Functional analysis of the nuage, a unique germline organelle, in drosophila melanogaster 2

... gtcccacaccaacggcggag taatacgactcactataggg aattaaccctcactaaaggg catacgatttaggtgacactatatag cgaattctaaggtacctaattgcctag cgaattcatcgatcgcgcgcagatcta atgtcgaagatcggaattaac ttagtccttgctctgcatatactt ... caggattgataagaatgcaggacaaaa ttgcaatatgttaatgttaccagtccatg actttgctggtggaggtacggagacagagtaaattctgt t cataatactccacgcgcaaa cgtcttttggcttcttctcc attgccctcaaatcaagcag gtggacggaggagaagacaa tcattgacgataccagcgcatc ... tttagctgtaagatgcttaaaggagct gaccaaataaaaataatacgacttc aactaattgctggcttgttatg tcattgacgataccagcgcatc tccgggtgcgtttaggtgag ttctatcaacaggctgtccacaggtt ccttcgtagtcgggtaggattattcgt aaaagacagacatgccttcgctccc...

Functional analysis of the nuage, a unique germline organelle, in drosophila melanogaster 1

... of processing body (P-body) that are known to participate in mRNA degradation and translational silencing, Decapping Protein 1a (DCP 1a) and Glycine-tryptophan protein of 18 2kDa (GW182), are also ... et al., 2005b), and that the C elegans homologue of GW182, Acyl-CoA carboxylase insensitive (AIN -1) , interacts with a putative AGO family protein, Asparagine-linked glycosylation (ALG -1) (Ding ... small RNA-mediated silencing Indeed, a preliminary study that examined the small RNA profiles of different developmental stages in D melanogaster has identified a unique class of small RNAs that...

Functional analysis of the nuage, a unique germline organelle, in drosophila melanogaster 3

... magenta, and cyan, respectively Although krimp was identified as a highly expressed mRNA in the GSCs from the microarray analysis, immunostaining of KRIMP indicates a wide expression in germline ... melanogaster germline cells (a) KRIMP localises to the perinuclear regions of the germline cells in the Drosophila ovary Ovaries were immunostained with anti-KRIMP (green) and anti-VAS (red) Bar ... (blue) Bar is µm An examination of the D/V marker GRK, indicated a loss of D/V polarity in krimp mutant oocytes The level of GRK expression was markedly reduced in 100% (n = 30 ) of the mutant ovarioles...

Functional analysis of the nuage, a unique germline organelle, in drosophila melanogaster 4

... vas, aub, cuff, and mael mutants In all of the examined mutants except mael, KRIMP perinuclear localisation was affected, while the localisation of AGO3 and MAEL appeared to depend on KRIMP, as ... It was also noticeable that VAS localisation depends partially on proper AUB localisation Although VAS foci were apparent in aub mutant, cytoplasmic VAS was visibly more abundant than in the ... Protein A/ G beads, in the presence of either HA-tagged AUB, CUFF, AGO3 or MAEL KRIMPMYC interacts directly with AUB-HA, CUFF-HA, and AGO3-HA The asterisk indicates the IgG band To confirm KRIMP association...

Functional analysis of the nuage, a unique germline organelle, in drosophila melanogaster 5

... the nuage site Indeed, a recent study has suggested that TUD aids in the association of piRNAs with AUB and AGO3 in an arginine methylationdependent manner (Nishida et al., 2009) The nuage components, ... silencing of LINEs/nonLTRs among the examined nuage components therefore implies a common role in maintaining the silenced state of the heterochromatic retroelements Vagin et al (2004 and 2006) have ... rescue the perinuclear localisation of AGO3 and MAEL, the expression level and anterior-dorsal localisation of GRK, and karyosome compaction of the oocyte; but not precocious osk mRNA translation in...

Functional analysis of the nuage, a unique germline organelle, in drosophila melanogaster 6

... that consist of nuage cytoplasmic foci docking partially around the mRNA degradation components Overlapping nuage/P-body foci are expressed as percentages of the total number of overlapping and ... non-overlapping P-body foci The range of overlaps (complete or partial) appears to be independent of the foci sizes and nuage/P-body pairs (b) Immunostaining of overlapping cytoplasmic AGO3 (red) and ... foci A complete overlap and partial overlap are indicated by a white arrow and arrowhead respectively Bar is μm (c) Immunostaining of non-overlapping Me31B A Me31B focus (green) that lacks the...

