Functional analysis of the nuage, a unique germline organelle, in drosophila melanogaster 2

2 Materials and Methods 2.1 Molecular work 2.1.1 Recombinant DNA methods 2.1.1.1 Strains and culture conditions Escherichia coli strains DH5α or XL1-Blue was used for all recombinant DNA procedures unless otherwise stated. For the use of restriction endonucleases that are sensitive to dam methylation, a dam negative strain JM110 was used. For pENTR/DTOPO cloning, TOP10 E. coli (Invitrogen) was used. For protein expression in E. coli, BL21(DE3) was employed. All bacterial strains were cultured in Luria-Bertani [LB; 1% (w/v) bacto-tryptone, 0.5% (w/v) yeast extract, 1% (w/v) sodium chloride (NaCl)] broth or grown on agar plates at 37°C. For drug resistance selection, the culture media was supplemented with the antibiotics ampicillin (100 μg/ml), kanamycin (50 μg/ml), or chloroamphenicol (37 μg/ml). 2.1.1.2 Bacterial glycerol stocks A fresh colony was cultured in LB, supplemented with the respective antibiotics, by shaking at 250 revolutions per (rpm) at 37°C until the optical density (OD600) reached 0.8. Glycerol was added to a final concentration of 12% (v/v) on ice and the glycerol stock was stored at -80°C. 34 2.1.1.3 Plasmid DNA preparation For small-scale and large-scale plasmid DNA preparation, Geneaid High Speed Mini Kit and Geneaid Plasmid Maxi Kit were used in accordance to the manufacturer’s instructions, respectively. DNA concentration was determined using NanoDrop ND-1000 Spectrophotometer (BioFrontier Technology). 2.1.1.4 Polymerase Chain Reaction (PCR) Standard PCR and colony PCR were performed in the presence of 50 ng template DNA, 200 μM deoxynucleotide triphosphate (dNTP), 500 μM of each primer (forward and reverse), and 0.4 units (U) Taq polymerase (iDNA Biotechnology) with the cycling conditions: cycle of 94°C for min, 25-33 cycles of 94°C for 30 sec/55-62°C for 30 sec/72°C for per kb, 72°C for 10 min. For high fidelity amplification, either PfuUltra (Stratagene) or Pfx (Invitrogen) polymerase was used in accordance to the manufacturers’ instructions. All primer sequences can be found in Table IV. 2.1.1.5 Restriction digestion Digestion of plasmid DNA or dsDNA fragments was carried out using restriction endonucleases (Roche) in accordance to the manufacturer’s instructions. 2.1.1.6 Sequencing Standard cycling reaction was performed using BigDye Terminator v3.1Cycle Sequencing kit (Applied Biosystems) in the presence of 50-100 ng template DNA and 200 μM of each primer (forward or reverse) with the following conditions: 25 cycles of 35 94°C for min/50°C for 30 sec/60°C for min, 60°C for 10min. The reactions were then analysed on 3730x1 DNA Analyser (Applied Biosystems). 2.1.2 Bacterial transformation 2.1.2.1 Preparation of heat-shock competent cells E. coli cells were cultured in SOB [2% (w/v) bacto-tryptone, 0.5% (w/v) yeast extract, 10 mM NaCl, 2.5 mM potassium chloride (KCl), 10 mM magnesium chloride (MgCl2), 10 mM magnesium sulphate (MgSO4)] at 37°C until the OD600 reached 0.6. The cells were then chilled on ice for 10 and harvested by spinning at 3000 rpm at 4°C. The pellet was resuspended in TB media [10 mM 1,4-Piperazinediethanesulfonic acid, Piperazine1,4-bis(2-ethanesulfonic acid), Piperazine-N,N′-bis(2-ethanesulfonic acid (PIPES), 55 mM manganese chloride (MnCl2), 15 mM calcium chloride (CaCl2), 250 mM KCl] and incubated on ice for 10 min. The cell suspension was centrifuged and fresh TB was added to the bacterial pellet. The cells were used directly for transformation or alternatively, stored for long-term in 7% (v/v) dimethyl sulfoxide (DMSO) at -80°C. 2.1.2.2 Preparation of electrocompetent cells E. coli cells were cultured in LB broth at 37°C until the OD600 reached 0.5-0.7. The cells were then chilled on ice for 10-15 and harvested by spinning at 4200 rpm at 4°C. Following two resuspensions in ice-cold water, the cells were ready for electroporation. Electrocompetent cells were stored for long-term in 10% (v/v) glycerol at -80°C. 36 2.1.2.3 Transformation For heat-shock transformation, competent cells were mixed with an appropriate volume of DNA and incubated on ice for 30 min. The DNA/cell mixture was then heat-shocked at 42°C for 60 sec and immediately placed on ice. For electroporation, competent cells were mixed with an appropriate volume of DNA and transferred to a pre-chilled electrocuvette on ice. The DNA/cell mix was pulsed once at 2.5 kilovolts (kV) and 25 microfarad (μF), and immediately placed on ice. Following either transformation, ml of LB was added to each mixture and mixed gently before incubating the culture at 37°C, with shaking at 250 rpm for hr to allow for plasmid expression. The cells were then plated on LB agar supplemented with the respective antibiotics, depending on the plasmids. 