIPK2 Genotoxic stress-induced DNA damage facilitates activation of the DNA ... (2009) 607 4–6 083 ª 2009 The Authors Journal compilation ª 2009 FEBS N Bitomsky & T G Hofmann p53, p73 and HIPK2 in apoptosis Fig Regulation of DNA damage- induced cell death by the p73 pathway ... apoptotic p53, p73 and HIPK2 in apoptosis signalling routes of the DDR regulated mainly from the cell nucleus and the key molecules p53, p73 and homeodomain-interacting protein kinase (HIPK2) Multiple...
- 10
- 466
- 0
báo cáo hóa học:" Sodium arsenite and hyperthermia modulate cisplatin-DNA damage responses and enhance platinum accumulation in murine metastatic ovarian cancer xenograft after hyperthermic intraperitoneal chemotherapy (HIPEC)" pptx
... al.: Sodium arsenite and hyperthermia modulate cisplatin-DNA damage responses and enhance platinum accumulation in murine metastatic ovarian cancer xenograft after hyperthermic intraperitoneal chemotherapy ... effects and determine the risk:benefit balance in performing intraperitoneal perfusion with cisplatin and arsenic For this reason, we determined platinum and arsenic accumulation in the brain, heart, ... cisplatin efficacy because of its abilities to impair NER by inhibiting induction of p53 and XPC and to activate MMR by maintaining high levels of MSH2 and enhancing platinum accumulation in tumors...
- 11
- 377
- 0
Báo cáo khoa học: "Radiation induced apoptosis and initial DNA damage are inversely related in locally advanced breast cancer patients" ppt
... doi:10.1186/1748-717X-5-85 Cite this article as: Pinar et al.: Radiation induced apoptosis and initial DNA damage are inversely related in locally advanced breast cancer patients Radiation Oncology 2010 ... initial DNA damage was completed in the University of Granada (Spain) Initial radiation -induced DNA damage in PBLs was measured as previously described [18] and was considered an individual indicator ... to restore DNA sequence integrity remains unclear Intrinsic radiosensitivity is correlated in a first approach to the ability of the cell to detect and repair DNA damages DSB can be induced by...
- 5
- 323
- 0
Báo cáo khoa học: " Enhancement of radiosensitivity in human glioblastoma cells by the DNA N-mustard alkylating agent BO-1051 through augmented and sustained DNA damage response" potx
... design DNAdirected alkylating agents by linking the alkylating pharmacophore to the DNA- affinity molecules (e.g., DNA intercalating agents, DNA minor groove binder) [7,8] In most cases, the DNA- directed ... article as: Chu et al.: Enhancement of radiosensitivity in human glioblastoma cells by the DNA N-mustard alkylating agent BO-1051 through augmented and sustained DNA damage response Radiation ... dilution of 1:100 in 1% BSA The secondary antibody solution was then aspirated, and the cells were washed twice in PBS The cells were then incubated in the dark with PI (1 μg/ml) in PBS for 30 min,...
- 13
- 447
- 0
Báo cáo khoa học: "Combined low initial DNA damage and high radiation-induced apoptosis confers clinical resistance to long-term toxicity in breast cancer patients treated with high-dose radiotherapy" pdf
... Henríquez-Hernández et al.: Combined low initial DNA damage and high radiation-induced apoptosis confers clinical resistance to long-term toxicity in breast cancer patients treated with high- dose radiotherapy ... observed Initial DNA damage levels in breast cancer patients Radiation-induced apoptosis in breast cancer patients Initial DNA damage was determined as radiationinduced double-strand breaks (DSB) in ... association between initial DNA damage and RIA in relation to radiation-induced toxicity in the set of LABC patients treated with high dose HF radical RT with long-term follow-up where this association...
- 8
- 315
- 0
Báo cáo y học: " Physical and in silico approaches identify DNA-PK in a Tax DNA-damage response interactome" pot
... listing of Tax binding proteins with accompanying literature citations can be found by visiting the publicly accessible Tax website http://htlv -tax. com As data accumulates regarding Tax- protein interactions, ... knowledge gained in existing literature that defined a physical interaction between Tax and a cellular protein, to comprise an in silico Tax interactome This interactome was then restricted to proteins ... TOP1, Chk2, and 53BP1 Construction of a physical Tax interactome map Our approach to defining the physical Tax interactome began with the selective isolation of Tax- containing multiprotein complexes...