Functional analysis of the nuage, a unique germline organelle, in drosophila melanogaster 7

... that deadenylation is unaffected in at least one of the piRNA pathway mutant aub Figure 3.3 .7 Deadenylation is unaffected in aub mutant LM-PAT assay of cycB In the piRNA pathway mutant aub, deadenylation ... deadenylation appears unaffected since the poly (A) tail length is comparable to that of the control In contrast, deadenylation is impaired in the deadenylase mutant twin, as indicated by the accumulation ... exonuclease in the aub mutant (Figure 3.3.8), indicating that cycB mRNA is efficiently decapped Figure 3.3.8 Decapping is unaffected in aub mutant Cap analysis of cycB In aub mutant as well as in the...

Functional analysis of the nuage, a unique germline organelle, in drosophila melanogaster 8

... unaffected in the mRNA degradation mutants PAGE-northern analyses of piRNA production in the mRNA degradation mutants The level of piRNA production is unaffected in the mRNA degradation mutants ... 3’-UTR, and poly (A) All examined regions are derepressed in dcp1 and ski3 mutants (b) Quantitative RACE-PAT and RT-PCR of HeT -A mRNA, normalised against act5C, in dcp1 and ski3 mutants Error bars indicate ... requires the contribution from both the piRNA pathway and mRNA degradation proteins 102 Figure 3.3.14 Nuage localisation is unaffected in the mRNA degradation mutants Immunostaining of the nuage components...

Functional analysis of the nuage, a unique germline organelle, in drosophila melanogaster 9

... overlapped with the tER and endosomal markers (Figure 3.4.1) This is consistent with the observation by Lee et al (20 09) that AGO1 and AGO2 are associated with membranes in the cytoplasm in RNAi-defective ... tER/endosomal markers TER94, CD63, LAMP2, and ARF6 (green) In the wild-type ovary, KRIMP, PCM, and TER94/CD63/LAMP2/ARF6 overlap In the piRNA pathway mutants spn-E and aub, pi-body assembly is compromised ... RNAi-defective mutant HPS4 Figure 3.4.1 Cytoplasmic nuage is tethered to ER/endosomal compartments Immunostaining of the nuage component KRIMP (magenta), P-body protein PCM (red), and tER/endosomal markers...

Functional analysis of the nuage, a unique germline organelle, in drosophila melanogaster 10

... eye and salivary glands of D melanogaster (Pal-Bhadra et al., 2004) A preliminary finding in our laboratory has indicated the presence of VAS, KRIMP, and MAEL transcripts in the wild-type adult ... Cavalli, and V .A Gvozdev 2004 Dissection of a natural RNA silencing process in the Drosophila melanogaster germline Mol Cell Biol a2 4:6742-6750 Aravin, A. A., M Lagos-Quintana, A Yalcin, M Zavolan, ... Castaneda, V.V Vagin, G.J Hannon, and A Bortvin 2009 Cytoplasmic compartmentalisation of the fetal piRNA pathway in mice PLoS Genet in press Aravin, A. A., M.S Klenov, V.V Vagin, F Bantignies, G Cavalli,...

Báo cáo khoa học: Molecular cloning of the Matrix Gla Protein gene from Xenopus laevis Functional analysis of the promoter identiﬁes a calcium sensitive region required for basal activity doc

... tatg|gtaag tatg|gtaag agag|gtaag g(t)5aacag|aagaa c(t)4gtatacag|actc a( t)4cag|atcc c(t)4ag|aatc Not in coding region I I II (2929) (986) (1985) (1490) Table Comparison between exon structures in Xenopus ... 2002 Functional analysis of Xenopus MGP gene promoter (Eur J Biochem 269) 1949 GGAAAC-3Â) for amplication of the region from )783 to +33, and (5Â-CCGGAGCTCGAGGGAGATGAGGAG GTGTGG-3Â) for amplication ... AGATCTACCACACCTCCTCATCTCC-3Â) for amplication of the region from )180 to )36 and (5Â-GAAGAT CTAACTAGATTTTACCATTGG-3Â) for amplication of the region from )180 to )72, respectively The )134/ )36TATALUC construct was PCR amplied...

