Báo cáo khoa học: Structural and functional analysis of the interaction of the AAA-peroxins Pex1p and Pex6p pptx

Structural and functional analysis of the interaction of the AAA-peroxins Pex1p and Pex6p Ingvild Birschmann 1, * , †, Katja Rosenkranz 2, †, Ralf Erdmann 2 and Wolf-H Kunau 1 1 Abteilung fu ¨ r Zellbiochemie, Medizinische Fakulta ¨ t der Ruhr-Universita ¨ t Bochum, Germany 2 Abteilung fu ¨ r Systembiochemie, Medizinische Fakulta ¨ t der Ruhr-Universita ¨ t Bochum, Germany Peroxisomes are ubiquitous, single membrane-bound organelles involved in many metabolic pathways [1]. Thirty-two proteins required for peroxisome biogenesis have been described [2–6]. They are encoded by PEX genes and are collectively called peroxins. Most of the peroxins are directly involved in the import process for peroxisomal matrix and membrane proteins while oth- ers are required for proliferation and inheritance of the organelles [2]. The current model of peroxisome bio- genesis suggests that peroxisomal proteins are synthes- ized on free ribosomes and post-translationally targeted to the organelle [7–9]. Targeting and trans- location of newly synthesized peroxisomal matrix pro- teins requires ATP and depends on peroxisomal targeting signals [10], PTS1 and PTS2, and their cognate receptors Pex5p and Pex7p, respectively [11,12]. These two peroxins bind their cargo in the cytoplasm, transport them to (and possibly across) the peroxisomal membrane and return to the cytoplasm for the next round of import. The membrane-bound steps of this receptor cycle are currently under inten- sive investigation [13,14]. PEX1 and PEX6 genes encode members of the AAA family of ATPases, a large superfamily of pro- teins involved in the ATP-dependent rearrangement of protein complexes [15–17]. AAA-proteins are found in all organisms and are essential for many activities, e.g. cell cycle function, vesicular transport, mitochondrial Keywords AAA-proteins, peroxisomal biogenesis, Pex1p, Pex6p, peroxin Correspondence Dr Ralf Erdmann, Institut fu ¨ r Physiologische Chemie, Abteilung fu ¨ r Systembiochemie, Medizinische Fakulta ¨ t der Ruhr-Universita ¨ t Bochum, D-44780 Bochum, Germany. Tel: +49 234322 4943 Fax: +49 234321 4266 E-mail: Ralf.Erdmann@ruhr-uni-bochum.de *Present address Institut fu ¨ r Klinische Biochemie und Patho- biochemie, Medizinische Universita ¨ tsklinik, D-97078 Wu ¨ rzburg, Germany †Both authors contributed equally to this manuscript (Received 21 July 2004, accepted 25 August 2004) doi:10.1111/j.1432-1033.2004.04393.x The AAA-peroxins Pex1p and Pex6p play a critical role in peroxisome bio- genesis but their precise function remains to be established. These two peroxins consist of three distinct regions (N, D1, D2), two of which (D1, D2) contain a conserved  230 amino acid cassette, which is common to all ATPases associated with various cellular activities (AAA). Here we show that Pex1p and Pex6p from Saccharomyces cerevisiae do interact in vivo. We assigned their corresponding binding sites and elucidated the importance of ATP-binding and -hydrolysis of Pex1p and Pex6p for their interaction. We show that the interaction of Pex1p and Pex6p involves their first AAA-cassettes and demonstrate that ATP-binding but not ATP-hydrolysis in the second AAA-cassette (D2) of Pex1p is required for the Pex1p–Pex6p interaction. Furthermore, we could prove that the second AAA-cassettes (D2) of both Pex1p and Pex6p were essential for peroxi- somal biogenesis and thus probably comprise the overall activity of the proteins. Abbreviations AAA, ATPases associated with various cellular activities; NSF, N-ethylmaleimide-sensitive fusion protein. FEBS Journal 272 (2005) 47–58 ª 2004 FEBS 47 functions and proteolysis [17,18]. AAA-proteins share the presence of one or two AAA-cassettes, comprising about 230 amino acids and are characterized by Wal- kerA and B motifs for ATP-binding and ATP-hydro- lysis [19,20]. Pex1p and Pex6p are functionally nonredundant AAA-proteins required for the biogen- esis of peroxisomes. A direct interaction of Pex1p and Pex6p has been demonstrated in some organisms [21– 24] indicating that the two peroxins cooperate in per- oxisome assembly. Sequence comparison of Pex1p and Pex6p with other AAA members indicates that the two AAA-peroxins belong to an AAA-protein subfamily characterized by a tripartite structure. These proteins possess large N-terminal regions followed by two AAA- cassettes. In N-ethylmaleimide-sensitive fusion protein (NSF), the best characterized AAA-protein, distinct functions could be assigned to its three parts [25,26]. For yeast and human Pex6p it has been reported that the N-terminal region of this protein functionally inter- acts with the yeast peroxin Pex15p or human Pex26p, respectively [3,27]. However, despite these findings and the fact that both AAA-peroxins are conserved from yeast to humans their function in peroxisome biogenesis remains unknown. In this study we mapped the mutual binding sites and assayed the effects of deletion and point mutations in Pex1p and Pex6p for the interaction of the proteins and for their overall function in peroxisome biogenesis. Our results demonstrate a different role of the two AAA-cassettes for the Pex1p–Pex6p interaction and their functional role in peroxisome biogenesis. Results The contribution of Pex1p and Pex6p to peroxisomal biogenesis is well established on the basis of the pheno- types of the corresponding null mutants. Both pex1D [24,28] and pex6D [29,30] mutants show a characteristic pex phenotype