2.1.3 Cloning strategies and constructs 2.1.3.1 Conventional cloning Restriction digests of vector DNA and PCR fragments were performed in accordance to the manufacturers’ instructions. To dephosphorylate the 5’- end of the digested vector DNA, U of calf intestinal phosphatase (Roche) was added to the restriction digest and incubated at 37°C for 60 min. To fill the 3’- end of staggered DNA, U of Klenow enzyme (Roche) and U of polynucleotide kinase (Roche) was added to the digested DNA and incubated at 37°C for 20 min, in the presence of 20 pmol adenosine triphosphate (ATP) and 250 μM dNTP. Ligation was set up with a vector:insert molar ratio of 3:1, in the presence of U T4 DNA ligase (Roche). Sticky-end and blunt-end 37 ligations were incubated at 16°C and room temperature, respectively for up to 16 hr. Half the ligation volume was then used for bacterial transformation. 2.1.3.2 Gateway® cloning Gateway® cloning is a two-step procedure, which comprises of a directional TOPO cloning of the gene-of-interest or DNA fragment into pENTR™/D-TOPO® (Appendix II, Invitrogen), followed by a site-specific recombination step to swap the DNA from pENTR™/D-TOPO® into the destination vectors (Appendix III, The Drosophila Gateway™ Vector Collection, . For TOPO cloning, PCR product with a flanking CACC sequence at the 5’- end and a blunt 3’- end was mixed with pENTR™/D-TOPO® in a molar ratio of 2:1, and incubated at room temperature for 30 min. Half the ligation mixture was then transformed into OneShot® TOP10 chemically competent E. coli (Invitrogen) in accordance to the manufacturer’s instructions. For site-specific recombination, equal volumes of pENTR™/D-TOPO® harbouring the gene-of-interest or DNA fragment and the Gateway® destination vectors were mixed, in the presence of LR Clonase™ II enzyme mix (Invitrogen). The DNA/enzyme mix was incubated at 25°C for hr to promote recombination. The reaction was subsequently terminated by adding Proteinase K and incubating at 37°C for 20 min. One-half of the reaction mix was used for transformation. 38 2.1.3.3 TA cloning PCR products that were amplified using Taq polymerase were used directly for TA cloning. For blunt-ended PCR products, A-tailing was performed by incubating the purified DNA duplex with 0.2 mM dATP and U Taq polymerase at 70°C for 30 min. For TA cloning, pGEM®-T Easy vector (Promega) and insert DNA were mixed in the molar ratio 1:3 and incubated for 60 at room temperature or overnight at 4°C (up to 16 hr). One-half of the ligation mix was then used for transformation. Recombinant clones were identified using the blue-white selection, where the presence of an insert in pGEM®-T Easy vector disrupts the ß-galactosidase gene and produces white bacterial colonies. 5-bromo-4-chloro-3-indolyl-β-D-galactoside (X-Gal) and isopropyl β-D-1thiogalactopyranoside (IPTG) were added as substrates, and to a final concentration of 0.5 mM and 80 μg/ml, respectively. 2.1.4 Single-fly PCR 2.1.4.1 Preparation of fly genomic DNA D. melanogaster genomic DNA was prepared by mashing a single fly in 50 μl squishing buffer [10 mM Tris-Cl pH 8.2, mM ethylenediaminetetraacetic acid (EDTA), 25 mM NaCl, and 200 pg/ml freshly diluted Proteinase K (Sigma)] with a pipette tip (Gloor and Engels, 1992; Gloor et al., 1993). The squished fly was subsequently incubated at 37°C for 20-30 min, followed by a heat-inactivation step at 65°C for 10 min. Single fly genomic DNA preps were stored at 4°C or -20°C. 39 2.1.4.2 Genomic DNA PCR Genomic DNA PCR was performed as described in 2.1.1.4. μl of genomic DNA was used per PCR. 2.1.5 Total RNA extraction Ovaries were dissected in cold Grace’s medium and transferred to TRIzol reagent (Invitrogen) on ice. Total RNA was extracted from the ovaries in accordance to the manufacturer’s instructions. Extracted total RNA was reconstituted to a final concentration of approximately 2-3 μg/μl and stored at -80°C. 2.1.6 Poly A+ RNA purification Total RNA extracted from at least 50 ovaries was used for poly A+ RNA purification using the Oligotex mRNA kit (QIAgen) in accordance to the manufacturer’s instructions. 2.1.7 DNase treatment DNase treatment was performed by incubating total RNA with DNaseI (Roche) at room temperature for up to 15 min. U of DNaseI was used per μg total RNA. Following treatment, DNaseI was heat-inactivated by adding EDTA pH 8.0 to a final concentration of 2.5 mM and incubating the samples at 65°C for 10 min. 2.1.8 Reverse transcription (RT) µg of DNase-treated total RNA was reverse-transcribed using oligo(dT)15 and Superscript III reverse transcriptase (Invitrogen). A mock reaction without reverse 40 transcriptase was also prepared for each RNA sample. The newly-synthesized complementary DNAs (cDNAs), following treatment with RNaseH (Stratagene), were first normalised and checked for genomic DNA contamination by performing PCR with actin5C (act5C) or alcohol dehydrogenase (adh) primers. 