Label free electrochemical DNA and protein detection using ruthenium complexes and functional polyethylenedioxythiophenes

... we studied label- free electrochemical DNA detection using ruthenium- complexed intercalators Two ruthenium- complexed electroactive DNA intercalators were synthesized, characterized, and their application ... drawbacks, label- free bioaffinity sensors are intensively investigated Label- free approach is becoming a more favored choice due to its simple and rapid analy...

Ngày tải lên: 11/09/2015, 09:07

... Electrochemical Immunoaffinity Sensor for Pesticide Detection TOPICAL CLUSTER In the present study, we describe an innovative strategy based on an original electrogenerated polyquinone film ... related to ATZ For CPEef, changes to ATD represents only 34 % of the one obtained for ATZ, at 10 nM ATD As expected, the selectivity is lower for high concentrations than for lo...

Ngày tải lên: 02/07/2014, 14:14

... technique of DNA detection require minimal sample preparation step for analyte detection and show very low detection limit Among non pcr based DNA detection, the focus of the study is only based on electrochemical ... sensitive electrochemical impedimetric DNA biosensor for detection of even single nucleotide mismatches [24] In this method EIS was used to study th...

Ngày tải lên: 08/09/2015, 18:11

... NH2–CCATCTTTACCAGACAGTGTTA 3′ 3′ GGUAGAAAUGGUCUGUCACAAU 5′ 3′ UUGUGACUAAAGUUUACCACGAU 5′ 3′AGUAUC GGGACAUGUUACGACGA 5′ 166 H.V Tran et al / Biosensors and Bioelectronics 49 (2013) 164–169 2.5 Grafting ... formats (Xu et al., 2004, 2006; Cai et al., 2003) In this paper, we describe a label- free and reagentless miRNA sensor based on an interpenetrated network of carbon nanotube...

Ngày tải lên: 02/07/2014, 14:14

... screening in DNA detection approach (this approach is more often used than the second one of protein detection because DNA stability is much higher than that of proteins and therefore DNA detection ... study, we described the setup of a novel DNA label- free electrochemical biosensor for GMO (soybean) detection, based on MWCNT -doped PPy matrices for ODN immob...

Ngày tải lên: 02/07/2014, 14:14

... technologies for the real-time label-free detection and characterization of protein interactions that may provide higher resolution functional data Common methods for studying protein interactions Current ... protein interactions with nonprotein biomolecules will depend on the development of labelfree methods for measuring the interactions Coupling functiona...

Ngày tải lên: 23/03/2014, 15:21

... of signal, the detection limit obtained for the VP16 probe was 5.2 × 10 -11 M When the semi-homogeneous and homogeneous assay formats were compared experimentally for detection of 5.2 × 10 -10 ... gold nanoparticles in ml solution used for modification* NA capacity of each nanoparticle when excess NA molecules used 6.02 × 10 13 15 1. 4 × 10 12 23 6.02 × 10 13 6.02 × 1...

Ngày tải lên: 11/08/2014, 00:22

... DEVELOPMENT OF PROTEIN MICROARRAYS AND LABEL- FREE MICROFLUIDIC IMMUNOASSAYS XUE CHANGYING (CHEM ENG., DUT) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF CHEMICAL ... protein microarrays and label- free microfluidic immunoassays with high stability, high sensitivity, fast response and low sample consumption, which can facilitate...

Ngày tải lên: 14/09/2015, 14:05

... single-strand break DNA repair pathway if applied to host cell DNA This pathway was investigated by studying the activity of Poly(ADP-ribose)Polymerase (PARP), the protein which detects nicks in DNA and ... principally binds to free DNA ends or DNA strand breaks (43), while ATR recognizes single-stranded regions of DNA common to multiple types of DNA lesions and that a...

Ngày tải lên: 25/10/2012, 11:18

... protein arginine methyltransferase and toward the Ewing sarcoma protein and a peptide Proteins 61, 164–175 48 Raman B, Guarnaccia C, Nadassy K, Zakhariev S, Pintar A, Zanuttin F, Frigyes D, Acatrinei ... 4) and 32P-labeled ETS-1 (lanes and 4) or ssDNA L (lanes and 2) (B) EMSA was performed with EWS (lanes 2, and 6) and 32P-labeled Htelo (lanes and 4), dsHtelo (lanes...

Ngày tải lên: 15/02/2014, 01:20

... Computational Linguistics, 22(2):249–254 Hyland, Ken (1998) Hedging in scientific research articles Amsterdam, The Netherlands: John Benjamins Lakoff, George (1973) Hedges: A study in meaning criteria and ... covers the entire Wikipedia and thus as many domains as are in Wikipedia Acknowledgments This work has been partially funded by the European Union under the project Judicial Ma...

Ngày tải lên: 20/02/2014, 09:20

... uorescence studies of conformational changes induced by cyclic AMP and DNA binding to cyclic AMP receptor protein from Escherichia coli Eur J Biochem 270, 14131423 Yu S & Lee JC (2004) Role of residue ... changes induced by DNA and cAMP 19 20 21 22 23 24 25 26 27 28 29 30 31 cAMP -induced allosteric changes in T127I, S128A and T127I S128A mut...

Ngày tải lên: 07/03/2014, 16:20

... 2A) The N-terminal part of XPCB hHR23B B C Fig NMR structure of the XPCB domain of hHR23B (A) Stereoview of the 12 superimposed structures of XPCB hHR23B All Pro residues conserved among the ... further our knowledge with respect to the mechanisms of action of these proteins, it is crucial that we define the precise boundaries of the STI1-homologous domai...

Ngày tải lên: 07/03/2014, 17:20

... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGT...

Ngày tải lên: 16/03/2014, 01:20