macrophage colony stimulating factor and its receptor c fms

... TTT GC and 3' primer GGG TCA TCA GTG TCT AGG CT 3'; for TNFR2, 5' primer CTT CGC TCT TCC AGT TGG and 3' primer AGG CAA GTG AGG CAC CTT Immunoassays for IL-1β and IL-6 Concentrations of IL-1β and ... Chemokine (C- C motif) ligand 15 MIP-1 delta/MIP5 1.84 1.07 CCR5 Chemokine (C- C motif) receptor CCR5 1.93 1.11 CXCL3 Chemokine (C- X -C motif) ligand GRO3 2.17 0.83 IRAK2 Interleukin-1 receptor- associated ... healthy controls (HCs) CSFR) on of type and type with rheumatoid arthritis (RA) and (TNFR1/2) and macrophage colony- stimulating factor receptor (MExpressionmonocytes of patientstumour necrosis factor...

Ngày tải lên: 09/08/2014, 08:22

... JF: Granulocyte -macrophage colonystimulating factor (GM-CSF) and granulocyte colony- stimulating factor (G-CSF): receptor biology, signal transduction, and neutrophil activation Blood Rev 1992, ... Jones TC: Future uses of granulocyte -macrophage colony- stimulating factor (GM-CSF) Stem Cells 1994, 12(Suppl 1):229-239 discussion 239240 13 Rapoport AP, Abboud CN, DiPersio JF: Granulocyte -macrophage ... contributions VI, LE and SV conceived of the study, and participated in its design and coordination and helped to draft the manuscript NC, TA and DN conducted the experiments TT and FG participated in...

Ngày tải lên: 09/08/2014, 03:21

... factor of osteoclastogenesis induced by macrophage colony- stimulating factor (M-CSF) and receptor activator of NF-κB ligand (RANKL) in a culture of murine precursor cells [13], was inhibited by the ... 96-well plates with macrophage colony- stimulating factor (M-CSF), receptor activator of NF-κB ligand (RANKL), and the indicated concentrations of dehydroxymethylepoxyquinomicin (DHMEQ) At day ... Effect of dehydroxymethylepoxyquinomicin (DHMEQ) on expression of receptor activator of NF-κB ligand (RANKL) and of macrophage colony- stimulating factor (M-CSF) by fibroblast-like synovial cells...

Ngày tải lên: 09/08/2014, 10:21

... IL-15 Granulocyte macrophage colony- stimulating factor * ** Granulocyte colony- stimulating factor * ** * ***** CCL2 ***** CCL3 * *** * * CCL5 *** * CXCL10 * * * * TNFα ... immunodepletion of GM-CSF and other candidate survival factors detected in FCM from RASFIL-17/TNF – such as granulocyte colony- stimulating factor, CCL2 and CXCL8 – failed to inhibit neutrophil ... KJ, Basu S, Zhan YF, Dunn AR: Mice lacking granulocyte colony- stimulating factor have chronic neutropenia, granulocyte and macrophage progenitor cell deficiency, and impaired neutrophil mobilization...

Ngày tải lên: 09/08/2014, 10:23

... doi:10.1186/cc10031 Cite this article as: Bo et al.: Granulocyte -colony stimulating factor (GCSF) and granulocyte -macrophage colony stimulating factor (GM-CSF) for sepsis: a meta-analysis Critical Care ... “granulocyte colony- stimulating factor , “granulocyte colony stimulating factor, recombinant”, “GCSF”, “filgrastim”, “lenograstim”, “sargramostim”, “pegfilgrastim”, “granulocyte -macrophage colony- stimulating ... granulocyte -colony stimulating factor; GMCSF: granulocyte -macrophage colony stimulating factor; LPS: lipopolysaccharide; mHLA-DR: monocytic HLA-DR; PHA: phytohemagglutinin; RCTs: randomized control trials;...