2.1.9 Semi-quantitative and quantitative PCR Semi-quantitative PCR was performed as described in 2.1.1.4 using µl per cDNA sample/reaction. Quantitative PCR was similarly carried out, except with a change to the use of Bio-Rad MyQ™ Single-Colour Real-Time PCR Detection System, in the presence of iQ™ SYBR® Green Supermix (Bio-Rad). Control experiments measuring the change in CT with template dilution were performed on the target genes and the control act5C. All the results were normalised with respect to act5C. P-values were measured using onetailed student T-test. All primer sequences can be found in Table IV. 2.1.10 Poly(A) tail test (PAT) 2.1.10.1 Rapid Amplification of cDNA Ends-PAT (RACE-PAT) 1-3 µg of DNase-treated ovarian total RNA was reverse-transcribed using oligo(dT)anchor and Avian myeloblastosis virus (AMV) Reverse Transcriptase (Promega, (Salles et al., 1999). A mock reaction without reverse transcriptase was prepared for each RNA sample. The newly synthesized cDNAs were checked for genomic DNA contamination by PCR with act5C primers. PCR was subsequently performed using µl diluted or neat cDNA sample/reaction as described in 2.1.1.4. For analyses of retroelement de-repression, primer sets corresponding to act5C and HeT-A untranslated regions (UTRs), coding 41 sequence (CDS), and poly(A) regions were used. All primer sequences can be found in Table IV. 2.1.10.2 Ligation-mediated PAT (LM-PAT) µg of total RNA from ovaries from each sample was treated with DNaseI as described in 2.1.7. LM-PAT assay was performed as described in (Salles et al., 1999). Amplified products were visualised on 3% (w/v) agarose/1x Tris Boric EDTA gel. All primer sequences can be found in 2.6. 2.1.11 Decapping assay Total RNA from ovaries (100 ng) was incubated with Terminator™ 5’-phosphatedependent exonuclease (1 U, Epicentre) in a 10 μl-reaction at 30°C for hrs. Reactions were terminated by adding 0.5 μl of 100 mM EDTA pH 8.0. To check levels of cyclin B (cycB) and U1 expression, one-step RT-PCR was performed using diluted or neat total RNA according to manufacturer’s instructions (Invitrogen). All primer sequences can be found in Table IV. 2.2 Fly genetics 2.2.1 Fly husbandry and stocks D. melanogaster were cultured on standard cornmeal-agar medium at 25°C. For ovary staining, y w was used as a wild-type control unless otherwise stated. FM6, sco/CyO and TM3/TM6B were used as first, second, and third chromosome balancers, respectively. Mutant alleles and allelic combinations used were vasPH165 (Styhler et al., 1998), 42 krimpf06583 (Bloomington Drosophila Stock Center), krimpf06583/Df(2R)Exel6063 (Bloomington Drosophila Stock Center), aubN11/HN2(Schupbach and Wieschaus, 1991; Wilson et al., 1996), maelM391/Df(3L)79E-F (Clegg et al., 1997; Hartenstein and Jan, 1992), spn-E616/hls3987 (Gillespie and Berg, 1995; Gonzalez-Reyes et al., 1997), dcr2L811fsX (Hatfield et al., 2005), armiKG04664 (Bloomington Drosophila Stock Center), b53; T3 (an insertion mutant for dcp1 that harbours a rescue transgene for a neighbouring gene, CG5602; (Lin et al., 2006), twinKG00877/Df(3R)crb-F89-4 (Bloomington Drosophila Stock Center), ski3f03251/Df(2R)Np5 (Bloomington Drosophila Stock Center), and pcm∆1 (Appendix I). As homozygous dcr-1Q1147x is lethal, mitotic clones were generated by subjecting 2-day old female flies [hsFLP/eyFLP;FRT82BUbi- green fluorescence protein (GFP)/FRT82Bdcr-1Q1147x] to heat-shock at 37°C for 1.5 hr. The treated flies were then aged for to 10 days prior to immunostaining. Me31B-GFP and Protein disulfide isomerase (PDI)-GFP fly lines were obtained from Carnegie Protein Trap Library (Buszczak et al., 2007). Flies carrying the transgene, UASp-aub-GFP (Harris and Macdonald, 2001), UASp-dcp1-Haemagglutinin (HA) (Lin et al., 2006), UASp-krimpVenus[Yellow fluorescence protein (YFP)] or UASp-krimp(variants)-MYC were crossed to flies harbouring the nosgal4VP16 transgene to drive the expression of tagged proteins in the female germline (Van Doren et al., 1998). For ms2/MS2 Coat Protein (MCP) labeling of the retroelement transcripts, flies carrying UASp-hs-HeT-A-(ms2)6, UASp-hsI-element-(ms2)6 or the control UASp-hs-nanos(nos)-(ms2)6 were crossed to those expressing MCP-GFP (Forrest and Gavis, 2003) and the F1 progenies were subjected to a heat-shock treatment to induce gene expression (see 2.5). 43 2.2.2 Generation and clean-up of mutant alleles pcm loss-of-function allele was generated by standard imprecise excision (Bachmann and Knust, 2008; O'Connor and Chia, 2002) of the P-element insertion EP1526 (Bloomington Stock Center), a homozygous viable DNA element that was inserted 584 nt downstream of the polyadenylation site. EP1526 was mobilised by crossing virgin females that carried this insertion to males that possessed the ∆2-3 transposae (Bloomington Stock Center). More than 100 independent excision lines were screened for the deletion of pcm CDS using single-fly PCR (described in 2.1.4.2 and Appendix I). The original krimpf06583 and ski3f03251mutant lines from the Stock Center exhibited male sterility and lethality, respectively due to background mutations. Both fly stocks were cleaned up by backcrossing to y w prior to the use of these alleles for all the experiments described. 