Functional characterization of HGF and its receptor c met in zebrafish development

Functional characterization of HGF and its receptor c met in zebrafish development

Functional characterization of HGF and its receptor c met in zebrafish development

... paracrine signaling in liver development The coexpression of hgfa and c- met in pectoral fin, hgfb and c- met in proneprhic duct also indicate their paracrine signaling in the development of these ... Characterizing HGF and its receptor c- met s role in zebrafish development (Manuscript in preparation) v LIST OF FIGURES Fig.1.1 Schematic represent...

Ngày tải lên: 12/09/2015, 08:18

220 499 0
Báo cáo khóa học: Structural and functional comparison of 15S- and 15R-specific cyclooxygenases from the coral Plexaura homomalla potx

Báo cáo khóa học: Structural and functional comparison of 15S- and 15R-specific cyclooxygenases from the coral Plexaura homomalla potx

... confirmed the 15S-configuration of the endogenous PGs by Ó FEBS 2004 Comparison of coral 15S- and 15R -cyclooxygenases (Eur J Biochem 271) 3535 Fig Deduced amino acid sequence of the novel 15S-COX ... Val in the novel P homomalla 15S-COX and in all known 15S-specific COX proteins, and an Ile in the 15RCOX [22,31] To determine the role of residue 349 in the sp...

Ngày tải lên: 23/03/2014, 12:20

6 414 0
Báo cáo khoa học: Expression and functional characterization of P2Y1 and P2Y12 nucleotide receptors in long-term serum-deprived glioma C6 cells ppt

Báo cáo khoa học: Expression and functional characterization of P2Y1 and P2Y12 nucleotide receptors in long-term serum-deprived glioma C6 cells ppt

... designated P2Y12 [15–17] Results from our laboratory revealed that both classic P2Y1 and P2Y12 receptors coexist in glioma C6 cells: P2Y1, linked to phospholipase C, and P2Y12 , inhibiting adenylate ... and P2Y1 and P2Y12 receptor protein expression and functional activity Examination of the effects of specific pharmacological agents (a single agonist a...

Ngày tải lên: 30/03/2014, 08:20

13 378 0
Báo cáo khoa học: Cloning and functional characterization of Phaeodactylum tricornutum front-end desaturases involved in eicosapentaenoic acid biosynthesis doc

Báo cáo khoa học: Cloning and functional characterization of Phaeodactylum tricornutum front-end desaturases involved in eicosapentaenoic acid biosynthesis doc

... organism for cloning the genes encoding the different fatty acid desaturases involved in EPA biosynthesis and identified two sequences coding for fatty acid desaturases with D5- and D6-regioselectivities ... contains 12 acidic amino acids (aspartate and glutamate), whereas the corresponding domain sequences in PtD5p and PtD6p have only eight and five acidic residues,...

Ngày tải lên: 31/03/2014, 09:20

9 455 0
Báo cáo y học: "Structural and functional characterization of human apolipoprotein E 72-166 peptides in both aqueous and lipid environments" pot

Báo cáo y học: "Structural and functional characterization of human apolipoprotein E 72-166 peptides in both aqueous and lipid environments" pot

... concentration of DHPC Protein -lipid interactions and Protein-LDLR binding of ApoE- (72-166) Proteins To identify and compare the lipid binding ability of the three apoE- (72-166) peptides, we assessed ... Received: 17 September 2010 Accepted: 10 January 2011 Published: 10 January 2011 References Weisgraber KH, Rall SC Jr, Mahley RW: Human E apoprotein heterogeneity Cysteine...

Ngày tải lên: 10/08/2014, 05:21

9 333 0
báo cáo khoa học: " Isolation and functional characterization of a cDNA coding a hydroxycinnamoyltransferase involved in phenylpropanoid biosynthesis in Cynara cardunculus L" potx

báo cáo khoa học: " Isolation and functional characterization of a cDNA coding a hydroxycinnamoyltransferase involved in phenylpropanoid biosynthesis in Cynara cardunculus L" potx

... 5'-ATGGCAACACTGTCAATTA-3' 5'-CCCGACGATCAGGATA-3' 5'-ACCGCCGGGATGAGTT-3' 5'-CCGCCTCCACGAACAA-3' 5'-TTCCGTTTCGTTTCTTCAA-3' 5'-TGGCCATAACCATTTTAGATAT-3' 5'-GGGTTTCATATGAAGATCGAGGTGAGAGAA-3' 5'-CGGGATCCTTAGATATCATATAGGAACTTGC-3' ... N-hydroxycinnamoyl/benzoyltransferase from I batatas (AB035183); AtHCT, shikimate/quinate hydroxycinnamoyltransferase of A thaliana (At5g48930); NtHCT, shikimat...

Ngày tải lên: 12/08/2014, 05:20

14 535 0
Cellular and molecular control of skeleton formation in fish  insights from osteoblast ablation and functional characterization of lrp5 and SOst

Cellular and molecular control of skeleton formation in fish insights from osteoblast ablation and functional characterization of lrp5 and SOst

...  51   3.2 FUNCTIONAL CHARACTERIZATION OF LRP5 AND  ITS  PUTATIVE  INHIBITOR SOST  DURING   CRANIOFACIAL SKELETON FORMATION    53   3.2.1 Lrp5 and Sost  are  conserved ...  EXPRESSION OF LRP5 AND  ITS  PUTATIVE  INHIBITOR SOST  DURING  CRANIAL   SKELETON  DEVELOPMENT IN  ZEBRAFISH    84   4.3  A  ROLE  FOR LRP5 AND SOST IN  MORPHOGENESIS OF  THE ...  Complementary and  ...