with only residual, ghost-like peroxi- somal structures and mislocalization of peroxisomal matrix proteins to the cytosol. Here we confirm and extend earlier studies of these AAA-peroxins and give a further detailed functional analysis of their cassette structure and interaction. The interaction of Pex1p and Pex6p involves their first AAA-cassettes (D1) Pex1p and Pex6p have been shown to interact in Pichia pastoris, Hansenula polymorpha and human [21–24]. To further limit the corresponding binding regions, we first confirmed the interaction of the two proteins in bakers yeast. For this purpose, we constructed plasmids carry- ing PEX1 fused to the coding sequence of the activation domain of Gal4p (PEX1-GAL4-AD) or PEX6 linked to the coding region of the DNA binding domain of Gal4p (PEX6-GAL4-BD). The two-hybrid reporter strain PCY2 was cotransformed with the two plasmids. Acti- vation of the reporter gene lacZ, indicated by blue colonies on X-Gal medium was observed, when PEX6- GAL4-BD was coexpressed with PEX1-GAL4-AD (Fig. 1A,B). Transformation of either of these two plas- mids alone did not lead to an activation of the reporter gene. The same results were obtained when the reporter strain HF7c was used to assay for histidine prototrophy (data not shown). These data demonstrate that ScPex1p interacts with ScPex6p. The two-hybrid studies did not provide an indication for homo-oligomerization of the two AAA-peroxins when PEX1-GAL4-BD was coex- pressed with PEX1-GAL4-AD or PEX6-GAL4-BD was coexpressed with PEX6-GAL4-AD (data not shown). This finding in turn is in agreement with the assumption that these two AAA-peroxins fulfill their function in peroxisome biogenesis as a transient or stable hetero- meric protein complex. To investigate the influence of the recent published interaction between Pex6p and Pex15p [27], we carried out the two-hybrid assay in the absence of Pex15p (PCY2 pex15D). Pex1p and Pex6p still showed interaction in pex15D indicating that the association of the two proteins does not depend on Pex15p (data not shown). To identify the regions in Pex1p and Pex6p that are responsible for their interaction, truncated versions of the proteins were tested for interaction in the yeast two-hybrid system. According to the predicted domain structure, the Pex1p sequence was divided into three parts: the N-terminal region (N, aa1–400), the first AAA-cassette (D1, aa394–681) and the second AAA- cassette (D2, aa669–1043). DNA fragments encoding these parts of Pex1p were fused to the GAL4-AD and coexpressed with PEX6-GAL4-BD in PCY2.As judged by the lack of lacZ gene expression, none of these cassettes alone can mediate binding to Pex6p (Fig. 1A). However, a Pex1p fragment consisting of the N-terminal part and the first AAA-cassette (N + D1, aa1–681) gave rise to a low but significant lacZ gene activation (Fig. 1A). The fragment compri- sing both AAA-cassettes (D1 + D2), however, led to a b-galactosidase activity comparable to that of the full-length Pex1p (Fig. 1A). These findings indicate that binding of Pex6p is best in the presence of both AAA-cassettes of Pex1p. However, the data also indi- cate that the first AAA-cassette together with the N-terminal region or the second cassette of Pex1p is already sufficient for interaction of the two AAA- peroxins. Consequently, these results demonstrate the Domain function of Pex1p and Pex6p I. Birschmann et al. 48 FEBS Journal 272 (2005) 47–58 ª 2004 FEBS critical role of the first AAA-cassette of Pex1p for the binding of Pex6p. Our data suggest that the binding site for Pex6p is comprised within the first AAA- cassette (D1) of Pex1p. Binding efficiency can be increased by the additional presence of either the N-terminal fragment or more drastically by the pres- ence of the second AAA-cassette. This is consistent with the observation that a mutation in the beginning of Pex1pD2 (G843D in human, corresponding to G700 in yeast) attenuates the interaction of the two AAA-peroxins [23]. To identify the Pex6p binding site for Pex1p, we tes- ted the N-terminal region (N, aa1–428), the first AAA- cassette (D1, aa421–716) and the second AAA-cassette (D2, aa704–1030) and all possible combinations for interaction with Pex1p in the yeast two-hybrid system. The corresponding PEX6 fragments were fused to GAL4-BD and coexpressed with PEX1–GAL4-AD. The results shown in Fig. 1B demonstrate that an acti- vation of the lacZ reporter gene occurred only in dou- ble transformants carrying PEX1 –GAL4-AD and the construct coding for the Pex6p region comprising the N-terminal fragment and the first AAA-cassette of PEX6 (PEX6N + D1–GAL4-BD). Neither of the cas- settes alone nor the two AAA-cassettes together or the N-terminal part together with the second cassette led to an activation of the reporter gene and thus is suffi- cient to maintain the interaction with Pex1p. These findings demonstrate the importance of the first AAA- cassette together with the N-terminal region of Pex6p for the described interaction. To confirm these results, we carried out coimmuno- precipitation with different genomic integrated con- structs: Pex1pN–ProteinA, Pex1pN + D1–ProteinA, Pex1p–ProteinA, Pex6pN–ProteinA, Pex6pN + D1– ProteinA, Pex6p–ProteinA. For this purpose, we generated strains that express the proteins of interest, C-terminally fused to two IgG-binding domains derived from Staphylococcus aureus protein A (ProtA). An advantage of these fusion proteins was the possibility to detect even the truncated constructs via the ProtA- tag. Moreover, as