2.2.3 Generation of transgenic flies by microinjection hr old y w embryos were collected on cornmeal-agar plates and dechlorionated in 50% (v/v) chlorox for min. Dechlorionated embryos were washed extensively with deionised water, aligned on a nitrocellulose membrane and then adhered onto a coverslip. The embryos were dried in silica gel for approximately 12-15 and covered with a thin layer of halocarbon oil. Plasmid DNA and helper DNA were injected manually under the microscope at a concentration of 100 ng/μl and the embryos were allowed to hatch in a wet chamber. The emerged flies were crossed to sco/CyO or TM3/TM6B balancer flies. Transgenic flies were identified by the orange eye colour in the F1 progenies. 44 Transgenes that were microinjected include UASp-krimp full length (FL)-Venus, UASpkrimp N-terminus (NT)-MYC, UASp-krimp C-terminus (CT)-MYC, UASp-ago3FL-HA, pCaSpeR-hs-HeT-A-(ms2)6, and pCaSpeR-hs-I-element-(ms2)6. For the construction of UASp-krimp(variants)-Venus/MYC and UASp-ago3FL-HA, expressed sequence tag (EST) clones RE66405 and LD17152 were used as templates, respectively. The PCR products were cloned into pENTR™/D-TOPO® (Invitrogen) and recombined into the destination vectors pPVW, pPMW, and pPHW using Gateway® technology (see 2.1.3.2). The construction of pCaSpeR-hs-HeT-A-(ms2)6 and pCaSpeR-hs-I-element-(ms2)6 are described in 2.5.1. All primer sequences can be found in Table IV. 2.3 Immunohistochemistry and Microscopy 2.3.1 Antibody staining of fixed ovaries Ovaries were dissected in Grace’s medium (BioWhittaker) and immediately fixed for at room temperature in the fixative solution (2 parts of Grace’s medium to part of 16% paraformaldehyde, electron microscopy grade). After several washes with PBX {PBS [10 mM sodium phosphate monobasic (NaH2PO4)/sodium phosphate dibasic (Na2HPO4) pH 7.4, 175 mM NaCl] containing 0.1% Triton X-100}, the fixed ovaries were pre-absorbed in PBX containing 5% normal goat serum (The Jackson Laboratory) for at least 30 at room temperature. The ovaries were then rinsed twice with PBX and incubated with the primary antibodies diluted in PBX containing 0.5% (w/v) bovine serum albumin (BSA, Sigma) for hr at room temperature or overnight at 4°C. After several washes in PBX, the ovaries were incubated in secondary antibodies diluted in 45 PBX containing 0.5% (w/v) BSA for hr at room temperature. The ovaries were further washed in PBX and stained with 4’,6-diamidino-2-phenylindole (DAPI). Following two rinses with PBS, the ovaries were mounted in Vectashield (Vector Laboratories). Antibodies that were used for immunostaining are summarised in Table II. Alexa Fluor (488, 555 or 633) conjugated goat anti-mouse, anti-rat, anti-rabbit, and anti-guinea pig (1:400, Molecular Probes Invitrogen) were used as secondary antibodies. Table II Antibodies for immunohistochemistry Protein AGO3 ARF6 Animal origin mouse mouse (3A-1) Working dilution 1:200 1:50 AUB rabbit 1:1000 C(3)G CD63 GRK dDCP1 dDCP2 guinea pig mouse mouse (1D12) rabbit rabbit mouse (3E6) 1:500 1:5 1:10 1:20 1:200 1:200 rabbit 1:1000 1:1000 1:200 1:10 000 MAEL mouse rat rabbit mouse (GL2A7) rabbit Me31B mouse 1:500 MYC mouse (9E10) 1:1000 OSK rat 1:100 GFP HA KRIMP LAMP2 Source(s) inhouse Santa Cruz Biotechnology A gift from Hong Han, McGill University, Montreal, Quebec, Canada (Page and Hawley, 2001) ID Laboroatory (Queenan et al., 1999) (Lin et al., 2006) Invitrogen Torrey Pines Biolabs, Houston, TX BEAM-ETC inhouse 1:5 Cayman Chemical 1:200 (Findley et al., 2003) A gift from Akira Nakamura, RIKEN Center for Developmental Biology, Kobe, Osaka, Japan Sigma A gift from Paul Lasko, McGill University, Montreal, Quebec, 46 PCM rabbit 1:600 TER94 mouse 1:50 VAS rat rabbit 1:200 1:500 2.3.2 Canada (Barbee et al., 2006) A gift from JimWilhelm, University of California, San Diego, La Jolla, CA A gift from Paul Lasko piRNA Fluorescence in situ Hybridisation (FISH) 2.3.2.1 In vitro transcription of RNA probes Digoxygenin (DIG)-labeled RNA probes were transcribed using double-stranded DNA harbouring a T7 promoter and the antisense HeT-A piRNA or 2S ribosomal RNA (rRNA) sequence (Table IV) at 37°C for hr. The reaction was terminated by incubating at 65°C for 10 following the addition of EDTA pH 8.0 to a final concentration of 2.5 mM. Synthesized RNA probes were stored at -20°C for up to a week. 2.3.2.2 FISH Ovaries were dissected and fixed as described in 2.3.1. Fixed ovaries were washed in PBS containing 0.1% (v/v) Tween-20 and hybridised at 42°C overnight in Hyb buffer [0.5 μg/μl yeast transfer RNA, 50% (w/v) dextran sulphate, 100 mM PIPES pH 8.0, 10 mM EDTA pH 8.0, M NaCl; (Pontes et al., 2006)] containing μg of denatured RNA probes. Ovaries were washed sequentially in 2x SSC (150 mM NaCl, 150mM sodium citrate)/50% (v/v) formamide, 1x SSC/50% (v/v) formamide, 1x SSC and PBX for 10 each. DIG-labeled RNA probes were detected using anti-DIG horseradish peroxidase (POD) antibody (1:100, Roche) with fluorescence amplification for 1-1.5 hr at room temperature (Tyramide Signal Amplification kit, Perkin Elmer). 