Ngày tải lên: 14/08/2014, 07:21

... AATGGACCCGACATTAACCA AAATGGTCGTTTGGCTGAAG AGGAACATCTGGCCAGGCTG ACTTGGGATGCTCCATGGTC CTCAACTTTCTGCCCAGAGG CTGGAAGGCAGAAGTGAAGG CACTCTGGACAGTGCAGGAAG CGACACCTCCAGGAAGCTCTG AAAGGATCCACTGGCGTCTTCACCACC ... GAATTCGTCATGGATGACCTTGGCCAG Forward Reverse Forward Reverse TGGCTGGAAGAGAGGAAGAG CTGGGGCAACTCAGGCTTA AACTGGGGACTCTCCCTTTG CTACTCCGTGAAGTGAACAA Primers that can be used to amplify both human and ... iNOS a Mouse G-CSF Human G-CSF GAPDH a Oligonucleotides used for the ChIP assay G-CSF promoter iNOS promoter a Forward ACGCGTAGATCCAACACCCTGCAGCGAT Reverse AGATCTGATTCTGGGTGATCTGGGCTGCA Forward Reverse...

Ngày tải lên: 22/03/2014, 17:20

... (reverse) 5'-ggaacaaaagtcctgatccagtagtc-3'; glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (forward) 5'-aatggaaatcccatcaccatctt-3'; GAPDH (reverse) 5'-catcgccccacttgattttg-3' PCR was performed ... Metcalf D, Stanley E, Cheers C, Fowler KJ, Basu S, Zhan YF, Dunn AR: Mice lacking granulocyte colony- stimulating factor have chronic neutropenia, granulocyte and macrophage progenitor cell deficiency, ... granulocyte colonystimulating factor (G-CSF) maintains neutrophil production at steady state and increases production of neutrophils in emergency situations [7,8] By contrast, granulocyte-macrophage...

Ngày tải lên: 09/08/2014, 01:22

... of tolerability and antibody response after recombinant human granulocyte -macrophage colony- stimulating factor (rhGM-CSF) and a single dose of recombinant hepatitis B vaccine Vaccine 1996, 14(13):1199-1204 ... Gorini R, Chiodo F: In vivo effects of recombinant human granulocyte -macrophage colony- stimulating factor (rHuGM-CSF), alone and associated with zidovudine, on HIV-1 replication New Microbiol 1997, ... Barbarini G: Effect of recombinant human granulocyte -macrophage colonystimulating factor on HIV-related leukopenia: a randomized, controlled clinical study AIDS 1997, 11(12):1453-1461 Scadden DT, Bering...

Ngày tải lên: 11/08/2014, 10:23

... Raychaudhuri SP, Raychaudhuri SK: The regulatory role of nerve growth factor and its receptor system in fibroblast-like synovial cells Scand J Rheumatol 2009, 38:207-215 Raychaudhuri SK, Raychaudhuri ... 2010 References Barthel C, Yeremenko N, Jacobs R, Schmidt RE, Bernateck M, Zeidler H, Tak PP, Baeten D, Rihl M: Nerve growth factor and receptor expression in rheumatoid arthritis and spondyloarthritis ... inflammatory and proliferative cascades of PsA and RA Abbreviations ELISA, enzyme-linked immunosorbent assay; FLS, fibroblast-like synoviocyte; NGF, nerve growth factor; NGF-R, nerve growth factor receptor; ...

Ngày tải lên: 12/08/2014, 14:21

... Activation of transcription factors and cell cycle progresion Activation of various transcription factors by HGF induces expression of several genes, involved in cell survival and cell cycle progression ... Fig.1.1 Schematic representation of proHGF/SF, HGF/SF and the c- Met receptor Proteolytic cleavage of proHGF/SF generates the heavy (H) and light (L) chain of the active factor and is accompanied ... discovered as a secreted product of fibroblasts and smooth muscle cells that induced dissociation and motility of epithelial cells (scatter factor) HGF is able to induce cell dissociation and mutual...

Ngày tải lên: 12/09/2015, 08:18

... 5’ TGG ATC CAT GAC CCC CCT GGG CCC 3’ and downstream primer, 5’ TAA GAT CTC AAG CTT TCA GGG CTG CGC AAG GTG GCG TA3’ The amplified products were fractionated on agarose gels The G-CSF cDNA eluted ... Zsebo KM, Murdock DC, Chazin VR, Bruszewski J, Lu H, Chen KK, et al: Recombinant human granulocyte colony- stimulating factor: effects on normal and leukemic myeloid cells Science 1986, 232(4746):61-65 ... Hammacher A, Smith DK, Treutlein HR, Boone T: Interaction of granulocyte colony- stimulating factor (G-CSF) with its receptor Evidence that Glu19 of G-CSF interacts with Arg288 of the receptor...