expression of the constructs was under the control of the endogenous promoters, overexpession was avoided, which has been shown to A BD C Fig. 1. Coimmunoprecipitation and two-hybrid interaction of Pex1p and Pex6p. A schematic representation of the Pex1p and Pex6p con- structs which were analyzed in the two-hybrid assay (A,B) or by coimmunoprecipitation (C,D) is shown on the left. Analysis of PCY2 trans- formants expressing the indicated fusion proteins of (A) Pex1p truncations and full-length Pex6p or (B) Pex6p truncations and full-length Pex1p. The interactions were analyzed for b-galactosidase activity by filter assays with X-gal as the substrate. Three independent double- transformations are shown. Extracts of oleic acid-induced wild-type cells expressing (C) Pex1p and Pex1p-truncations or (D) Pex6p and Pex6p-truncations fused to ProteinA were immunoprecipitated with anti-IgG and immunoblotted with the same antisera (C,D), or antibodies to Pex1p (D) or Pex6p (C). As a control, wild-type cells expressing no ProteinA fusion protein were treated equally (C,D; lane 4). I. Birschmann et al. Domain function of Pex1p and Pex6p FEBS Journal 272 (2005) 47–58 ª 2004 FEBS 49 affect peroxisome biogenesis [31–33]. To ascertain whether the ProtA fusion proteins were functional or not, we investigated the ability of the strains to grow on medium containing oleic acid as the sole carbon source and monitored for the correct proliferation of peroxisomes via the analysis of cell morphology by electron microscopy. We observed that both full length proteins Pex1p and Pex6p fused to ProtA were functional in vivo, whereas the four deleted strains (Pex1pN– ProtA, Pex 1pN + D1–ProtA, Pex6p N– ProtA, Pex6pN + D1–ProtA) showed neither growth on oleic acid nor morphologically detectable peroxi- somes (data not shown). ProtA fusion proteins in the eluates were detected by immunoblot analysis with anti-IgG (Fig. 1C,D). The different migration behaviour reflects the different sizes of the fusion proteins. Immunological analysis revealed the presence of Pex6p in the precipitate of full-length Pex1p–ProtA and also the presence of Pex1p in the full-length Pex6p–ProtA-precipitate (Fig. 1C,D). These data confirm the in vivo interaction of the two proteins. We tested two truncations for their interaction behaviour, the N-terminal region and the N-terminal region together with the first AAA- cassette. Attempts to express ProtA fusion constructs comprising the first and the second cassette were not successful. Neither Pex1p nor Pex6p was present in the precipitates of the N-terminal region of Pex6, or Pex1p, respectively (Fig. 1C,D). These data indicate that the N-terminal fragment alone does not interact with the corresponding binding partner. However, a significant amount of Pex1p and Pex6p was detected in the precipitates of the N + D1 fusions (Fig. 1C,D). These data support the two-hybrid results and indicate that D1 of both Pex1p and Pex6p contributes to the binding of the two proteins. Truncation of either pro- tein, however, did result in a significant decrease in the coimmunoprecipitation of the binding partner. These data might indicate that the contact sites between the two proteins are not limited to the first cassette but also comprise regions of the N-terminal fragment or the second cassette, or that the binding site is com- prised by D1 but its binding capability is significantly enhanced in the presence of the N-terminal fragment or D2. ATP-binding but not ATP-hydrolysis in the second AAA-cassette (D2) of Pex1p is required for the Pex1p–Pex6p interaction Pex1p and Pex6p both contain two AAA-cassettes and thus two consensus ATP-binding sites. Typically, Walker-type nucleotide-binding sites consist of two conserved motifs. The WalkerA motif is essential for nucleotide-binding, while the WalkerB motif is required for hydrolysis of the nucleotide. To investi- gate the influence of the binding and ⁄ or hydrolysis of ATP on the interaction of the AAA-peroxins, Pex1p and Pex6p carrying mutated ATP-binding sites were tested for interaction with the binding partner in the yeast two-hybrid system. In the first set of mutants, the lysine residue in the GXXGXGKT sequence of either one of the two WalkerA motifs was replaced by a glutamate or alanine residue which led to Pex1pA1- (K467E), Pex1pA2(K744E), Pex6pA1(K489A) and Pex6pA2(K778A). These invariant lysine residues have been shown to be essential for the biological activity of a number of ATP- and GTP-binding proteins and their replacement yields proteins with significantly reduced ATP-binding capacity [34]. Such an impairment of the biological activity has also been reported for Pex1p and NSF [19,35,36]. Similarly, we also introduced point mutations of amino acids in the ATP-hydrolysis sites (conserved sequence is four hydrophobic amino acid D ⁄ E) to investigate their influence on the des- cribed interaction. We changed the conserved aspartate of the WalkerB motifs of Pex1p and Pex6p into gluta- mine leading to Pex1pB1(D525Q), Pex1pB2(D797Q) and Pex6pB2(D831Q) [37]. It was not necessary to cre- ate a B1 point mutation because wild-type Pex6p already contains an alanine instead of the critical aspartate (aa548), strongly suggesting that D1 of Pex6p can bind but not hydrolyse ATP. DNA fragments encoding the entire Pex1p or Pex6p harboring the different mutations in the AAA-cassettes were fused to GAL4-AD ⁄ GAL4-BD and coexpressed with PEX6–GAL4-BD or PEX1–GAL4-AD, respect- ively (Fig. 2). Compared to wild-type Pex1p or Pex6p, only the