47 2.3.3 Microscopy and image processing Images were captured at room temperature with a 3-Photomultiplier Tube detector using a 40x or 63x 1.3 NA Plan-Apochromat oil objective in an upright confocal microscope (EXCITER or LSM510; Carl Zeiss, Inc.) controlled by LSM program software. For quantification of cytoplasmic nuage and P-body overlaps in Figure 3.3.3a, single confocal sections of stage 5-7 egg chambers were counted manually. At least egg chambers from different ovarioles were scored for each nuage/P-body combination. For AUB, which exhibited fewer cytoplasmic foci, 5-8 egg chambers were scored. All images were processed with Adobe Photoshop CS3. 2.4 Biochemistry 2.4.1 Recombinant protein expression and purification krimp (163rd to 306th and 461st to 540th amino acids ), ski3 (1131st to 1233rd amino acids), and ago3 (78th to 252nd amino acids) antigen sequences were amplified with EST clones RE66405, LP07472, and LD17152, respectively. All primer sequences can be found in Table IV. Antigen sequences were cloned into pENTR™/D-TOPO (Invitrogen) and recombined into pDEST15 GST and/or pDEST17 HIS (Invitrogen) in accordance to the manufacturer’s instruction manual (2.1.3.2). For protein expression, each construct was transformed into the bacterial strain BL21(DE3). A fresh colony was then picked and cultured in LB in the absence of antibiotics at 37°C, shaking at 250 rpm until the OD600 reached 0.6. The expression of each fusion protein was induced by adding IPTG to a final concentration of 0.4 mM and 48 the cells were cultured for another 3-4 hr. The cells were then harvested by centrifugation at 2000 rpm for 20 at 4°C. To prepare the cell lysate, the cell pellet was resuspended on ice with ml lysis buffer (20 mM sodium phosphate pH 7.4, 0.5 M NaCl, mg/ml lysozyme), supplemented with 400 pmol phenylmethylsulphonyl fluoride (PMSF) per gram of cell pellet. The resuspended cells were lysed by subjecting the cell suspension to four times of minsonication/1 min-interval at an output of 20-30 watts on ice. The cell debris was removed by centrifugation at 10 000xg for 30 at 4°C. GST- and HIS-tagged fusion proteins were purified from the supernatant using Glutathione Sepharose High Performance and Ni Sepharose High Performance (Amersham Biosciences), respectively in accordance to the manufacturer’s instructions. Purified recombinant proteins were stored at -20°C. 2.4.2 Antibody generation and affinity purification The GST fusion proteins were used for antibody generation in mice for AGO3 and in rats for KRIMP antigen (Ag) 461 and SKI3. KRIMP Ag163 was sent to Zymed Laboratories Inc. (South San Francisco, USA) for antibody generation in rabbits. For immunisation, antigens were mixed with complete or incomplete Freund’s adjuvant (Pierce) and vortexed vigorously for 60 at 4°C to form emulsions. For each injection, 0.1 mg, 0.2 mg, and 0.25 mg of antigen/adjuvant emulsions were respectively administered intramuscularly and/or intraperitoneally to mice, rats, and rabbits. Six rounds of 49 immunisation were usually performed per antigen. The animals were bled in accordance to standard animal handling procedures. To prepare the anti-serum, the bleeds were first left at room temperature for 30 to deactivate the complement and subsequently, overnight at 4°C to allow clotting. To separate the serum, the bleeds were centrifuged at maximum speed for 30 at 4°C. Glycerol and sodium azide were added to final concentrations of 50% (v/v) and 0.1% (w/v), respectively and the anti-serum was kept at -20°C or -80°C. KRIMP Ag163 rabbit polyclonal antibodies were affinity purified using HIS-tagged KRIMP fusion protein conjugated to a HiTrap NHS-activated HP affinity column (Amersham Biosciences) and Bio-Rad Low Pressure Chromatography System in accordance to the manufacturer’s instructions. KRIMP Ag163 rabbit polyclonal antibodies were collected in fractions eluted with 0.2 M glycine-hydrochloric acid (HCl). Eluted antibodies were concentrated by dialysing in 50% (v/v) glycerol/PBS overnight at 4°C. Sodium azide was added to a final concentration of 0.1% (w/v) and the anti-serum was stored in aliquots at -80°C. 2.4.3 Immunological detection of proteins Bacterial cells were lysed in 2x sample buffer [4% (w/v) sodium dodecyl sulphate (SDS), 200 mM dithiothreithol (DTT), 300 mM Tris-HCl pH 6.8, 20% (v/v) glygerol, 0.04% (w/v) bromophenol blue] by vortexing at high speed for 1-2 and then boiling for min. Ovary lysates were prepared as described in (Drummond-Barbosa and Spradling, 50 2004). For both bacterial and ovary cell lysates, the cell debris was removed by centrifugation at maximum speed for 20 at 4°C. The supernatants were stored at 20°C or -80°C. Proteins were separated on 8-12% (v/v) polyacrylamide gels [8-12% (v/v) acrylamide/bis-acrylamide (29:1, Bio-Rad), 375 mM Tris-HCl pH 8.8, 0.1% (v/v) SDS, 0.1% (w/v) ammonium persulphate (APS), 0.4% (v/v) N,N,N',N'- Tetramethylethylenediamine (TEMED)] using a Bio-Rad gel electrophoresis system at 100 V. For direct visualisation of proteins on the gels, the gels were stained with coomassie brilliant blue staining buffer [0.0025% (w/v) coomassie brilliant blue R250 in part glacial acetic acid: parts of 50% (v/v) methanol]. For immunological detection, the proteins were first transferred by electrophoretic blotting onto nitrocellulose or polyvinylidene fluoride (PVDF) membrane (Bio-Rad) in the transfer buffer [3.03 g/L Tris-base, 14.4 g/L glycine, 20% (v/v) methanol] at 100 V for 60 min. Blocking was performed in 5% (w/v) skimmed milk in Tris buffered saline (20 mM Tris, 150 mM NaCl, pH 7.5) containing 0.05% (v/v) Tween-20 (TBST) for at least 30 at room temperature. The membrane was subsequently incubated in the primary antibody solution [5% (w/v) BSA in TBST] at 4°C overnight or for 60 at room temperature, followed by six vigorous washes with TBST for 10 each. The secondary antibody step was performed in TBST for 45 at room temperature and washes were similarly carried out. Detection was performed with SuperSignal® West Pico Chemiluminenscence substrate (Thermo Scientific) and the signals were visualised on Kodak BioMax MS film. 51 Antibodies that were used for immunoblotting are summarised in Table III. Detection was performed using rabbit-, rat-, and mouse-conjugated HRP (1:6000-1:10 000, BioRad). Table III Antibodies for immunoblotting Protein Animal origin Working dilution ACT mouse (JLA20) 1:500 dDCP1 GFP HA rabbit rabbit mouse 1:1000 1:2500 1:1500 Me31B mouse 1:2500 MYC PCM SKI3 mouse (9E10) rabbit rat 1:5000 1:2000 1:500 2.4.4 Source(s) Developmental Studies Hybridoma Bank, The University of Iowa (Lin et al., 2006) BD Biosciences BEAM-ETC A gift from Akira Nakamura, RIKEN Center for Developmental Biology, Kobe, Osaka, Japan Sigma (Barbee et al., 2006) inhouse Co-immunoprecipitation (co-IP) of protein complexes 2.4.4.1 In vivo co-IP For one co-IP, 150-200 ovaries were dissected in ice-cold Grace’s medium. The dissected ovaries were homogenised in 250 μl lysis buffer [150 mM NaCl, 50 mM Tris pH 8.0, 0.05% (v/v) Nonidet P-40 (NP-40), 100 U RNase inhibitor, Complete® EDTA-free protease inhibitor (Roche)] on ice. The cell debris was removed by centrifuging at 14 000 rpm for 20 at 4°C. The supernatant was then pre-absorbed with equilibrated Protein A/G beads (Calbiochem) and immunoglobulin G (IgG)-coupled beads for 60 each at 4°C. Co-IP was performed overnight at 4°C with guinea pig anti-GFP (1:200, gift from Mohan Balasubramanian, Temasek Life Sciences Laboratory, Singapore)- or mouse anti52 HA (BEAM-ETC)- coupled Protein A/G beads. Following co-IP, the beads were rinsed five times with the wash buffer [150 mM NaCl, 50 mM Tris pH 8.0, 0.05% (v/v) NP-40] to remove unbound proteins. To minimise the elution of IgG, 24 μl of 2x sample buffer lacking DTT was first added to each sample, followed by an incubation at 70°C for min. The beads were then collected by spinning at 12 000 rpm for at 4°C. μl of M DTT was added to the eluate, mixed, and boiled for before loading onto the polyacrylamide gel. Immunological detection was subsequently performed as described in 2.4.3. 2.4.4.2 In vitro co-IP Full-length krimp, aub, cuff, ago3, and mael were amplified using the EST clones RE64405, LD23107, IP10749, LD17152, and LD20229 as templates, respectively, and cloned into pGBKT7-MYC or pGADT7-HA (Invitrogen). All primer sequences can be found in Table IV. 3-4 μg template DNA was in vitro transcribed and translated using TNT® rabbit reticulocyte lysate system (Promega) by incubating at 25°C for hr. The lysate containing the translated fusion proteins were used directly for co-IP. Preabsorption and co-IP were performed as described in 2.4.4.1. 2.4.5 Northern analyses of transcripts and piRNAs Total RNA was used directly for polyacrylamide gel electrophoresis (PAGE) northern of piRNAs, northern analysis of retroelement transcripts, RT-PCR, decapping, and PAT assays. For northern analysis of krimp transcript, polyA+ RNA purified from ovaries were used. 53 For northern analysis of transcripts, DIG DNA probes were synthesized by PCR in the presence of 1x DIG DNA labeling mix (Roche) or by random priming with the High Prime DNA Labeling Kit (Roche). The EST clone RE66405, pBluescript rp49, amplified full-length gapdh, pGEM-T Easy ms2, pCaSpeR-hs-HeT-A-(ms2)6, and pCaSpeR-hs-Ielement-(ms2)6 were used as templates to synthesize probes for detecting krimp, rp49, gapdh, ms2, HeT-A, and I-element, respectively. All primer sequences can be found in Table IV. 200 ng polyA+ RNA or μg total RNA were loaded and separated in a formaldehyde/MOPS 1% (w/v) agarose gel, transferred onto a Hybond N+ nylon membrane (Amersham Biosciences) and then cross-linked. Hybridisation was performed at 45°C in DIG Easy Hyb buffer and detection was carried out according to the manufacturer’s instructions (Roche). The signals were visualised on Kodak BioMax MS film. For stripping, the blots were incubated with boiling 0.5% (v/v) SDS. rRNA was visualised using 0.02% (w/v) methylene blue in 0.3 M sodium acetate pH 5.2. For radioactive PAGE northern analysis of the piRNAs, RNA probes were synthesized from the linearised templates by in vitro transcription using either T7 or SP6 RNA polymerase (Roche), in the presence of [γ-32P] UTP (3000 Ci/mmol, 10 mCi/ml). Templates were pGEM-T harboring PCR product amplified with primer sets corresponding to roo, I-element, and HeT-A (Table IV). 