detection and characterization of the t cell receptor repertoire

Báo cáo khoa học: Heterologous expression of a serine carboxypeptidase-like acyltransferase and characterization of the kinetic mechanism potx

Báo cáo khoa học: Heterologous expression of a serine carboxypeptidase-like acyltransferase and characterization of the kinetic mechanism potx

... mechanism. Investigation of the substrate specificity of AtSMT towards l-malate revealed structural features required for the interaction of the acyl acceptor with the enzyme. The lack of enzymatic activity ... with the CPY-ySMT fusion resulting in SMT activity of 140 pkatÆL )1 culture, whereas the SUC2- ySMT construct turned out to be inactive. With the aim of facilitating the subsequent purifica- tion ... extension of the SMT sequence with both the ER retention sig- nal and the 6xHis tag led to severe reduction of SMT activity, thus revealing the requirement of a native C-terminus. Kinetic studies The sinapoylglucose-dependent

Ngày tải lên: 23/03/2014, 07:20

13 310 0
Báo cáo khoa học: Structure, signaling mechanism and regulation of the natriuretic peptide receptor guanylate cyclase pptx

Báo cáo khoa học: Structure, signaling mechanism and regulation of the natriuretic peptide receptor guanylate cyclase pptx

... [86]. Nevertheless, the observed homodimerization of the GCD and the metal ion dependence of the catalytic activity support the integrity of the expressed proteins. As expected from the high sequence ... lmolÆmin )1 Æmg )1 to 23 lmolÆmin )1 Æmg )1 [29,88–90]. Together, these data seem to suggest that the structure of the Cyg12 GCD dimer may reflect the structure of the GCD in the dimerized full-length NPRA in its ... of the nascent receptor polypeptide to the cell membrane, but that, once the active receptor is formed, the glycosyl moieties are not involved in ANP binding. This notion is consistent with the

Ngày tải lên: 28/03/2014, 23:20

12 291 0
Báo cáo khoa học: Identification and characterization of the metal ion-dependent L-alanoyl-D-glutamate peptidase encoded by bacteriophage T5 pdf

Báo cáo khoa học: Identification and characterization of the metal ion-dependent L-alanoyl-D-glutamate peptidase encoded by bacteriophage T5 pdf

... agent Figure shows that, at a concentration of 40 lgỈmL)1, polymyxin B inhibited the growth of cells but did not lyse them (the attenuance of the cell mixture did not decrease) At the same time, ... Cloning of the lys gene The lys gene of bacteriophage T5 was amplified by PCR with primers LysF (5¢-gtcgagacATATGAGTTTTAAAT TTGGT-3¢) and LysR (5¢-ctggatccATTAAACTAGTTCG ACATG-3¢), which contain sites ... proteins with diverse pH and ionic strength optima The spectrum of antibacterial action of endolysins is determined by the enzyme type, composition of the cell wall components of the target bacterium,

Ngày tải lên: 30/03/2014, 02:20

14 413 0
Báo cáo khóa học: Isolation and characterization of the Xenopus HIVEP gene family ppt

Báo cáo khóa học: Isolation and characterization of the Xenopus HIVEP gene family ppt

... 5¢-GGATCGTTAT CACCTCTG-3¢ and 5¢-GTGTAGTCTGTAGCAGCA-3¢, 60 °C, 28 cycles; Gsc, 5¢-ACAACTGGAAGCACT GGA-3¢ and 5¢-TCTTATTCCAGAGGAACC-3¢,60°C, 28 cycles; XWnt8, 5¢-TGTGGCCGGGTCTGAACTTA TTTT-3¢ and 5¢-GTCATCTCCGGTGGCCTCTGTTCT-3¢, 60 ... 5¢-TCCCTC GTCCACGGCCTCTTACAT-3¢,60°C, 29 cycles. Further oligonucleotides: Histone H4, 5¢-CGGGATAACATTCA GGGTATCACT-3¢ and 5¢-ATCCATGGCGGTAACTG TCTTCCT-3¢,60°C, 22 cycles; Xbra, 5¢-GGATCGTTAT CACCTCTG-3¢ ... representation of the full length XHIVEP1 and the Myc-tagged (MT) deletion mutants. Black and white boxes indi- cate the position of the Znf domains and the serine-rich stripe, respectively. The

Ngày tải lên: 30/03/2014, 13:20

10 414 0
Báo cáo khoa học: A natural osmolyte trimethylamine N-oxide promotes assembly and bundling of the bacterial cell division protein, FtsZ and counteracts the denaturing effects of urea docx

Báo cáo khoa học: A natural osmolyte trimethylamine N-oxide promotes assembly and bundling of the bacterial cell division protein, FtsZ and counteracts the denaturing effects of urea docx