Pex1pA2 mutation resulted in a significantly less efficient interaction with Pex6p as judged by the decreased activation of the lacZ gene (Fig. 2A). Neither a mutation in Pex1pA1 nor in Pex6pA1 or Pex6pA2 had any influence on the Pex1p–Pex6p interaction (Fig. 2). Moreover, the mutations of the WalkerB motif did not affect the interaction of the AAA-peroxins (Fig. 2). All constructs used for two-hybrid analyses were over- expressed and showed the same protein level, demon- strating that the described effects were not a result of different expression levels (data not shown). These results give rise to the notion that ATP-bind- ing to D1 of Pex1p and to D1 and D2 of Pex6p as well as the capability for ATP-hydrolysis in general is dispensible for the Pex1p–Pex6p interaction. However, the results also clearly demonstrate that the ability of the second AAA-cassette of Pex1p to bind ATP is required for the interaction of Pex1p and Pex6p. Domain function of Pex1p and Pex6p I. Birschmann et al. 50 FEBS Journal 272 (2005) 47–58 ª 2004 FEBS The second AAA-cassettes (D2) of Pex1p and Pex6p are essential for peroxisomal biogenesis To investigate the effects of the described WalkerA and WalkerB mutants of the ATP-binding sites for the function of Pex1p and Pex6p in peroxisomal biogen- esis, we analyzed the functional and morphological phenotypes of the transformed mutants in further detail. Cells deficient in Pex1p or Pex6p are characterized by the inability to grow on oleic acid as the single car- bon source, mislocalization of matrix proteins to the cytosol and the absence of morphologically detectable matrix-filled peroxisomes [21,24,28,30,35,38]. First, we tested different mutant constructs for their ability to complement the oleic acid-growth phenotype of the pex1 or pex6 null mutant. As demonstrated in Fig. 3, null mutants expressing Pex1p mutated at the first ATP-binding site (Pex1pA1, Pex1pB1) showed the wild-type phenotype with respect to growth on oleic acid medium. The same has been shown for Pex6p (Pex6pA1) [27]. Complementation of the mutant strains is indicated by growth on oleic acid medium (YNO)-agar plates, which gives rise to a typical halo reflecting the consumption of oleic acid. Interestingly, the null mutants expressing Pex1p or Pex6p mutated at WalkerA or WalkerB of the second ATP-binding site were not able to grow on oleic acid as sole carbon source (Fig. 3; [27,35]), indicating that both ATP-bind- ing and ATP-hydrolysis at the conserved D2 is required for Pex1p and Pex6p function in peroxisomal biogenesis. This is also supported by the ultrastructural appearance of the corresponding mutants (Figs 4 and 5). Oleic acid-induced pex1D (Fig. 4) or pex6D (Fig. 5) mutant cells transformed with plasmids encoding Pex1pA2 (Fig. 4E), Pex1pB2 (Fig. 4F), Pex6pA2 (Fig. 5E), or Pex6pB2 (Fig. 5F) are characterized by the absence of morphologically detectable peroxisomes and thus exhibit the same phenotype of the corres- ponding pex1 (Fig. 4B) and pex6 (Fig. 5B) null mutants, indicative of no complementation. Peroxi- somes reappear, however, upon complementation of pex1D or pex6D strains with the wild-type Pex1p (Fig. 4A) or Pex6p (Fig. 5C) proteins or proteins har- boring mutations in the first AAA-cassette [Pex1pA1 (Fig. 4C), Pex1pB1 (Fig. 4D), Pex6pA1 (Fig. 5D)]. These results are consistent with an essential role of the conserved AAA-cassette for Pex1p and Pex6p func- tion in peroxsiome biogenesis. The results also demon- strate that ATP-binding and ATP-hydrolysis at the conserved AAA-cassette is required for the biological function of Pex1p and Pex6p. A B Fig. 2. Two-hybrid interaction of Pex1p and Pex6p harboring point mutations of the WalkerA and B motifs of their ATP-binding sites. A schematic representation of the Pex1p and Pex6p mutants which were tested for two-hybrid interaction is shown on the left. PCY2 transformants expressed the indicated fusion protein combinations of (A) Pex1p mutations and full-length Pex6p or (B) Pex6p muta- tions and full-length Pex1p. The interactions were analyzed for b-ga- lactosidase activity by filter assays with X-gal as substrate and three independent double-transformations are shown. Fig. 3. Effects of point mutation of the WalkerA and B motifs of the ATP-binding sites on the complementation activity of Pex1p. Growth behaviour on oleic acid medium (YNO) was analyzed for wild-type, pex1D and pex1D expressing genes encoding wild-type or indicated point mutated Pex1p. Complementation is indicated by growth on YNO-agar plates, which gives rise to a typical halo reflecting the consumption of oleic acid. I. Birschmann et al. Domain function of Pex1p and Pex6p FEBS Journal 272 (2005) 47–58 ª 2004 FEBS 51 Discussion In this report, we demonstrate that the two AAA- peroxins Pex1p and Pex6p of Saccharomyces cerevisiae interact in vivo. We analyzed this interaction in more detail paying special attention to the cassette structure of the proteins. We assigned the binding sites of these two AAA-proteins to their different protein regions and elucidated the importance of ATP-binding to the two AAA-cassettes of Pex1p and Pex6p for their inter- action. The amino acid sequences of both peroxins sug- gest an architecture with three different regions: an N-terminal fragment (N) followed by two AAA-cas- settes (D1 and D2) [20]. Sequence comparison with other members of the large AAA-protein family shows that in both AAA-peroxins D2 is well conserved, while D1 exhibits much less sequence similarity. We have reported previously that