10 µg or 20 µg of total RNA from the ovaries were separated on a 15% polyacrylamide/8 M urea denaturing gel, transferred onto a Hybond N+ Nylon membrane (Amersham Biosciences) and crosslinked. Hybridisation was performed at 62°C in Church buffer [0.25 M sodium phosphate 54 pH 7.2, mM EDTA pH 8.0, 7% (w/v) SDS, 1% (w/v) BSA], containing radio-labeled sense roo, I-element or HeT-A RNA probes. The membranes were analysed by Typhoon 9200 (Amersham Biosciences). For non-radioactive PAGE northern analysis of piRNAs, all steps were similarly performed with changes to the use of 1x DIG RNA labeling mix for probe synthesis, DIG Easy Hyb buffer for hybridisation, and anti-DIG alkaline phosphatase for detection. 2.5 ms2/MCP-GFP labeling system of mRNAs 2.5.1 ms2/MCP-GFP labeling of retroelement transcripts HeT-A or I-element genomic sequences and six tandem stem-loop binding sites for MCP were amplified using y w genomic DNA and pSL-ms2-6 (Bertrand et al., 1998) as templates, respectively. All primer sequences are provided in Table IV. Amplified HeT-A was digested with XbaI and BglII and cloned into pCaSpeR-hs. Amplified I-element was cloned into pGEM-T Easy, digested with NotI, and recloned into pCaSpeR-hs. pGEM-T Easy harbouring six copies of MCP binding sites was digested with EcoRI, blunted with Klenow fragment, and ligated into the StuI site of pCaSpeR-hs HeT-A and the blunted XbaI site of pCaSpeR-hs I-element, respectively. These plasmids were microinjected into y w embryos as described in 2.2.3. 2.5.2 Visualisation of artificial retroelement transcripts The transgenes HeT-A-(ms2)6, I-element-(ms2)6 or the control nos-(ms2)6, and MCP-GFP (Forrest and Gavis, 2003) were co-expressed in aub or krimp control and mutants by 55 subjecting female flies to a heat-shock regimen of 1.5hr at 36°C every 12 hrs for a duration of 1.5 days. Immunostaining was performed days after heat-shock. 2.5.3 Timecourse (pulse-chase) of artificial HeT-A transcript aub control and mutant flies harbouring HeT-A-(ms2)6 were subjected to hr of heatshock at 36°C. Ovaries were dissected in cold Grace’s medium at 0, 20, 40, 60, 80, 100, 120 min, hr and 12 hr post heat-shock termination and immediately frozen in TRIzol reagent (Invitrogen) at -80°C until RNA extraction. Northern blotting was performed as described in 2.4.5. For mRNA abundance measurement, band intensities corresponding to HeT-A ms2 were quantified using ImageJ and normalised to gapdh transcript. 2.6 Primers Table IV Primer sequences Primer names Primer sequences Transgenes for microinjection krimp FL FW krimp FL RV ms2 FW ms2 RV HeT-A BglII FW HeT-A XbaI RV I-element BglII FW I-element XbaI RV caccatgaatctggaggacatt ttggctaacctgagcgta cgaattctaaggtacctaattgcctag cgaattcatcgatcgcgcgcagatcta ccagatctatgtccatgtccgacaaccttt ccctctagatccgggtgcgtttaggtgagtg ccagatctatgacagacccaccaaacattt ccctctagaaactaattgctggcttgttatg Antibody generation ago3 Antigen (Ag) FW ago3 Ag RV ski3 Ag FW caccaaaacagatgaccatacatc ttattttggacgcgaaggatcaa cacccgaatgtttcccaattcccga 56 ski3 Ag RV krimp Ag163 FW krimp Ag163 RV krimp Ag461 FW krimp Ag461 RV tgaatttgcaataatagcgga cacctcagaagagagagacgct ttagatttgattgtagatatc caccgccaatatgcattgctttgtt aatgcgttgctcgtccttggg Probes for northern krimp FW krimp RV T7 T3 SP6 ms2 FW ms2 RV gapdh FW gapdh RV actgccattgcaggagttgg gtcccacaccaacggcggag taatacgactcactataggg aattaaccctcactaaaggg catacgatttaggtgacactatatag cgaattctaaggtacctaattgcctag cgaattcatcgatcgcgcgcagatcta atgtcgaagatcggaattaac ttagtccttgctctgcatatactt piRNA FISH antisense HeT-A piRNA probe FW antisense HeT-A piRNA probe RV antisense 2S rRNA probe FW antisense 2S rRNA probe RV taatacgactcactataggctcattaacgagtatagggg gtgct agcaccccctatactcgttaatgagcctatagtgagtcgt atta taatacgactcactataggctgcttggactacatatggtt gagggttgta tacaaccctcaaccatatgtagtccaagcagcctatagt gagtcgtatta LM-PAT, RACE-PAT, RT-PCR and single-fly PCR cycB PAT FW cycB PAT RV HeT-A PAT FW HeT-A 3’UTR RV HeT-A 5’UTR FW HeT-A 5’UTR RV HeT-A 5’CDS FW HeT-A 5’CDS RV HeT-A 3’CDS FW HeT-A 3’CDS RV act5C FW act5C RV pcm-Ex FW pcm-Ex RV pcm-1 FW accactaagcaacgattaaaacacg caggattgataagaatgcaggacaaaa ttgcaatatgttaatgttaccagtccatg actttgctggtggaggtacggagacagagtaaattctgt t cataatactccacgcgcaaa cgtcttttggcttcttctcc attgccctcaaatcaagcag gtggacggaggagaagacaa tcattgacgataccagcgcatc tccgggtgcgtttaggtgag tgcccatctacgagggttat agtacttgcgctctggcgg cgcttttgttttggttttggt gggactatctgagcaccttcc ttcccaagttctttcgctaca 57 pcm-2 RV pcm-3 FW pcm-4 RV pcm-5 FW pcm-6 RV pcm-7 FW pcm-8 RV nat1 FW nat1 RV gapdh FW gapdh RV ski3-1 FW ski3-2 RV ski3-3 FW ski3-4 RV ski3-5 FW ski3-6 RV roo FW roo RV I-element FW I-element-RV HeT-A FW HeT-A RV TART FW TART RV mst40 FW mst40 RV ggaatatctgctcctcctcca tcctcaacgtggagcactact gacgtgccgcatttactttc agtttacaaggtgcccgaaat tcacatagcgactgctggtc cgaatctgatggggtctcaac gtcgggcagtatgtattccaa cactacgactacatgcgcgata gaacttggcgcagatctcc atgtcgaagatcggaattaac ttagtccttgctctgcatatactt aaatgtggctcctttctgctt cttgcactgggttcagagttc aggacattcgggagaccataa atttcaggcagttcgttgct aggaaattggacaggaaaacg agatcatccaagggcaaatct tcctttaagcatcttacagctaaagg tttagctgtaagatgcttaaaggagct gaccaaataaaaataatacgacttc aactaattgctggcttgttatg tcattgacgataccagcgcatc tccgggtgcgtttaggtgag ttctatcaacaggctgtccacaggtt ccttcgtagtcgggtaggattattcgt aaaagacagacatgccttcgctccc ctggggtaaccttgaacttcgtctga Cap analysis cycB 5'UTR FW cycB 5'UTR RV U1 FW U1 RV aactcgatcaggttttcggata gcttggctatcacttggtttg gcatacttacctggcgtagagg accaaaaattacacgcacgag 58 [...]