the discovery of vegf c and its receptor vegfr 3
Tài liệu Translational Vascular Medicine docx
... induction of Bcl-2 and inhibition of caspase -3 cleavage [30 ] 3. 3.2 Resistance to Complement Mechanisms implicated in complement deposition on the EC surface include activation of the classical ... (EC) forms the lumen of the capillary which contains several erythrocytes On the abluminal surface of the capillary, a pericyte can be seen The pericyte has several characteristic features including ... allow the maintenance of vascular endothelial homeostasis and integrity [5] 3. 2 Accelerated Atherosclerosis Heart attack and stroke as a consequence of atherosclerosis remain the leading cause of...
- 268
- 1,071
- 0
Tài liệu Báo cáo khoa học: Altered expression of CD1d molecules and lipid accumulation in the human hepatoma cell line HepG2 after iron loading pptx
... using the following primers: 5¢-GGGCACTC AGCCAGGGGACATCCTGCCCAA -3 as forward and 5¢-GATACAAGTTTGCACACCTTTGCACTTCTG -3 as reverse [58] The PCR amplification was performed in a total volume of 50 ... 4A) Culture of HepG2 cells in iron-rich media induced a significant increase in the percentage of HepG2 cells expressing Nor -3. 2-reactive CD1d, while the expression of ICAM-1, gp180 and MHC molecules ... expression of immune regulatory molecules known to function as ligands of selected subsets of T cells, such as MHC class I and II, CD1d, ICAM-1 and the novel CD8 ligand gp180 We also characterized...
- 14
- 682
- 0
Báo cáo khoa học: Tyrosine nitration in the human leucocyte antigen-Gbinding domain of the Ig-like transcript 2 protein ppt
... bacterial and viral infection, and chronic inflammation [17] To date, there is a scarcity of data available concerning how inflammatory stress affects the interaction between HLA-G and its receptors ... molecules are inactivated [15] Experimental procedures Cell culture The NK cell line, NKL, the monocytic cell line, U- 937 , and the MHC class I-deficient human erythroleukaemia transfected cells, ... rhILT2-Fc These results are in agreement with the MS analyses because Tyr76 participates directly in the interaction with HLA-G [3, 19] and Tyr35 is located in the very vicinity of Tyr38 These modifications...
- 11
- 375
- 0
Báo cáo khoa học: Roles of 1-Cys peroxiredoxin in haem detoxification in the human malaria parasite Plasmodium falciparum potx
... blood-stage P falciparum with primers and 5¢-GCGAATTCATGGCTTACCATTTAGGAGC -3 The 5¢-GCGAATTCTTACATTTGAACAAATCTTA -3 primers, which contain EcoRI sites (italics) adjacent to the initiation and the termination ... precipitated with trichloroacetic acid, and the iron concentration of the precipitate was measured The fact that iron was not detected in the precipitated fraction indicates that iron ⁄ Prx complexes ... the exception of the PCR primers The primers were 5¢-GCGA and 5¢-CGGA ATTCATGGCATCATATGTAGGA -3 ATTCTTACAACTTTGATAAATATT -3 (EcoRI sites in italics; initiation and termination codons underlined)...
- 8
- 373
- 0
Báo cáo khoa học: "AMBIGUITY RESOLUTION IN THE HUMAN SYNTACTIC PARSER: AN EXPERIMENTAL STUDY" ppt
... E CS (Sf) COMPLEMENTSENTENCE The psychologist told the wife that to (yell was not constructive ) Chodorow, M.S Time-compressed speech and the study of lexical and syntactic processing In W.E Cooper ... tached into the overall sentence structure A constraint could be plced on such a model which forbade such free constituents, forcing the analyses of the constituents to be abandonedi f they cannot ... reading and Chodorow's (1979) measurements of subjects' recall of time-compressed speech) and have yielded conf l i c t i n g results The present investigation set out to gather data concerning the...