ATP-binding by D2 but not D1 is strictly required for the overall function of Pex1p in peroxisome biogenesis. This conclusion was based on the analysis of functional consequences of muta- tions of the conserved lysine in WalkerA of both AAA-cassettes [35]. Our further analyses demonstrated that the same is true for Pex6p [27]. Additionally, point mutations in WalkerB of D2 in both AAA-peroxins AB DC EF Fig. 4. Effects of point mutation of the WalkerA and B motifs of the AAA-cassettes of Pex1p on the morphological appearance of peroxisomes. Morphological appearance of oleic acid-induced pex1D (B), and pex1D- cells, expressing genes coding for wild-type (A), Pex1pA1 (C), Pex1pB1 (D), Pex1pA2 (E) or Pex1pB2 (F). Bar, 1 lm; p, peroxisome; n, nucleus. Domain function of Pex1p and Pex6p I. Birschmann et al. 52 FEBS Journal 272 (2005) 47–58 ª 2004 FEBS indicate that not only ATP-binding but also ATP- hydrolysis catalyzed by the conserved AAA-cassettes of Pex1p as well as Pex6p is strictly required for peroxi- some biogenesis. The data presented here demonstrate the inverse importance of D1 and D2 in Pex1p and Pex6p for the interaction of these two proteins. While a fragment of Pex6p consisting of N and D1 alone exhibits signifi- cant binding properties for Pex1p, all three individual fragments of Pex6p (as well as any other combination of these) failed to do so. Moreover, our mapping experiments also underscored the importance of D1 in Pex1p for the binding of both AAA-peroxins. Also in this case none of the three fragments of Pex1p alone reacted with full length Pex6p. However both combi- nations, N + D1 and D1 + D2, which did interact with Pex6p, contained the less well conserved AAA- cassette (D1). These data together with coimmuno- precipitation analysis strongly suggest that in both AAA-peroxins, the actual binding is performed by D1. However two possibilities account for the observations: first, that the contact site between the two proteins is not limited to the first cassette but also comprises parts of the N-terminal fragment and ⁄ or the second cassette; AB DC EF Fig. 5. Effects of point mutation of the WalkerA and B motifs of the AAA-cassettes of Pex6p on the morphological appearance of peroxisomes. Wild-type (A), pex6D (B), and pex6D-cells, expressing genes coding for wild-type (C), Pex6pA1 (D), Pex6pA2 (E) or Pex6pB2 (F) are shown. Bar, 1 lm; p, peroxisome; n, nucleus. I. Birschmann et al. Domain function of Pex1p and Pex6p FEBS Journal 272 (2005) 47–58 ª 2004 FEBS 53 or second, that the contact site is contained within D1 but binding is enhanced via conformational changes in the presence of N or D2. In analogy to NSF (see below), the latter possibility seems to be more likely. The importance of the first cassette for the interaction is also supported by coimmunoprecipitation analysis with HsPex1p (from fibroblasts of individuals with wild-type PEX1 and of patients carrying PEX1 alleles mutated in D1) and HsPex6p, which show a lowered Pex6p binding to Pex1p mutated in D1 [39]. The strong contribution of the well conserved AAA-cas- sette (D2) of Pex1p to the strength of the interaction between Pex1p and Pex6p is also demonstrated by the fact that of all point mutations in either WalkerA or WalkerB motifs of the two AAA-peroxins, only the mutation A2 in Pex1p weakened this interaction. This in turn is in line with the previous observation that a distinct point mutation in the vicinity of the WalkerA motif in Pex1pD2 attenuates the interaction of both AAA-peroxins [23]. How can these different functional roles of D1 and D2 of both AAA-peroxins for peroxi- some biogenesis and interaction of the two proteins be explained? Our data demonstrate at the molecular level that Pex1p and Pex6p, despite their structural similar- ity, exhibit different functions. One possibility is that the binding of Pex1p to Pex6p is only one and may be the first step in the overall function of both peroxins in peroxisome biogenesis. This assumption is suppor- ted by structure–function analysis of NSF, another member of the AAA-protein family and within this family that most closely related to the two AAA- peroxins. NSF is an ATPase whose hydrolytic activity is essential for membrane fusion [19,40,41]. Similar to the two AAA-peroxins, NSF contains two AAA-cassettes of different degrees of conservation but compared with the AAA-peroxins in reverse order. In NSF, D2 is less conserved than D1, which is the well conserved cas- sette. NSF has been shown to form cylindrical homo- oligomeric complexes with a stacked ring structure [42]. Its less conserved cassette (D2) mediates oligo- merization [19,40]. D2 cassettes of NSF have a high affinity for each other and for ATP and form the sta- ble core of the NSF oligomer. In contrast, the well conserved cassette (D1) of NSF accounts for the majority if not all of the ATPase activity of the NSF oligomer and is critical for NSF function in the vesicu- lar transport process [40]. ATP-binding to D1 appears to induce a conformational change in NSF so that it is able to bind with its N-terminal region to the SNAP–SNARE complex [42]. As the ADP-bound form of NSF is unable to interact with this protein complex, ATP-hydrolysis in D1 leads to the disassem- bly of the NSF–SNAP–SNARE complex [40,43]. If one assumes that the two AAA-peroxins, in con- trast to NSF, do not form homo-oligomers but instead interact with each other, there is a functional analogy between these proteins. For both, NSF and Pex1p ⁄ Pex6p, the less conserved AAA-cassettes are crucial