... aaatgtggctcctttctgctt cttgcactgggttcagagttc aggacattcgggagaccataa atttcaggcagttcgttgct aggaaattggacaggaaaacg agatcatccaagggcaaatct tcctttaagcatcttacagctaaagg tttagctgtaagatgcttaaaggagct gaccaaataaaaataatacgacttc aactaattgctggcttgttatg tcattgacgataccagcgcatc tccgggtgcgtttaggtgag ttctatcaacaggctgtccacaggtt ccttcgtagtcgggtaggattattcgt aaaagacagacatgccttcgctccc ctggggtaaccttgaacttcgtctga Cap analysis cycB 5'UTR... gtcccacaccaacggcggag taatacgactcactataggg aattaaccctcactaaaggg catacgatttaggtgacactatatag cgaattctaaggtacctaattgcctag cgaattcatcgatcgcgcgcagatcta atgtcgaagatcggaattaac ttagtccttgctctgcatatactt piRNA FISH antisense HeT -A piRNA probe FW antisense HeT -A piRNA probe RV antisense 2S rRNA probe FW antisense 2S rRNA probe RV taatacgactcactataggctcattaacgagtatagggg gtgct agcaccccctatactcgttaatgagcctatagtgagtcgt... atta taatacgactcactataggctgcttggactacatatggtt gagggttgta tacaaccctcaaccatatgtagtccaagcagcctatagt gagtcgtatta LM-PAT, RACE-PAT, RT-PCR and single-fly PCR cycB PAT FW cycB PAT RV HeT -A PAT FW HeT -A 3’UTR RV HeT -A 5’UTR FW HeT -A 5’UTR RV HeT -A 5’CDS FW HeT -A 5’CDS RV HeT -A 3’CDS FW HeT -A 3’CDS RV act5C FW act5C RV pcm-Ex FW pcm-Ex RV pcm-1 FW accactaagcaacgattaaaacacg caggattgataagaatgcaggacaaaa ttgcaatatgttaatgttaccagtccatg... ago3 Antigen (Ag) FW ago3 Ag RV ski3 Ag FW caccaaaacagatgaccatacatc ttattttggacgcgaaggatcaa cacccgaatgtttcccaattcccga 56 ski3 Ag RV krimp Ag163 FW krimp Ag163 RV krimp Ag461 FW krimp Ag461 RV tgaatttgcaataatagcgga cacctcagaagagagagacgct ttagatttgattgtagatatc caccgccaatatgcattgctttgtt aatgcgttgctcgtccttggg Probes for northern krimp FW krimp RV T7 T3 SP6 ms2 FW ms2 RV gapdh FW gapdh RV actgccattgcaggagttgg... ttgcaatatgttaatgttaccagtccatg actttgctggtggaggtacggagacagagtaaattctgt t cataatactccacgcgcaaa cgtcttttggcttcttctcc attgccctcaaatcaagcag gtggacggaggagaagacaa tcattgacgataccagcgcatc tccgggtgcgtttaggtgag tgcccatctacgagggttat agtacttgcgctctggcgg cgcttttgttttggttttggt gggactatctgagcaccttcc ttcccaagttctttcgctaca 57 pcm -2 RV pcm-3 FW pcm-4 RV pcm-5 FW pcm-6 RV pcm-7 FW pcm-8 RV nat1 FW nat1 RV gapdh FW gapdh... names Primer sequences Transgenes for microinjection krimp FL FW krimp FL RV ms2 FW ms2 RV HeT -A BglII FW HeT -A XbaI RV I-element BglII FW I-element XbaI RV caccatgaatctggaggacatt ttggctaacctgagcgta cgaattctaaggtacctaattgcctag cgaattcatcgatcgcgcgcagatcta ccagatctatgtccatgtccgacaaccttt ccctctagatccgggtgcgtttaggtgagtg ccagatctatgacagacccaccaaacattt ccctctagaaactaattgctggcttgttatg Antibody generation ago3... ski3-1 FW ski3 -2 RV ski3-3 FW ski3-4 RV ski3-5 FW ski3-6 RV roo FW roo RV I-element FW I-element-RV HeT -A FW HeT -A RV TART FW TART RV mst40 FW mst40 RV ggaatatctgctcctcctcca tcctcaacgtggagcactact gacgtgccgcatttactttc agtttacaaggtgcccgaaat tcacatagcgactgctggtc cgaatctgatggggtctcaac gtcgggcagtatgtattccaa cactacgactacatgcgcgata gaacttggcgcagatctcc atgtcgaagatcggaattaac ttagtccttgctctgcatatactt aaatgtggctcctttctgctt... transcribed using double-stranded DNA harbouring a T7 promoter and the antisense HeT -A piRNA or 2S ribosomal RNA (rRNA) sequence (Table IV) at 37°C for 2 hr The reaction was terminated by incubating at 65°C for 10 min following the addition of EDTA pH 8.0 to a final concentration of 2. 5 mM Synthesized RNA probes were stored at -20 °C for up to a week 2. 3 .2. 2 FISH Ovaries were dissected and fixed as.. .2. 2 .2 Generation and clean-up of mutant alleles pcm loss -of- function allele was generated by standard imprecise excision (Bachmann and Knust, 20 08; O'Connor and Chia, 20 02) of the P-element insertion EP1 526 (Bloomington Stock Center), a homozygous viable DNA element that was inserted 584 nt downstream of the polyadenylation site EP1 526 was mobilised by crossing virgin females that carried this insertion... Jackson Laboratory) for at least 30 min at room temperature The ovaries were then rinsed twice with PBX and incubated with the primary antibodies diluted in PBX containing 0.5% (w/v) bovine serum albumin (BSA, Sigma) for 4 hr at room temperature or overnight at 4°C After several washes in PBX, the ovaries were incubated in secondary antibodies diluted in 45 PBX containing 0.5% (w/v) BSA for 4 hr at . incubated at 25 °C for 2 hr to promote recombination. The reaction was subsequently terminated by adding Proteinase K and incubating at 37°C for 20 min. One-half of the reaction mix was used for transformation Carnegie Protein Trap Library (Buszczak et al., 20 07). Flies carrying the transgene, UASp-aub-GFP (Harris and Macdonald, 20 01), UASp-dcp1-Haemagglutinin (HA) (Lin et al., 20 06), UASp-krimp- Venus[Yellow. by adding EDTA pH 8.0 to a final concentration of 2. 5 mM and incubating the samples at 65°C for 10 min. 2. 1.8 Reverse transcription (RT) 1 µg of DNase-treated total RNA was reverse-transcribed