Ngày tải lên: 10/09/2015, 08:43

111 368 0
Báo cáo Y học: Functional integration of mitochondrial and hydrogenosomal ADP/ATP carriers in the Escherichia coli membrane reveals different biochemical characteristics for plants, mammals and anaerobic chytrids pdf

Báo cáo Y học: Functional integration of mitochondrial and hydrogenosomal ADP/ATP carriers in the Escherichia coli membrane reveals different biochemical characteristics for plants, mammals and anaerobic chytrids pdf

... allows the functional expression of a variety of single mitochondrial- type AACs in E coli After IPTG-induction we were able to obtain functional integration of the various mitochondrial- type AACs into ... into the cytoplasmic membrane of E coli Measuring the uptake of the various adenylates into intact E coli cells expressing eukaryotic AACs, we were ab...

Ngày tải lên: 18/03/2014, 01:20

10 486 0
Báo cáo khoa học: Membrane trafficking of CD98 and its ligand galectin 3 in BeWo cells ) implication for placental cell fusion pot

Báo cáo khoa học: Membrane trafficking of CD98 and its ligand galectin 3 in BeWo cells ) implication for placental cell fusion pot

... cytoplasm and in the nucleus of forskolin-treated BeWo cells Inhibition of galectin binding to membrane glycoproteins affects cellular fusion We then investigated whether the close proximity of CD98 and ... Probes, Invitrogen, Paisley, UK) per 106 cells mL)1 cells for 30 min, or with MitoTracker Deep Red 633 (Molecular Probes) at a concentration of 25 nm per 10...

Ngày tải lên: 23/03/2014, 09:20

13 385 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identified and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains a...

Ngày tải lên: 07/03/2014, 21:20

12 561 0
Báo cáo Y học: Structural and functional characterization of a C-type lectin-like antifreeze protein from rainbow smelt (Osmerus mordax) potx

Báo cáo Y học: Structural and functional characterization of a C-type lectin-like antifreeze protein from rainbow smelt (Osmerus mordax) potx

... digestion fragments of untreated and deglycosylated AFP 1222 J C Achenbach and K V Ewart (Eur J Biochem 269) Ó FEBS 2002 Fig Analysis of antifreeze activity Antifreeze activity was evaluated qualitatively ... chemicals were reagent grade Purification of smelt AFP Blood plasma was obtained from a population of rainbow smelt (O mordax) caught in seawater along the nor...

Ngày tải lên: 24/03/2014, 03:21

8 518 0
Báo cáo khóa học: Purification and functional characterization of insecticidal sphingomyelinase C produced by Bacillus cereus ppt

Báo cáo khóa học: Purification and functional characterization of insecticidal sphingomyelinase C produced by Bacillus cereus ppt

... expression of the insecticidal toxin (SMC) in E coli The SMC gene amplified by PCR using the vector sense (VS) (5¢-GGGAATTCCATATGGAAGTGTCTACAA ATC-3¢) and vector antisense (VA) (5¢-CCGCTCG AGCTTCATAGAAATAGTCGCCTC-3¢) ... The bacteria-free supernatant was tested for its insecticidal activity against the cockroaches by injection Identification of B cereus To identify the bacterial...

Ngày tải lên: 30/03/2014, 13:20

6 456 0
Báo cáo y học: "Functional significance of nerve growth factor and its receptor (TrkA) in inflammatory arthritis" pps

Báo cáo y học: "Functional significance of nerve growth factor and its receptor (TrkA) in inflammatory arthritis" pps

... to in uence the in ammatory and proliferative cascades of PsA and RA Abbreviations ELISA, enzyme-linked immunosorbent assay; FLS, fibroblast-like synoviocyte; NGF, nerve growth factor; NGF-R, nerve ... expression in rheumatoid arthritis and spondyloarthritis Arthritis Res Ther 2009, 11:R82 Raychaudhuri SP, Raychaudhuri SK: The regulatory role of nerve growth factor...

Ngày tải lên: 12/08/2014, 14:21

2 264 0
Discovery of botanical flavonoids as dual peroxisome proliforator, activated receptor (PPAR) ligands and functional characterization of a natural PPAR polymorphism that enhances interaction with nuclear compressor

Discovery of botanical flavonoids as dual peroxisome proliforator, activated receptor (PPAR) ligands and functional characterization of a natural PPAR polymorphism that enhances interaction with nuclear compressor

... 3.2 Characterization of flavonoids on PPAR and PPAR activity 103 3.3 Characterization of flavonoids and PPAR ligands on a natural PPAR V22 7A variant 124 3.4 Mechanism(s) elucidation of attenuated ... their clinical application especially in patients with heart failure (Arakawa et al 2004; Rangwala and Lazar 2004; Staels 2005) 1.3.2 Dual PPAR /PPAR ligands...

Ngày tải lên: 12/09/2015, 08:20

263 267 0
w