... inhibited the GdnHCl-induced perturba- tion of the secondary structures of FtsZ (Fig. 2C). Taken together the results suggested that TMAO strongly counteracted the denaturing activities of urea and ... unfolding of FtsZ could be due to either stabilization of the native state or desta- bilization of the unfolded state. It has been shown that the transfer of a native protein from water to an osmolyte ... unfolding steps in the presence of different urea concentrations. The results indicated that the transition from the native to the intermediate step (DG NfiI ) of the urea-induced unfolding of FtsZ was

Ngày tải lên: 30/03/2014, 16:20

13 599 0
Báo cáo sinh học: "Detection and characterization of translational research in cancer and cardiovascular medicine"Ơ docx

Báo cáo sinh học: "Detection and characterization of translational research in cancer and cardiovascular medicine"Ơ docx

... and established the best distribution of the nodes, the resultant network was stretched onto a temporal axis so that the oldest nodes appear at the top, and the more recent ones along the bottom ... along the bottom, dominates the figure, with distinct clusters: stroke and neurology on the left, cardiac surgery on the bottom, imaging on the bottom right, and then on the right the largest domain, ... represents the overall set of relationships of that journal and the other journals to which it is specifically linked To facilitate interpretation of the network plots, we color-coded the title of

Ngày tải lên: 18/06/2014, 19:20

12 528 0
Báo cáo hóa học: " Detection and characterization of chicken anemia virus from commercial broiler breeder chickens" pdf

Báo cáo hóa học: " Detection and characterization of chicken anemia virus from commercial broiler breeder chickens" pdf

... compared to the other two detection methods used in the present study namely the nested PCR assay for detecting CAV DNA and ELISA for detection of antibodies against CAV. Smyth et al. [17] demonstrated ... replication in those tissues might be limited and below the detection limit of the assay. It might also be related with the age of commercial broiler breeder chickens or the poor sensitivity of the technique ... majority of the hens (96.15%) tested for CAV antibodies suggesting high level of occur- rence of vertical transmission of viral DNA to the progeny. The detection of CAV DNA in the ovary and oviduct

Ngày tải lên: 20/06/2014, 01:20

11 390 0
báo cáo hóa học:" Detection and characterization of translational research in cancer and cardiovascular medicine" potx

báo cáo hóa học:" Detection and characterization of translational research in cancer and cardiovascular medicine" potx

... and established the best distribution of the nodes, the resultant network was stretched onto a temporal axis so that the oldest nodes appear at the top, and the more recent ones along the bottom. ... 1. The clinical pole, along the bottom, dominates the figure, with distinct clusters: stroke and neurology on the left, cardiac surgery on the bottom, imaging on the bottom right, and then on the ... evaluating the semantic content of the interfaces. Semantic Structure Similar structures appear in the maps of the semantic con- tent of the two fields. The cancer map shows three distinct zones

Ngày tải lên: 20/06/2014, 03:20

12 397 0
báo cáo khoa học: " Identification and characterization of the Nonrace specific Disease Resistance 1 (NDR1) orthologous protein in coffee" doc

báo cáo khoa học: " Identification and characterization of the Nonrace specific Disease Resistance 1 (NDR1) orthologous protein in coffee" doc

... mass of about 48 kDa instead of the predicted 24.6 kDa. These authors further demonstrated that the protein regains its theoretical size when translated in vitro without the machinery dedicated ... Altogether, these results show that the mature CaNDR1a prote in is targeted to PM in the tobacco heterologous system, further suggesting a similar subcellular localization for the protein in coffee ... 11:144 http://www.biomedcentral.com/1471-2229/11/144 Page 6 of 17 to glycosylation, indicating that the latter post-transla- tional modification could account for the migration shi ft of the mature

Ngày tải lên: 11/08/2014, 11:21

17 455 0
Báo cáo khoa học: "Expression and characterization of the UL31 protein from duck enteritis virus" pot

Báo cáo khoa học: "Expression and characterization of the UL31 protein from duck enteritis virus" pot

... not exclude the possibility that an amount of it too small to be detected is packaged in virions, these results indi- cated that the UL31 protein is not a component of DEV virions. Distribution ... [8,14,16-20]. However, there is no report on the identifi- cation and characterization of the UL31 gene product of DEV. In the present study, the UL31 gene was amplified from the genome of DEV and successfully ... suggesting that the 35 kDa protein was the primary translation product of the UL31 gene. RT-PCR analyses revealed that the UL31 gene was transcribed most abundantly during the late phase of replication.