for oligomerization but not for overall function. The lat- ter, in turn, requires ATP-binding and ATPase activity of the well conserved cassettes. Moreover, just as in NSF, the N-terminal fragment of Pex6p apparently has a privotal role in converting the energy of ATP-hydrolysis into conformational changes. Recently, we showed that the N-terminal fragment of Pex6p binds in an ATP-dependent manner to Pex15p, a hitherto functionally uncharacterized peroxin of the peroxisomal membrane [27]. In analogy, it is tempting to speculate that a functionally import- ant binding partner should also exist for the N-ter- minal fragment of Pex1p. As a defect in the interaction of Pex1p and Pex6p is the most common cause for the peroxisomal biogenesis disorders [23,44] our data will contribute to the pathogenesis of these fatal diseases. Experimental procedures Strains and culture conditions The yeast strains used in this study were S. cerevisiae wild- type UTL-7A (MATa, ura3–52, trp1, leu2–3112) (W. Duntze, Ruhr University, Bochum, Germany) and its derivates pex1D [35] and pex6D [27]. Yeast strains used for two-hybrid experi- ments were PCY2 (MATa, gal4D, gal80D, URA3::GAL1- lacZ, lys2–801 amber ,his3-D200, trp1-D63, leu2 ade2–101 ochre ) [45] and its derivative pex15D (this study, primers KU718 ⁄ KU719). Deletion mutants were constructed using the kanMX marker according to [46]. Complete and minimal media used for yeast culturing have been described elsewhere [47]. YNDO medium contained 0.1% (w ⁄ v) oleic acid, 0.1% (w ⁄ v) glucose, 0.05% (v ⁄ v) Tween 40, 0.1% (w ⁄ v) yeast extract and 0.67% (w ⁄ v) yeast nitrogen base without amino acids, adjusted to pH 6.0. YNO medium contained the same components without glucose. The bacterial strain used for cloning was DH5a (recA, hsdR, supE, endA, gyrA96, thi-1, relA1, lacZ). Plasmids The primers used are listed in Table 1. The PEX1 open reading frame comprising the 5¢- and 3¢- flanking regions was subcloned from psk100 (HindIII ⁄ XhoI fragment from pRC111 [28]) into pRS416 using HindIII and XhoI as the restriction enzymes (pIB1 ⁄ 1). PEX1B1 was constructed by overlapping PCR of pIB1 ⁄ 1 with primers KU531 and KU532. The PCR product was digested with EcoRV ⁄ SpeI and ligated with EcoRV ⁄ XhoI and XhoI ⁄ SpeI Domain function of Pex1p and Pex6p I. Birschmann et al. 54 FEBS Journal 272 (2005) 47–58 ª 2004 FEBS fragments of pIB1 ⁄ 8 (construct of PEX1 in pET21d) to plasmid pIB1 ⁄ 7. A SauI ⁄ KpnI digested fragment from this plasmid containing the mutation and two fragments of pIB1 ⁄ 1(XhoI ⁄ KpnI and XhoI ⁄ SauI) were ligated to yield the final construct pIB1 ⁄ 10. PEX1B2 was introduced by overlapping PCR with primers KU473 and KU474 and digestion with XbaI and PstI. After ligation with Bam- HI ⁄ XbaI and PstI ⁄ BamHI fragments of psk100 and subse- quent digestion with BglI, it was cloned into pIB1 ⁄ 1, replacing the corresponding wild-type fragment. PEX1A1 (mut-1) and PEX1A2 (mut-2) have been described previ- ously by Krause et al. [35]. For two-hybrid studies, the PEX1 ORF was cloned into the transcription activation domain-containing plasmid pPC86 (pIB1 ⁄ 31) and the DNA binding domain-containing pPC97 (pBM5) [45]. The constructs were obtained by PCR using primers KU500 and KU143 (template pIB1 ⁄ 1) and cloned into vectors by primer-derived SalI ⁄ SacI sites. For construction of PEX1A1 and PEX1A2, SpeI ⁄ PstI fragments from plasmid mut-1 and mut-2 were used to replace the corresponding fragments of plasmid pIB1 ⁄ 31, resulting in plasmid pIB1 ⁄ 16 and pIB1 ⁄ 14. PEX1B1 (pIB1 ⁄ 12) was constructed by ligation of fragments derived from pIB1 ⁄ 7 (NsiI ⁄ EcoRI) and pIB1 ⁄ 31 (SalI ⁄ NsiI and SalI ⁄ EcoRI). For PEX1B2 (pIB1 ⁄ 15) construction, the ClaI ⁄ BglII frag- ment of plasmid pIB1 ⁄ 5 was used and ligated with SalI ⁄ ClaI and SalI ⁄ BamHI fragments of pIB1 ⁄ 31. Truncated versions of PEX1 were created as follows. The first cassette (D1, aa394–681) was amplified from pIB1 ⁄ 1 by PCR (pri- mers KU1234 and KU617) and subcloned into pPC97 by using the primer-derived SalI ⁄ NotI sites (pIB1 ⁄ 26). The corresponding construct in pPC86 was designed using restriction sites SalI ⁄ SacI (pIB1 ⁄ 32). The N-terminus (pIB1 ⁄ 25) (N, aa1–400) and the second cassette (pIB1 ⁄ 27) (D2, aa669–1043) of PEX1 were amplified from pIB1 ⁄ 1 using primers KU500 ⁄ KU1233 and KU1235 ⁄ KU143, respectively. Three further truncated versions of PEX1 were generated by combining the N-terminus and first cassette (pIB1 ⁄ 28), the N-terminus and second cassette (pIB1 ⁄ 29) and the first and second cassette (pIB1 ⁄ 30). Plasmid pIB1 ⁄ 28 was obtained by SpeI ⁄ BamHI digestion of plasmid pIB1 ⁄ 32 and ligation with the corresponding fragment of plasmid pIB1 ⁄ 31. For the construction of plasmid pIB1 ⁄ 29, the N-terminal part of PEX1 was amplified using primers KU500 and KU1236. The coding sequence for the second cassette was amplified using primers KU1237 and KU143. Subcloning of the two parts into the SalI ⁄ SpeI digested pPC86 was performed using SalI ⁄ BamHI (N-terminus) and BamHI ⁄ SpeI (D2). For plasmid pIB1 ⁄ 30 construction, the fragment of PEX1 was amplified using primers KU1234 and KU475 and ligated after digestion with SalI ⁄ PstIin pIB1 ⁄ 31. Pex1pD1-His 6 constructed for antibody produc- tion was obtained by PCR using primers KU616 and KU617 (template pIB1 ⁄ 1) and cloned into pET9dHis by NcoI ⁄ NotI sites derived from the primers. PEX6 ORF and PEX6 fragments have been described previously [27]. Strains in which the genomic copies of genes express