Functional characterization of HGF and its receptor c met in zebrafish development

... paracrine signaling in liver development The coexpression of hgfa and c- met in pectoral fin, hgfb and c- met in proneprhic duct also indicate their paracrine signaling in the development of these ... Characterizing HGF and its receptor c- met s role in zebrafish development (Manuscript in preparation) v LIST OF FIGURES Fig.1.1 Schematic represent...

Ngày tải lên: 12/09/2015, 08:18

... confirmed the 15S-configuration of the endogenous PGs by Ó FEBS 2004 Comparison of coral 15S- and 15R -cyclooxygenases (Eur J Biochem 271) 3535 Fig Deduced amino acid sequence of the novel 15S-COX ... Val in the novel P homomalla 15S-COX and in all known 15S-specific COX proteins, and an Ile in the 15RCOX [22,31] To determine the role of residue 349 in the sp...

Ngày tải lên: 23/03/2014, 12:20

... designated P2Y12 [15–17] Results from our laboratory revealed that both classic P2Y1 and P2Y12 receptors coexist in glioma C6 cells: P2Y1, linked to phospholipase C, and P2Y12 , inhibiting adenylate ... and P2Y1 and P2Y12 receptor protein expression and functional activity Examination of the effects of specific pharmacological agents (a single agonist a...

Ngày tải lên: 30/03/2014, 08:20

... organism for cloning the genes encoding the different fatty acid desaturases involved in EPA biosynthesis and identified two sequences coding for fatty acid desaturases with D5- and D6-regioselectivities ... contains 12 acidic amino acids (aspartate and glutamate), whereas the corresponding domain sequences in PtD5p and PtD6p have only eight and five acidic residues,...

Ngày tải lên: 31/03/2014, 09:20

... concentration of DHPC Protein -lipid interactions and Protein-LDLR binding of ApoE- (72-166) Proteins To identify and compare the lipid binding ability of the three apoE- (72-166) peptides, we assessed ... Received: 17 September 2010 Accepted: 10 January 2011 Published: 10 January 2011 References Weisgraber KH, Rall SC Jr, Mahley RW: Human E apoprotein heterogeneity Cysteine...

Ngày tải lên: 10/08/2014, 05:21

... 5'-ATGGCAACACTGTCAATTA-3' 5'-CCCGACGATCAGGATA-3' 5'-ACCGCCGGGATGAGTT-3' 5'-CCGCCTCCACGAACAA-3' 5'-TTCCGTTTCGTTTCTTCAA-3' 5'-TGGCCATAACCATTTTAGATAT-3' 5'-GGGTTTCATATGAAGATCGAGGTGAGAGAA-3' 5'-CGGGATCCTTAGATATCATATAGGAACTTGC-3' ... N-hydroxycinnamoyl/benzoyltransferase from I batatas (AB035183); AtHCT, shikimate/quinate hydroxycinnamoyltransferase of A thaliana (At5g48930); NtHCT, shikimat...

Ngày tải lên: 12/08/2014, 05:20

...  51   3.2 FUNCTIONAL CHARACTERIZATION OF LRP5 AND  ITS  PUTATIVE  INHIBITOR SOST  DURING   CRANIOFACIAL SKELETON FORMATION    53   3.2.1 Lrp5 and Sost  are  conserved ...  EXPRESSION OF LRP5 AND  ITS  PUTATIVE  INHIBITOR SOST  DURING  CRANIAL   SKELETON  DEVELOPMENT IN  ZEBRAFISH    84   4.3  A  ROLE  FOR LRP5 AND SOST IN  MORPHOGENESIS OF  THE ...  Complementary and  ...

Ngày tải lên: 10/09/2015, 08:43

... allows the functional expression of a variety of single mitochondrial- type AACs in E coli After IPTG-induction we were able to obtain functional integration of the various mitochondrial- type AACs into ... into the cytoplasmic membrane of E coli Measuring the uptake of the various adenylates into intact E coli cells expressing eukaryotic AACs, we were ab...

Ngày tải lên: 18/03/2014, 01:20

... cytoplasm and in the nucleus of forskolin-treated BeWo cells Inhibition of galectin binding to membrane glycoproteins affects cellular fusion We then investigated whether the close proximity of CD98 and ... Probes, Invitrogen, Paisley, UK) per 106 cells mL)1 cells for 30 min, or with MitoTracker Deep Red 633 (Molecular Probes) at a concentration of 25 nm per 10...

Ngày tải lên: 23/03/2014, 09:20

Ngày tải lên: 07/08/2014, 17:22

... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identified and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains a...

Ngày tải lên: 07/03/2014, 21:20

... digestion fragments of untreated and deglycosylated AFP 1222 J C Achenbach and K V Ewart (Eur J Biochem 269) Ó FEBS 2002 Fig Analysis of antifreeze activity Antifreeze activity was evaluated qualitatively ... chemicals were reagent grade Purification of smelt AFP Blood plasma was obtained from a population of rainbow smelt (O mordax) caught in seawater along the nor...

Ngày tải lên: 24/03/2014, 03:21

... expression of the insecticidal toxin (SMC) in E coli The SMC gene amplified by PCR using the vector sense (VS) (5¢-GGGAATTCCATATGGAAGTGTCTACAA ATC-3¢) and vector antisense (VA) (5¢-CCGCTCG AGCTTCATAGAAATAGTCGCCTC-3¢) ... The bacteria-free supernatant was tested for its insecticidal activity against the cockroaches by injection Identification of B cereus To identify the bacterial...

Ngày tải lên: 30/03/2014, 13:20

... to in uence the in ammatory and proliferative cascades of PsA and RA Abbreviations ELISA, enzyme-linked immunosorbent assay; FLS, fibroblast-like synoviocyte; NGF, nerve growth factor; NGF-R, nerve ... expression in rheumatoid arthritis and spondyloarthritis Arthritis Res Ther 2009, 11:R82 Raychaudhuri SP, Raychaudhuri SK: The regulatory role of nerve growth factor...

Ngày tải lên: 12/08/2014, 14:21

... 3.2 Characterization of flavonoids on PPAR and PPAR activity 103 3.3 Characterization of flavonoids and PPAR ligands on a natural PPAR V22 7A variant 124 3.4 Mechanism(s) elucidation of attenuated ... their clinical application especially in patients with heart failure (Arakawa et al 2004; Rangwala and Lazar 2004; Staels 2005) 1.3.2 Dual PPAR /PPAR ligands...

Ngày tải lên: 12/09/2015, 08:20