- 5
- 352
- 0
Báo cáo khoa học: Enzymes of mannitol metabolism in the human pathogenic fungusAspergillus fumigatus– kinetic properties of mannitol-1-phosphate 5-dehydrogenase and mannitol 2-dehydrogenase, and their physiological implications pot
... that the reduction kcat exceeds the oxidation kcat by a factor of 12 (Table 2) These kcat conditions imply that chemical reaction of AfM1PDH in the reduction direction proceeds much faster than the ... in either direction of each of the two enzymatic reactions Comparison of KIEs on kcat and kcat Km distinguishes datasets in which Dkcat is smaller than Dkcat Km from others in which Dkcat roughly ... requirement of the strictly ordered kinetic mechanism, because, at saturating concentrations of the substrate which is added second, the commitment to catalysis becomes innite, and so the KIE is completely...
- 13
- 470
- 0
Báo cáo khoa học: A L225A substitution in the human tumour suppressor HIC1 abolishes its interaction with the corepressor CtBP docx
... restriction site (underlined) (5¢-CGG CGGGCTCTTCTTGGATGCATCCAGGCC -3 and 5¢-GG and CCTGGATGCATCCAAGAAGAGCCCGCCG -3 ) convenient flanking oligonucleotides The StuI–XhoI fragment containing the L225A ... clones as matrices and the following oligonucleotides: sense 5¢-GGAATT HIC1 interacts with CtBP CGGGATCCCAAAGTACTGCCACCTGCGG -3 with a BamH1 site, and antisense 5¢-AGTGGTACCGTCGACTC ATCCCGGGCTGCCGCT -3 , ... into mCtBP2 by overlap PCR mutagenesis (mCtBP2.A58E.F, GACCTGGCCACTGTGGAATTCTGTGATGCACAG; mCtBP2.A58E.R, CTGTGCATCACAGAATTCCACAGT GGCCAGGTC; mCtBP2.V72R.F, GAAATCCATGAGA AGCGGTTGAATGAAGCTGTG; and...
- 12
- 326
- 0
Báo cáo khoa học: Human-blind probes and primers for dengue virus identification Exhaustive analysis of subsequences present in the human and 83 dengue genome sequences doc
... microbial identification In Proceedings of the International Conference on Mathematics and Engineering Techniques in Medicine and Biological Sciences (Valafar F & Valafar H, eds), pp 36 3 36 7 CSREA ... positives; and l it can be used for genomic sequences of all sizes of practical interest, including the human genome (3 Gb) The basic idea is to set in correspondence to each of the 4n n-mers a particular ... al its simplicity; the distance is if both genomes produce the same pattern and if they not share any of the same probes By computing the distances between each pair of 83 patterns (the distance...
- 11
- 540
- 0
Báo cáo khoa học: Etoposide upregulates Bax-enhancing tumour necrosis factor-related apoptosis inducing ligand-mediated apoptosis in the human hepatocellular carcinoma cell line QGY-7703 pdf
... forward, 5¢-GCGAATTCCATGG ACGGGTCCGGGGAG -3 ; Bax reverse, 5¢-CGCTC GAGTCAGCCCATCTTCTTCCAG -3 ; Bid forward, 5¢-CGGGATCCCCATGGCGATGGACTGTGAGGT -3 ; Bid reverse, 5¢-CGGAATTCTCAGTCCATCCCATTTC TGG -3 The primers ... forward, 5¢-CGGAATTCTGCA AGTCTTTACTGTGGAA -3 ; DR5 reverse, 5¢-CGGA TCCTTAGGACATGGCAGAG -3 ; DcR2 forward, 5¢-CGGAATTCCGCGGAAGAAATTCATTTCT -3 ; DcR2 reverse, 5¢-CGGGATCCTCACAGGCAGGACG TAGCAG -3 ; Bax ... over basal actin mRNA levels The sequences of the primers used in this study are as follows: DR4 forward, 5¢-CGGAATTCGGAGGGGACCCCAAGTGCAT -3 ; DR4 reverse, 5¢-CGGGATCCTCACTCCAAGGACA CGGCA -3 ; DR5...