pro- teins fused to ProteinA (ProtA) were produced by trans- forming haploid yeast cells with the PCR products according to Knop et al. [48]. Primers used were KU1009 ⁄ KU1010 for Pex1p-ProtA and KU1011 ⁄ KU1012 for Pex6p-ProtA. Constructs with Pex1pN(aa1–412)-ProtA, Pex1pN + D1(aa1–681)-ProtA, Pex6pN(aa1–428)-ProtA and Pex6pN + D1(aa1–716)-ProtA were amplified using primers KU1132 ⁄ KU1010, KU1133 ⁄ KU1010, KU1130 ⁄ KU1012 and KU1131 ⁄ KU1012, respectively. All point mutations generated were confirmed by DNA sequencing. Recombinant DNA techniques, including enzy- matic modification of DNA, fragment purification, bacterial Table 1 Primers used Primer Sequence (5¢)3¢) KU143 TCTAAGCTTGAGCTCTTTCACATAAGGGAGAGTCG KU473 CTGTATTCTATTTTTTCAAGAGTTCGATTCTATTG KU474 CAATAGAATCGAACTCTTGAAAAAATAGAATACAG KU475 CTTCTCTACGCCCGTGCTC KU500 GGAGGATCCGTCGACCATGACGACGACCAAGAG KU531 CCTTCTTTGATTGTGCTGCAGAACGTTGAGGCTCTATT TGG KU532 CCAAATAGAGCCTCAACGTTCTGCAGCACAATCAAAGA AGG KU616 CGGATCCATGGTTAAAGATATTATCGAAAGGCATTTGC KU617 CCGCATGCGGCCGCTCAAGATGGTGTAAACGCACTAA GCG KU718 CACTAGCAGAACGTACTACGGTGTGGTTTATACAAGAG GGTTCCAGCTGAAGCTTCGTACGCT KU719 GATGAAAAACCATTATGTATGTCATTAAAATAAGTAG GTAGGATAGGCCACTAGTGGATCTG KU1233 5¢-GGCGCCGAGCTCTCATTTACCCATTTGGGTTAC TTTC-3¢ KU1234 5¢-CCATGGAGGTCGACCGTAACCCAAATGGGTAAA GAAG-3¢ KU1235 5¢-CCATGGAGGTCGACCCTTTTTTCGAAGTCGCTT-3¢ KU1236 TCTAGAGGATCCGGTTACTTTCCATTGAACGG KU1237 GAATTCGGATCCCTTTTTTCGAAGTCGC KU1009 GCCCAATGGTGAGAATTCCATCGACATTGGTAGC CGACTCTCCCTTATGCGTACGCTGCAGGTCGAC KU1010 GCCCTTTAAAGGGAAACGCGCTTTGTTCTTTTCTTCT TCCTTTATCGATGAATTCGAGCTCG KU1011 GAATCATTATGAAGCGGTGAGAGCTAATTTTGAAGG TGCTCGTACGCTGCAGGTCGAC KU1012 TATTTACAAATTTACCTATACGCTCTGAGTTGATATTAC ATCGATGAATTCGAGCTCG KU1130 GCTAATAACAACTAATATCACTAACAGAAGACCATTAC CCCGTACGCTGCAGGTCGAC KU1131 GGAGGATTTATCAAAAGCTACTTCGAAAGCTAGGAACG AACGTACGCTGCAGGTCGAC KU1132 GGGTAAAGAAGAAGTTAAAGATATTATCGAAAGGCAT TTGCCTCGTACGCTGCAGGTCGAC KU1133 GGGAACTTTTTTCGAAGTCGCTTAGTGCGTTTACACCAT CTCGTACGCTGCAGGTCGAC I. Birschmann et al. Domain function of Pex1p and Pex6p FEBS Journal 272 (2005) 47–58 ª 2004 FEBS 55 transformation and plasmid isolation were performed as described previously [49,50]. Antibodies ⁄ Immunoblots Western blot analyses were performed according to stand- ard protocols [51]. Anti-rabbit and anti-(mouse IgG)- coupled HRP (Sigma-Aldrich, Germany) were used as secondary antibodies and blots were developed using the ECL system (Amersham Buchler GmbH & Co KG, Braunschweig, Germany). Rabbit polyclonal antibodies to Pex1pD1-His 6 were pro- duced by Eurogentec (Seraing, Belgium) according to standard methods [51]. Further polyclonal antibodies used were anti-Pex6p Ig [27], anti-GAL4-DBD Ig and anti- GAL4-TA Ig (Santa Cruz Biotechnology, Santa Cruz, CA, USA) and anti-(rabbit IgG) Ig fraction (Sigma-Aldrich, Taufkirchen, Germany). Two-hybrid analysis The applied two-hybrid assay was based on the described method by [52]. Cotransformation of two-hybrid vectors into the strain PCY2 was performed according to [53]. Transformed yeast cells were plated onto SD synthetic med- ium without tryptophane and leucine. b-Galactosidase filter assays were performed as described elsewhere [54]. Coimmunoprecipitation For immunoprecipitations, S. cerevisiae cells grown on YNBO were lysed according to Lamb et al. [55] using glass beads and lysis buffer (50 mm Tris ⁄ HCl pH 7.5, 50 mm NaCl) containing protease inhibitors (240 lgÆmL )1 phenyl- methanesulfonyl fluoride, 2 lgÆmL )1 aprotinin, 0.35 lgÆmL )1 bestatin, 1 lgÆmL )1 pepstatin, 2.5 lgÆmL )1 leupeptin, 0.1 6 mgÆ mL )1 benzamidin, 5 lg Æ mL )1 antipain, 0.21 mgÆmL )1 NaF, 6 lgÆmL )1 chymostatin). Cell debris was sedimented, and the supernatant was centrifuged at 100 000 g at 4 °C for 1 h (Hitachi, himac CP 56 GII rotor RP45AT). The derived sediment was resuspended in solubilization buffer [lysis buffer containing 1% (w ⁄ v) Digitonin (Calbiochem, Merck Biosciences, Darmstadt, Germany)] and incubated at 4 °C for 30 min. Solubilized extracts normalized for pro- tein and volume were added to magnetic beads (Dyna- beadsÒM-280, Dynal Hamburg, Germany), covered with anti-(rabbit IgG fraction) Ig and incubated at 4 °C for 1 h. After a repeated washing step with solubilization buffer, bound proteins were released by cooking the beads in SDS sample buffer. The immunoprecipitated proteins were analyzed for the presence of Pex1p and Pex6p by SDS ⁄ PAGE and immuno- blot analysis with antibodies against Pex1p, Pex6p and anti-(rabbit IgG). Microscopy Potassium permanganate fixation and preparation of intact yeast cells for electron microscopy were performed accord- ing to [47]. Acknowledgements We are indebted to Sigrid Wu ¨ thrich for technical help. This work was supported by the Deutsche Forschung- sgemeinschaft, SFB 642 (Teilprojekt A13). References 1 van den Bosch H, Schutgens RB, Wanders RJ & Tager JM (1992) Biochemistry of peroxisomes. Annu Rev Bio- chem 61, 157–197. 2 Eckert JH & Erdmann R (2003) Peroxisome biogenesis. Rev Physiol Biochem Pharmacol 147, 75–121. 3 Matsumoto N, Tamura S & Fujiki Y (2003) The patho- genic peroxin Pex26p recruits the Pex1p-Pex6p AAA ATPase complexes to peroxisomes. Nat Cell Biol 5, 454–460. 4 Rottensteiner H, Stein K, Sonnenhol E & Erdmann R (2003) Conserved function of pex11p and the novel pex25p and pex27p in peroxisome biogenesis. Mol Biol Cell 14, 4316–4328. 5 Vizeacoumar FJ, Torres-Guzman JC, Tam YY, Aitchi- son JD & Rachubinski RA (2003) YHR150w and YDR479c encode peroxisomal integral membrane pro- teins involved in the regulation of peroxisome number, size, and distribution in Saccharomyces cerevisiae. J Cell Biol 161, 321–332. 