Tài liệu Báo cáo khoa học: Functional analysis of the basic helix-loop-helix transcription factor DEC1 in circadian regulation ppt

... activity of DEC1 is also required for the interaction with BMAL1 Binding of DEC1 mutants to a CACGTG E-box To examine the binding ability of DEC1 mutants to the CACGTG E-box in the Dec1 promoter, ... for DEC1 suppressive activity against CLOCK/BMAL1-induced transcription In addition, the N-terminal region of DEC1, including the bHLH domain, interacted with the C-terminal region of BMAL1 in ... 5) These results indicate that the bHLH region, including His57 and Arg65, is responsible for the E-box binding Determination of the region in BMAL1 for binding to DEC1 To identify the region in...

Báo cáo khoa học: Structural and functional analysis of the interaction of the AAA-peroxins Pex1p and Pex6p pptx

... to the cytosol Here we conﬁrm and extend earlier studies of these AAA-peroxins and give a further detailed functional analysis of their cassette structure and interaction The interaction of Pex1p ... for the Pex1p Pex6p interaction and their functional role in peroxisome biogenesis Results The contribution of Pex1p and Pex6p to peroxisomal biogenesis is well established on the basis of the ... revealed the presence of Pex6p in the precipitate of full-length Pex1p ProtA and also the presence of Pex1p in the full-length Pex6p ProtA-precipitate (Fig 1C,D) These data conﬁrm the in vivo interaction...

Báo cáo khoa học: Functional analysis of the aglycone-binding site of the maize b-glucosidase Zm-p60.1 pot

... and catalytic properties of the mutants, and simulations of the substrate–enzyme interactions of the wild-type and one of the mutants The results provide indications of the native enzymes’ catalytic ... construction of the mutant b-glucosidases Findings that cytokinin-O-glucosides are natural substrates for both of the two b-glucosidases, Zm-p60.1 and Bgl4:1, but the architecture of their sites that ... sites involved in the two modes of aglycone binding The amino acid sequence of Zm-p60.1 was compared with the sequences of 22 other members of the GH1 family from 13 plant genera The resulting alignment...

Báo cáo khoa học: Conformational and functional analysis of the lipid binding protein Ag-NPA-1 from the parasitic nematode Ascaridia galli potx

... like the Trp residue of the 183 Conformation, ligand binding and distribution of nematode protein Ag-NPA-1 R Jordanova et al Fig Immunohistological localization of Ag-NPA-1 in adult A galli and ... ligand binding and distribution of nematode protein Ag-NPA-1 Fig Immunogold electron microscopic localization of Ag-NPA-1 in a male A galli worm (A) Section of the striate musculature (mu) and the ... emission upon binding characterize the binding sites of NPAs as highly nonpolar and completely isolated from the solvent Here we analyze the conformational and functional properties of Ag-NPA-1 as...

Xem thêm

Từ khóa: a functional analysis of the cameron site chipped stone assemblage functional analysis of the cervicalfunctional analysis of intergenic summary of analysis of the conversation between christina and benjamin in terms of speech acts give a critical analysis of the concept of self defence in public international law and international humanitarian law 776 analysis of the d latch for a few transitions  chapter 7 contains a longitudinal analysis of the subset of companies that had participated in the previous study collis 2003 as well as the present survey in and as electronic governance a comparative analysis of the social production of an academic community a cost benefit analysis of the ganga a gendered analysis of the importance of fertility preservation for cancer patients a biomechanical analysis of the respiratory pattern during the golf swing structural studies of the functional complexes of the 50s and 70s ribosome a major antibiotic target a comparative analysis of the models a content analysis of the language used by offenders detected attempting to solicit children for sex functional analysis of human brca2 variants using a mouse embryonic stem cell based assay 5 extending your search broadly and doing a comparative analysis of the sons Báo cáo quy trình mua hàng CT CP Công Nghệ NPV chuyên đề điện xoay chiều theo dạng Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Chuong 2 nhận dạng rui ro Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)