Ngày tải lên: 12/08/2014, 04:21

10 255 0
Báo cáo y học: " Immunohistochemical detection and regulation of a5 nicotinic acetylcholine receptor (nAChR) subunits by FoxA2 during mouse lung organogenesis" pps

Báo cáo y học: " Immunohistochemical detection and regulation of a5 nicotinic acetylcholine receptor (nAChR) subunits by FoxA2 during mouse lung organogenesis" pps

... ducted in order to test the hypothesis that these important pulmonary transcription factors regulate a 5 . Although lit- tle data regarding the expression pattern and specific con- tributions of ... conceived of the study and supervised in its implementation, interpretation, and writing. All authors approved of the final manuscript. Competing interests The authors declare that they have no competing ... relevant to the current study is the dis- covery that a single putative FoxA2 binding site exists in the proximal a 5 promoter and that plausible GATA-6 binding sites are absent. This suggests that

Ngày tải lên: 12/08/2014, 13:22

11 300 0
Fabrication and characterization of the ultrafiltration and nanofiltration membranes

Fabrication and characterization of the ultrafiltration and nanofiltration membranes

... demonstrated that the formation of asymmetric membrane structure can be controlled by both the thermodynamics of the polymer solution and the kinetics of the transport process ... FABRICATION AND CHARACTERIZATION OF ULTRAFILTRATION AND NANOFILTRATION MEMBRANES WANG KAIYU (M. Eng., Tianjin University) A THESIS SUBMITTED FOR THE DEGREE OF PHYLOSOPHY OF DOCTOR DEPARTMENT OF ... rate and elongational rate can therefore strengthen the macromolecular orientation along the spinning direction and the packing density of polymer molecules, and then subsequently

Ngày tải lên: 12/09/2015, 11:29

210 402 0
Isolation and characterization of the novel human gene, MOST 1

Isolation and characterization of the novel human gene, MOST 1

... identification of the estimated 35,000 genes residing within three billion base pairs of DNA, the characterization of their regulatory elements, transcriptional units and translated ... structure and characterization of their functions Even after the identification, the next would... cell division During this process of integration, the viral genome breaks at E1 and ... supporting me through these years. I thank God for you and just want to say I love you! TABLE OF CONTENTS TITLE i ACKNOWLEDGEMENTS ii TABLE OF CONTENTS iii LIST OF FIGURES vii LIST OF TABLES

Ngày tải lên: 16/09/2015, 17:13

185 227 0
Cloning and characterization of the promoter of the cancer  associated gene, FAT10

Cloning and characterization of the promoter of the cancer associated gene, FAT10

... identified and characterized the promoter of the FAT10 gene. We found that the 5’UTR, from the transcription start site to 15 bases before the start codon, displayed significant promoter activity. ... FAT10 expression, the methylation status of the tumor is either more in the tumor (P6) or no different from the adjacent normal tissues (P10 and 11). It is possible that differential methylation of other ... tissues of HCC patients, we sequenced the ~1.3 kb of the FAT10 promoter to screen for mutations and determined the methylation status of this promoter in HCC patients. No mutations can be found in the

Ngày tải lên: 03/10/2015, 20:57

119 318 0
Isolation, cloning and characterization of the FSH beta gene promoter of the chinook salmon (oncorhynchus tshawytscha)

Isolation, cloning and characterization of the FSH beta gene promoter of the chinook salmon (oncorhynchus tshawytscha)

... putative regulatory elements in the promoter and in the first intron, it is at its infant stage More studies need to be carried out to determine the functionality of all of the putative regulatory ... sites and how their binding proteins may coordinate with each other to regulate the transcription of this gene The availability of the nucleotide sequence and the identification of a wealth of ... synthesized in and released from the hypothalamus, binds to GnRH receptors on the surface of the pituitary gonadotrope This leads to the synthesis and secretion of LH and FSH which stimulate the

Ngày tải lên: 08/11/2015, 17:15

142 361 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

... AGTGAGATGGATACAGGTGCTAAAC TCTGGACCTCAGACATGAACTTACT TGTCAGTCCTCTTTAATGCT AATGGTATCCTGTTTGGCTCAG GGTTGTAATTGTACACGGTAGTC CGGTAGTCAGGAAATCAATGCC CCATGTCTGCAGATGGTCGAGG GGACTGACATTGCTCCAGAGC GCTTCAGTGACTCAGAAATTGG ... TGAGTTACACGTTCAGTCAGCAATATG Real-time TCTTGGTCTTTAGTTCTTATCATCTTGAGC Real-time AAGATTCTCAGCTACATAATGCACACC Real-time ATGCTCATCAGTAGATTCTGCTCAC Real-time ACGCTTCTTCTTTGCGACTG Real-time CACCATATCCCGCTTGAGTT Real-time ... GCTTCAGTGACTCAGAAATTGG GTCCAGAATATTCAGCCTTTCACC CTCCCTCAAACAAACCAGAGTC CACTGGATGAGACAGGAAGTT CTTCTCCAGGACAGTCCAAAGAGTC CTGGATTGAAGCGCCCTCGGTTAATC GCTGCCTTTGTTATTTGTAAGCTTCAG GGAAACTTCCTGTCTCATCCAGTG...