Ngày tải lên: 10/08/2014, 21:23

... 5'TTC TCT GAG CAG CTC CAA TG3' and (R) 3'CCA CAG ACA GGC CAC TTC TT5' Immunohistochemistry Master Mix for PCR was prepared using Taq polymerase, dNTPs and other reagents from Invitrogen (Carlsbad, ... 18:231-9 Smith HO, Anderson PS, Kuo DY, Goldberg GL, DeVictoria CL, Boocock CA, Jones JG, Runowicz CD, Stanley ER, Pollard JW: The role of colony- stimulating factor and its receptor in the etiopathogenesis ... mediates colony stimulating factor 1-induced morphological changes in macrophages Mol Cell Biol 2001, 21:1795-1809 Lesage S, Zouali H, Cezard JP, Colombel JF, Belaiche J, Almer S, Tysk C, O'Morain C, ...

Ngày tải lên: 11/08/2014, 10:23

... : cacctttcactttccttcctccccgcccacccacctgcctatgaccttttgccttttctctctccatttcctctccctccctga Exon : h-LIF-T5 gagttgtgcccctgctgttggttctgcactggaaacatggggcggggagccccctccccatcacccctgtcaacgccacctgtgccata ... tacacagcccagggggagccgttccccaacaacctggacaagctatgtggccccaacgtgacggacttcccgcccttccacgccaac ggcacggagaaggccaagctggtggagctgtaccgcatagtcgtgtaccttggcacctccctgggcaacatcacccgggaccagaa gatcctcaaccccagtgccctcagcctccacagcaagctcaacgccaccgccgacatcctgcgaggcctccttagcaacgtgctgtgc cgcctgtgcagcaagtaccacgtgggccatgtggacgtgacctacggccctgacacctcgggtaaggatgtcttccagaagaagaag ... cgccacccatgtcacaacaacctcatgaaccagatcaggagccaactggcacagctcaatggcagtgccaatgccctctttattctctat h-LIF-2N Exon : tacacagcccagggggagccgttccccaacaacctggacaagctatgtggccccaacgtgacggacttcccgcccttccacgccaac...

Ngày tải lên: 13/08/2014, 13:20

... TGCTGGAGACACCGATGTCTTCATTAGGCTCCTCTCAACCGGAGATGGTGGATCTCTCTCGGATTTCCAGCCCGGAAACGTAGCGTCCAATTTTTAAGC 298 GACTGAAGCCCCGCAAGGCACAGTGGCACTCGGTCCACTGCCTCCTACACCTCGCCTTGGATTGGACTCCTACGAGACTGGTCACTGGAGAGAGACGCA ... ACAAGGGAAAGGAGGGGATATACGTTCAGAGCCGAGGTTGCCTGCTGAAGGAGGTCCACCTCAATGTGACGGATTTGGGGCTGGGATACCAGACTAAGG 147 D 1288 AGGAGCTGATATTCCGATACTGCAGCGGCCCCTGCGCCGAGGCGGAGACCAACTACGACAAGATCCTGAACAACCTCACACACAACAAAAAGCTAGACA 180 E 1387 AAGACACGCCCTCGCGCACCTGCTGCCGCCCAATTGCATTCGATGACGACCTGTCCTTTTTGGACGACAACGTGGTGTATCACACCCTGAAAAAGCATT ... gtcacagcccccgtgcgctgcaccttgcgcttctctgctccgagttctcaccacactgttggacagttctgatcaaactgcgcagagtctccttcatct ATF/CREB gcttcgcggaatgtatttttcaggttttggaacattgaattattcccctctcgactcaatttttgctccaaaatattaaacttccttgaaaaatttccg...