6 Vizeacoumar FJ, Torres-Guzman JC, Bouard D, Aitch- ison JD & Rachubinski RA (2004) Pex30p, Pex31p, and Pex32p form a family of peroxisomal integral membrane proteins regulating peroxisome size and number in Saccharomyces cerevisiae. Mol Biol Cell 15, 665–677. 7 Lazarow PB & Fujiki Y (1985) Biogenesis of peroxi- somes. Ann Rev Cell Biol 1, 489–530. 8 Titorenko VI & Rachubinski RA (2001) Dynamics of peroxisome assembly and function. Trends Cell Biol 11, 22–29. 9 Subramani S (2002) Hitchhiking fads en route to peroxi- somes. J Cell Biol 156, 415–417. 10 Dodt G & Gould SJ (1996) Multiple PEX genes are required for proper subcellular distribution and stability of Pex5p, the PTS1 receptor: Evidence that PTS1 pro- tein import is mediated by a cycling receptor. J Cell Biol 135, 1763–1774. 11 Gould SJ & Valle D (2000) Peroxisome biogenesis disorders: genetics and cell biology. Trends Genet 16, 340–345. Domain function of Pex1p and Pex6p I. Birschmann et al. 56 FEBS Journal 272 (2005) 47–58 ª 2004 FEBS [...]... peroxisome-associated AAA proteins that functionally and physically interact Yeast 15, 1059–1078 25 Whiteheart SW & Kubalek EW (1995) SNAPs and NSF: general members of the fusion apparatus Trends Cell Biol 5, 64–68 FEBS Journal 272 (2005) 47–58 ª 2004 FEBS Domain function of Pex1p and Pex6p 26 May AP, Whiteheart SW & Weis WI (2001) Unraveling the mechanism of the vesicle transport ATPase NSF, the N-ethylmaleimide-sensitive... Gould SJ (1998) Disruption of a PEX1–PEX6 interaction is the most common cause of the neurologic disorders Zellweger syndrome, neonatal adrenoleukodystrophy, and infantile Refsum disease Proc Natl Acad Sci USA 95, 8630–8635 24 Kiel JA, Hilbrands RE, van der Klei IJ, Rasmussen SW, Salomons FA, van der Heide M, Faber KN, Cregg JM & Veenhuis M (1999) Hansenula polymorpha Pex1p and Pex6p are peroxisome-associated... Leroy P, Nielsen PJ, Nishi K, Schnier J & Slonimski PP (1989) Birth of the D-E-A-D box Nature 337, 121–122 38 Hettema EH, Girzalsky W, van Den Berg M, Erdmann R & Distel B (2000) Saccharomyces cerevisiae Pex3p and Pex19p are required for proper localization and 57 Domain function of Pex1p and Pex6p 39 40 41 42 43 44 45 46 58 stability of peroxisomal membrane proteins EMBO J 19, 223–233 Tamura S, Matsumoto... W, Veenhuis M & Kunau WH (2001) Pex12p of Saccharomyces cerevisiae is a component of a multi-protein complex essential for peroxisomal matrix protein import Eur J Cell Biol 80, 257–270 34 Walker JE, Saraste M, Runswick MJ & Gay NJ (1982) Distantly related sequences in the alpha- and beta-subunits of ATP synthase, myosin, kinases and other ATPrequiring enzymes and a common nucleotide binding fold EMBO... Lazarow PB (2003) Peroxisome biogenesis: advances and conundrums Curr Opin Cell Biol 15, 489–497 13 Hazra PP, Suriapranata I, Snyder WB & Subramani S (2002) Peroxisome remnants in pex3delta cells and the requirement of Pex3p for interactions between the peroxisomal docking and translocation subcomplexes Traffic 3, 560–574 14 Agne B, Meindl NM, Niederhoff K, Einwachter H, Rehling P, Sickmann A, Meyer... Subramani S (1998) Two AAA family peroxins, PpPex1p and PpPex6p, interact with each other in an ATP-dependent manner and are associated with different subcellular membranous structures distinct from peroxisomes Mol Cell Biol 18, 936– 943 22 Tamura S, Shimozawa N, Suzuki Y, Tsukamoto T, Osumi T & Fujiki Y (1998) A cytoplasmic AAA family peroxin, Pex1p, interacts with Pex6p Biochem Biophys Res Commun 245, 883–886... relationships in peroxisome biogenesis disorders of PEX1-defective complementation group 1 are defined by Pex1p Pex6p interaction Biochem J 357, 417–426 Nagiec EE, Bernstein A & Whiteheart SW (1995) Each domain of the N-ethylmaleimide-sensitive fusion protein contributes to its transport activity J Biol Chem 270, 29182–29188 Hay JC & Scheller RH (1997) SNAREs and NSF in targeted membrane fusion Curr Opin... K, Kunau WH & Tabak HF (2003) Pex15p of Saccharomyces cerevisiae provides a molecular basis for recruitment of the AAA peroxin Pex6p to peroxisomal membranes Mol Biol Cell 14, 2226–2236 28 Erdmann R., Wiebel FF, Flessau A, Rytka J, Beyer A, Frohlich KU & Kunau W-H (1991) PAS1, a yeast gene ¨ required for peroxisome biogenesis, encodes a member of a novel family of putative ATPases Cell 64, 499–510... Bukau B (2002) AAA+ proteins and substrate recognition, it all depends on their partner in crime FEBS Lett 529, 6–10 19 Whiteheart SW, Rossnagel K, Buhrow SA, Brunner M, Jaenicke R & Rothman JE (1994) N-ethymaleimidesensitive fusion protein: a trimeric ATPase whose hydrolysis of ATP is required for membrane fusion J Cell Biol 126, 945–954 20 Beyer A (1997) Sequence analysis of the AAA protein family Protein... Jahn R & Heuser JE (1997) Structure and conformational chages in NSF and its membrane receptor complexes visualized by quick-freeze ⁄ deep-etch eletron mycroscopy Cell 90, 523–553 Steel GJ & Morgan A (1998) Selective stimulation of the D1 ATPase domain of N-ethylmaleimide-sensitive fusion protein (NSF) by soluble NSF attachment proteins FEBS Lett 423, 113–116 Poll -The BT, Gootjes J, Duran M, De Klerk . detailed functional analysis of their cassette structure and interaction. The interaction of Pex1p and Pex6p involves their first AAA-cassettes (D1) Pex1p and Pex6p. ATP-binding and -hydrolysis of Pex1p and Pex6p for their interaction. We show that the interaction of Pex1p and Pex6p involves their first AAA-cassettes and demonstrate