- 11
- 409
- 0
Báo cáo khoa học: Probing the access of protons to the K pathway in the Paracoccus denitrificans cytochrome c oxidase pdf
... C, Michel H & Mantele W (1996) Carboxyl group protonation upon ¨ 412 O.-M H Richter et al 31 32 33 34 35 36 37 38 reduction of the Paracoccus denitrificans cytochrome c oxidase: direct evidence ... difficult to reconcile the discrepancy observed with mutations of the particular glutamate residue, especially between the closely related aa3 cytochrome c oxidases of Paracoccus and Rhodobacter ... contributions of the m (C O) vibrational mode of glutamines can be expected at 1668 to 1687 cm)1 and of the d(NH2) at 1585 to 1611 cm)1 407 Proton access to Paracoccus cytochrome c oxidase [32 ] The increase...
- 9
- 367
- 0
Báo cáo sinh học: " PET kinetics of radiolabeled antidepressant, [N-methyl-11C]mirtazapine, in the human brain" ppt
... of the slope of the linear part of the Logan plot, curvature of the plot throughout the duration of scanning impairs the estimation of the binding potential (see Figure 3) Since the binding of ... function was fitted to these measurements and was used to estimate the continuous time-course of the radiochemical fractions of [N-methyl-1 1C] mirtazapine needed to calculate the metabolitecorrected ... drug discovery and therapeutic application Pharmacol Ther 2006, 110: 135 -37 0 28 Millan MJ Dual- and triple-acting agents for treating core and co-morbid symptoms of major depression: novel concepts,...
- 18
- 432
- 0
báo cáo hóa học:" Role of the VEGF-Flt-1-FAK pathway in the pathogenesis of osteoclastic bone destruction of giant cell tumors of bone" pptx
... such as OPCs, in GCTs We investigated the effects of GCTCM on the biological phenotypes of OPCs To examine the VEGF protein in GCT-CM, we used a VEGF- ELISA, and confirmed that the VEGF concentration ... investigated the effects of GCT-CM on the chemotaxis and proliferation of rOPCs GCTCM enhanced the chemotaxis and proliferation of rOPCs to levels that were comparable to VEGF stimulation, and the addition ... OPCs Thus, we investigated the biological effects of VEGF in GCTs using GCT-CM and rOPCs Consistent with the immunohistochemistry results, GCT-CM contained VEGF and treating rOPCs with GCT-CM...
- 8
- 445
- 0
báo cáo hóa học:" Role of the VEGF-Flt-1-FAK pathway in the pathogenesis of osteoclastic bone destruction of giant cell tumors of bone" potx
... such as OPCs, in GCTs We investigated the effects of GCTCM on the biological phenotypes of OPCs To examine the VEGF protein in GCT-CM, we used a VEGF- ELISA, and confirmed that the VEGF concentration ... investigated the effects of GCT-CM on the chemotaxis and proliferation of rOPCs GCTCM enhanced the chemotaxis and proliferation of rOPCs to levels that were comparable to VEGF stimulation, and the addition ... OPCs Thus, we investigated the biological effects of VEGF in GCTs using GCT-CM and rOPCs Consistent with the immunohistochemistry results, GCT-CM contained VEGF and treating rOPCs with GCT-CM...
- 8
- 244
- 0
Báo cáo hóa học: " Research Article Robust Object Categorization and Segmentation Motivated by Visual Contexts in the Human Visual System" docx
... European 21 [30 ] [31 ] [32 ] [33 ] [34 ] [35 ] [36 ] [37 ] [38 ] [39 ] [40] [41] [42] [ 43] [44] [45] [46] Conference on Computer Vision (ECCV ’06), vol 39 52 of Lecture Notes in Computer Science, pp 575–588, ... we can find similar UCB Then, if we use the link information in the UCB, we can select the category-speci c codebook The links between CCB and local patches can give probable ROI, because each ... objectbackground context to reduce the effect of background clutter Part-part context can remove or reduce the effect of outliers, and part-whole context can predict the category label and region of interest...