Ngày tải lên: 16/02/2014, 09:20

20 690 0
Báo cáo khoa học: Detection and characterization of a novel extracellular fungal enzyme that catalyzes the specific and hydrolytic cleavage of lignin guaiacylglycerol b-aryl ether linkages pdf

Báo cáo khoa học: Detection and characterization of a novel extracellular fungal enzyme that catalyzes the specific and hydrolytic cleavage of lignin guaiacylglycerol b-aryl ether linkages pdf

... dehydration generates the quinonemethide from GOG (structure II) The reaction mixture turned yellow as a result of formation of the quinonemethide The scheme is consistent with the fact that the ... Analysis of the products of the reaction revealed the presence of guaiacylglycerol (GG) and 4MU (data not shown) Localization of enzymatic activity To confirm the localization of the b-aryl ether ... specificity of the Ca structure and p-hydroxyl group, the b-aryl ether cleavage enzyme could react with DHP-GOU This result indicates reactivity for the structure that retained the Ca alcohol and...

Ngày tải lên: 17/03/2014, 03:20

10 671 0
Báo cáo Y học: Puri®cation and characterization of the human adenosine A2a receptor functionally expressed in Escherichia coli doc

Báo cáo Y học: Puri®cation and characterization of the human adenosine A2a receptor functionally expressed in Escherichia coli doc

... analysis and Amido black assays indicated that the latter underestimated the amount of puri®ed receptor fusion protein by 12% Protein concentrations of ®nal puri®ed receptor given in the text and tables ... properties of the canine adenosine A2a receptor [27] This indicates that the truncated receptor puri®ed by us is suf®cient to ful®l the main receptor functions and is appropriate for structural and ... cDNA The codon for the last used amino acid of the receptor (Ser412 in case of the full-length receptor and Ala316 for the truncated receptor) was followed by the nucleotide sequence GCGGCCGCA that...

Ngày tải lên: 24/03/2014, 00:21

11 583 0
Báo cáo hóa học: "Programmed cell death-1 (PD-1) at the heart of heterologous prime-boost vaccines and regulation of CD8+ T cell immunity" doc

Báo cáo hóa học: "Programmed cell death-1 (PD-1) at the heart of heterologous prime-boost vaccines and regulation of CD8+ T cell immunity" doc

... upon boosting Please note the inverse relationship between functional avidity and the amount of antigen The table (bottom) depicts the major, synergistic features of priming and boosting vectors/regimens, ... strategy could then be matched with heterologous vectors that expand and/ or differentiate the primed cells to therapeutically useful effector T cells or, alternatively, with homologous boosting ... further testing in other heterologous prime-boost vaccine protocols This asymmetry between priming and boosting vectors could very well be at the heart of both the mechanism and advantage of heterologous...

Ngày tải lên: 18/06/2014, 16:20

11 506 0
Báo cáo y học: " The establishment and characterization of the first canine hepatocellular carcinoma cell line, which resembles human oncogenic expression patterns" ppsx

Báo cáo y học: " The establishment and characterization of the first canine hepatocellular carcinoma cell line, which resembles human oncogenic expression patterns" ppsx

... c-MET.seq c-MET human.seq TATTCTCTTCTTTCATTGGGGAGCACTATGTCCATGTGAACGCCACTTATGTGAATGTC TATTCTCTACTTTCATTGGGGAGCACTATGTCCATGTGAACGCCACTTATGTGAATGTC TCTTCTCTACTTTCATTGGGGAGCACTATGTCCATGTGAACGCTACTTATGTGAACGTA ... GAA GTT TCC CAG TTT CTG AGC AAG GGT ATG GAG CAA CAC AT GTT CCT GGG CAC GTT TTT GTA TGA CTT GGG GTG CTT TCT TGG TGT AAC GGA ATA TGA GGG GGC CAT CTA TC GCA CGT CCA CTT CAT TAC CCA TGC C GGC TGC TCC ... CCAAGAGTGAGAGTACGTTTGGATGAC AGATGTTAGTGACAATGAACCT GTGATTTGTGTGTGCTGATC CGGAGGGACGCCAAACAGG GTCCCGGGTCAACTCTTCGTG TGGAGAGCGTCAACCGGGAGATGT AGGTGTGCAGATGCCGGTTCAGGT ATGGGTAGGGCAAATCAGTAAGAGGT AAGCATCGTATCACAGCAGGTTAC...

Ngày tải lên: 13/08/2014, 13:20

10 336 0
w