Ngày tải lên: 03/10/2015, 20:57

... G-CSF as a template and, in the case of the Q134N mutant, a pair of complementary primers (forward, 6748 5¢-GCCGGCATGGCACCGTTGGTGGGCTGCAGGG-3¢; and reverse, 5¢-CCCTGCAGCCCACCAACGGTGCCA TGCCGGC-3¢) ... PEGylation of the G-CSF molecule by MTGase enzyme C Maullu et al tance to proteolytic inactivation, low toxicity, improved pharmacokinetic profiles, and reduced renal clearance and immunogenicity [4,5] ... africana, Macaca mulatta, Macropus eugenii, Microcebus murinus, Monodelphis domestica, Mus musculus, Myotis lucifugus, Ochotona princeps, Ornithorhynchus anatinus, Oryctolagus cuniculus, Otolemur...

Ngày tải lên: 16/03/2014, 00:20

... Flag-tagged expression vector was constructed as follows PCR was carried out using BOS-5 (GGGTTTG CCGCCAGAACACA) and BOS-Flag-rev (CCGAATT CCTTGTCATCGTCATCCTTGTAGTCCATGGTGGC CTCACGACACCTGA) primers with ... while cDNA for C- terminal Lyn was ampli®ed using primers Lyn-Cfor (TCACTTTTCCCTGCATCAG) and Lyn-Crev (GCTCTAGACAATAGGCTAGTCTCC) The resultant DNA fragments were inserted into the SmaI site and ... (1998) The Src-like tyrosine kinase Hck is activated by granulocyte colony- stimulating factor (G-CSF) and docks to the activated G-CSF receptor Biochem Biophys Res Commun 251, 117±123 Corey, S.J.,...

Ngày tải lên: 17/03/2014, 17:20

... th c tổng hợp phương pháp Sango (Macrogen co) codon vùng đầu N biến đổi thành codon c tần số dịch mã cao E coli (ACC CCC CTG GGC CCT  ATC CCG TTA GGT CCA) Gen hg-csf sử dụng làm khuôn thiết kế ... G-CSF c chứa acid amin cystein: Cys17, Cys36, Cys42, Cys64, Cys74 c chứa hai c u nối disulfide Cys36-Cys42 Cys64-Cys74 cysteine tự vị trí Cys17 [6,7] Hình Trình tự acid amin protein G-CSF (C c ... trùng c liên quan dùng nhân tố kích thích dòng bạch c u (Granulocyte -Colony Stimulating Factor, G-CSF) GCSF c ch c kích thích nguyên bào tủy tái sinh, phát triển biệt hóa theo hướng tạo bạch c u...

Ngày tải lên: 16/04/2014, 11:16

... granulocyte -colony- stimulating factor; GM-CSF: granulocyte -macrophage colony stimulating factor; ELISA: enzyme-linked immunosorbent assay; G-CSFR: granulocyte -colony- stimulating factor receptor; CT: ... large cell carcinoma producing granulocyte -colony- stimulating factor Ann Thorac Surg 2007, 83:308-310 Yamano T, Morii E, Ikeda J, Aozasa K: Granulocyte colony- stimulating factor production and ... granulocyte -macrophage colony- stimulating factor by human colorectal carcinoma cells Cancer Res 1994, 54:3700-3702 Trutmann M, Terracciano L, Noppen C, Kloth J, Kaspar M, Peterli R, Tondelli P, Schaeffer C, Zajac...

Ngày tải lên: 09/08/2014, 07:21

... doi:10.1186/1752-1947-5-88 Cite this article as: El Husseiny and Mattar: Aggressive cutaneous vasculitis in a patient with chronic lymphatic leukemia following granulocyte colony stimulating factor injection: a case ... severe chronic neutropenia and were on long-term G-CSF therapy Symptoms developed with an increase in the absolute neutrophilic count (ANC) and stopped when the ANC decreased and the patients continued ... Bachmeyer C, Wetterwald E, Aractingi S: Cutaneous vasculitis in the course of hematologic malignancies Dermatology 2005, 210:8-14 Yadav BS, Sharma SC, Kapoor RK: Paraneoplastic leukocytoclastic...

Ngày tải lên: 11/08/2014, 00:22