- 22
- 321
- 0
Báo cáo y học: "Eotaxin and FGF enhance signaling through an Extracellular signal-related kinase (ERK)-dependent pathway in the pathogenesis of Eosinophilic Esophagitis" doc
... kinase receptors that are specific for particular FGF subsets and can be found in a variety of tissues, including epithelial and mesenchymal tissue [20] bFGF increases the half-life of cells and could ... Infectious Diseases and the Human Immune Monitoring Center for their services Author details Stanford School of Medicine, Stanford, CA 9 430 5, USA 2California Pacific Medical Center, San Francisco, ... necrosis factor beta (TNF-b), and vascular endothelial growth factor (VEGF) Samples were tested and normalized with standard curves to ensure consistency and calibrations occurred before each...
- 9
- 243
- 0
Báo cáo y học: "Differential binding of chemokines to macrophages and neutrophils in the human inflamed synovium" pps
... CCL3 > CCL5 > CCL2 > CXCL8 In non-RA tissue the order was, CCL3 > CCL5 > CXCL8 > CCL2 The number of CCL3 and CCL5 positive intimal cells did not differ between RA and non-RA tissue However, the ... shown the presence of CCR1, CCR2 and CCR5 on CD68+ Arthritis Research Vol No Patterson et al macrophages in the RA synovium, but not CCR4 [17] Since CCL2 is a ligand for CCR2, and both CCL3 and CCL5 ... two adjacent cysteine (C) residues near the NH2-terminus (CC; e.g CCL2, CCL3 and CCL5) and CXC receptors (CXCR) bind members of the class of chemokines with C separated by an amino acid defined...
- 9
- 494
- 0
Báo cáo y học: "A polymorphism in the human serotonin 5-HT2A receptor gene may protect against systemic sclerosis by reducing platelet aggregation" potx
... set of primers was designed to encompass the C+ 135 4T polymorphic site in the 5HTR2A gene (forward primer, 5'-AGCCAACTTCAAATGGGACA -3' and reverse primer, 5'-CACACACAGCTCACCTTTTCA -3' ) The PCR reaction ... 40 cycles, each consisting of 30 seconds at 96 C, 45 seconds at 58 C and 45 seconds at 72 C A final elongation step of minutes at 72 C was added Sequencing All of the PCR products were sequenced ... criteria for the classification of systemic sclerosis (scleroderma) Subcommittee for Scleroderma Criteria of the American Rheumatism Association Diagnostic and Therapeutics Criteria Committee Arthritis...
- 7
- 411
- 0
Báo cáo y học: " NeMeSys: a biological resource for narrowing the gap between sequence and function in the human pathogen Neisseria meningitid" pot
... Z2491 MC58 FAM18 0 534 42 N lactamica* FA 1090 NCCP11945 α14 Manually edited CDSs 466 421 31 5 574 549 6 43 691 31 4 CDSs deleted from previous annotation 1 03 164 39 138 1 73 538 83 38 93 91 100 36 2 150 ... genitalium); the fact that many of these species not cause disease in humans (C glutamicum, F novicida); the use of strains for which no accurate genome annotation is available; and the frequent lack of ... NeMeSys can be used to narrow the gap between sequence and function in the meningococcus Results and discussion First component of NeMeSys: the genome sequence of strain 80 13 Providing a precise...
- 13
- 552
- 0
Báo cáo y học: " Contrasting chromatin organization of CpG islands and exons in the human genome" pot
... and the total number of intact and bisulfite-converted cytosines was calculated for each locus to indicate the degree of methylation The cytosines in the CG context were considered Enrichment of ... enrichment of CpG methylation CpG islands, exons, and CpG density The genomic coordinates of CGIs and exons were downloaded from the UCSC genome browser CpG density was calculated as the ratio of ... such bias, there will be no significant difference between the set of spliced exons and that of highly expressed exons Calculating the strength of exon splice sites The sum of the scores of the...
- 8
- 437
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008