- 13
- 340
- 0
Báo cáo y học: "Ubiquitination of HTLV-I Tax in response to DNA damage regulates nuclear complex formation and nuclear export" pps
... response to DNA damage may be a consequence of their inability to be ubiquitinated Lysine residues 280 and 284 are ubiquitinated in response to DNA damage Since Tax is ubiquitinated in response to DNA ... previous findings showing that the redistribution of Tax in response to DNA Cytoplasmic localization of ubiquitinated Tax is leptomycin B sensitive The wild-type HTLV-1 Tax protein localizes predominately ... results in increased mono-ubiquitination of Tax Mutation of Tax amino acids known to be targets of ubiquitination (K280 and K284) inhibited DNA damage- induced ubiquitination of Tax, resulting in retention...
- 12
- 297
- 0
Báo cáo y học: "Dissection of a DNA-damage-induced transcriptional network using a combination of microarrays, RNA interference and computational promoter analysis" pot
... 5'-GATCCCCGACTCCAGTGGTAATCTACTTCAAGAGAGTAGATTACCACTG GAGTCTTTTTGGAAA-'3 (previously described in Brummelkamp et al [24]) LacZ: 5'-GATCCCCAAGGCCAGACGCGAATTATTTCAAGAGAATAATTCGCGTCT GGCCTTTTTTTGGAAA-3' ... specifically designed to express siRNAs: ATM_I (7218) 5'-GATCCCCCTGGTTAGCAGAAACGTGCTTCAAGAGAGCA CGTTTCTGCTAACCAGTTTTTGGAAA-'3 ATM_II (p480): 5'-GATCCCCGATACCAGATCCTTGGAGATTCAAGAG ATCTCCAAGGATCTGGTATCTTTTTGGAAA-3', ... ATCTCCAAGGATCTGGTATCTTTTTGGAAA-3', a generous gift from R Agami (ATM level was knocked-down using a combination of two different siRNAs.) Rel _A: 5'-GATCCCCGAAGAGTCCTTTCAGCGGATTCAAGAGATCCGCTGAAAG GACTCTTCTTTTTGGAAA -3'...
- 8
- 248
- 0
DEVELOPMENT AND APPLICATION OF NEW APPROACHES FOR STUDIES OF INFLUENZA INDUCED INFLAMMATION AND DNA DAMAGE
... of influenza A (H1N1) virus infection to explore the impact of influenza infection and inflammation on DNA damage and DNA damage responses By studying chromatin phosphorylation as a measure of DNA ... of DNA damage, we show that the level of DNA damage increases following influenza infection, and we provide data that supports a role for replication fork breakdown as a driver of DNA strand breaks ... Together, these studies raise the possibility that DNA damage and DNA repair modulate the severity of influenza -induced cytotoxicity, thereby affecting tissue damage and regeneration, and ultimately...
- 16
- 357
- 0
DEVELOPMENT AND APPLICATION OF NEW APPROACHES FOR STUDIES OF INFLUENZA INDUCED INFLAMMATION AND DNA DAMAGE
... Investigation of DNA damage as a potential mechanism of influenza pathogenesis 66 3.1.2 Phosphorylation of H2AX (Ser-139) during DNA strand breaks 69 3.1.3 DNA damage is triggered by influenza ... to sense for DNA damages, activate cell signaling and repair DNA lesions DNA damage are surveyed via DNA damage sensors, Mre11-Rad50-Nbs1 (MRN) complex, and replication protein A (RPA) and Rad9-Rad1-Hus1 ... more harmful DNA strand breaks Taken together, DNA damage (in the form of DNA strand breaks) can be induced directly by ROS / RNS, as well as indirectly during the repair of ROS / RNS -induced base...
- 223
- 596
- 0
Từ khóa: fruits and vegetables and the prevention of oxidative dna damagepotential ros and oxidative dna damageoxidative stress dna damage and apoptosis in male infertilityoxidative and nitrosative stress in parkinson diseasedna damage and repairdna damage response and human agingdna damage response and dna repairdna damage and apoptosis in fetal and ovarian reserve oocytesdna damage and telomeric loss in yeast agingdna damage response and mutagenesis in mouse embryonic stem cells pdfdna damage response cell cycle checkpoints and dna repairhdacs dna damage repair and radiation sensitivityapoptosis and the origins of dna damage in human spermatozoaapoptosis and dna damage in human spermatozoaage dna damage and disease in the progenychuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP