... father a < /b> than b as c but d and < /b> > a < /b> 48 I am teacher a < /b> the ba < /b> c an d no article > b 49 My uncle is good engineer a < /b> the ba < /b> c an d no article > b 50 That is eraser a < /b> the ba < /b> c an d no article ... the ba < /b> c an d no article > b 55 That is a < /b> bag It is on table a < /b> the ba < /b> c an d no article > a < /b> 56 We are in same class a < /b> the ba < /b> c an d no article > a < /b> 57 Your book is the desk a < /b> at b over ... pounds from a < /b> bank a < /b> crime b criminal c criminally d criminality > b 178 your own business can cause a < /b> lot of financial worries a < /b> Manage b Managing c Manager d Manageable > b 179 The surgeons...
... climbing, backpacking, and < /b> adventure tourism Some recreational activities are made illegal such as gambling and < /b> drug use Research has shown that recreation contributes to life satisfaction, quality ... choosing a < /b> wife or a < /b> husband A < /b> of B on C in D with He left the gas on, ? A < /b> didn’t he B had he C was he D wasn’t he Michael took a < /b> photograph of Sandra while she A < /b> smiled B was smiling C had ... heavy fog have cancelled B All flights because of the heavy fog have been cancelled C All flights have cancelled because of the heavy fog D All flights have been cancelled because of the heavy fog...
... 5Â-GGTATTGAGGGTCGCCATGGTTATGTTC AATCACCA-3Â; reverse primer, 5Â-AGAGGAGAGTTAG AGCCTTACAAGAAGGGTCCAAAGA-3Â) The PCR product was puried, treated with T4 exonuclease to create vector-compatible overhangs and < /b> annealed to a < /b> prepared ... for LlCBP3 3A < /b> at pH 6.0 (A,< /b> B) Binding of LlCBP3 3A < /b> visualized by SDS-PAGE (A)< /b> LlCBP3 3A < /b> present in the supernatant after 24 h of incubation with a-< /b> chitin (lane 2), b- chitin (lane 3), Avicel (lane ... incubation FEBS Journal 276 (2009) 24022415 ê 2009 The Authors Journal compilation ê 2009 FEBS G Vaaje-Kolstad et al Degradation of a-< /b> and < /b> b- chitin The degradation rates of a-< /b> and < /b> b- chitin were assayed...
... to both b1 ,3- and < /b> b1 ,4galactosidases, giving rise to a < /b> disaccharide and < /b> a < /b> monosaccharide, and < /b> is thus identified as a < /b> mixture of Galb1-3GlcNAcb1-3Gal and < /b> Galb1-4GlcNAcb1-3Gal The tetrasaccharide ... b1 ,3galactosidases, giving rise to a < /b> disaccharide and < /b> a < /b> monosaccharide, and < /b> was thus identified as a < /b> mixture of Galb1-4[Fuca1-3]GlcNAcb1-3Gal and < /b> Galb1-3[Fuca1-4]GlcNAcb1-3Gal The calculated amounts ... Galb1-4GlcNAcb1-3Gal NeuAca2-3Galb1-4GlcNAcb1-3Gal NeuAca2-3Galb1-4[Fuca1-3]GlcNAcb1-3Gal NeuAca2-3Galb1-3GlcNAcb1-3Gal NeuAca2-3Galb1-3[Fuca1-4]GlcNAcb1-3Gal Fig Secretion of Lewis antigens in...
... synthase subunit b: 5¢-CCTTCTGCTGTGGGCTATCA-3¢ and < /b> 5¢TCAAGTCATCAGCAGGCACA-3¢; ND5: 5¢-TAACCCC ACCCTACTAAACC-3¢ and < /b> 5¢-GATTATGGGCGTTGA TTAGTAG-3¢; b- globin: 5¢-CAACTTCATCCACGTTCA CC-3¢ and < /b> 5¢-ACACAACTGTGTTCACTAGC-3¢ ... 5¢-AAGACAGCAGCCCCAGTGAA-3¢ and < /b> 5¢-ACACCCAGCACCAGCACCT-3¢; PRC: 5¢-CACTGG TTGACCCTGTTCCT-3¢ and < /b> 5¢-GTGTTTCAGGGCTTC TCTGC-3¢; Cyt c: 5¢-CCAGTGCCACACCGTTGAA-3¢ and < /b> 5¢-TCCCCAGATGATGCCTTTGTT-3¢; ATP ... quantification was performed by nonsaturating picture scanning by a < /b> gel Doc 1000 Molecular Analyst apparatus (Biorad) Respiratory parameters and < /b> respiratory ratio in intact cells Respiratory parameters and...
... distorted chair The C-terminal a-< /b> domain is characterized by an adamantane-like four-metal cluster Solution structures of 113 Cd-substituted Cd7MT-2 from rabbit, rat and < /b> human are available and < /b> revealed ... (Tubingen, Germany), and < /b> all ¨ other chemicals were from Merck (Darmstadt, Germany) Synthesis of the individual a-< /b> and < /b> b- domains The individual a-< /b> and < /b> b- domains (KSCCSCCPVGCSKCA QGCVCKGAADKCTCCA ... Zn4aMT and < /b> Zn3bMT with those observed for Cd7MT [20] Presence (+) or absence (–) of NOEs is indicated b- Domain Proton Asn (a)< /b> Asn (a)< /b> Asn (b) Cys (a)< /b> Cys (b) Asn 23 (b) a-< /b> Domain Lys (NH) Lys (a)< /b> ...
... channels, and < /b> in particular with data obtained with b- PTH showing the formation of cationselective ion channels in artificial lipid bilayer membranes and < /b> in the plasmalemma of rat hippocampal ... min, and < /b> thereafter abundantly washed with dye-free solution before imaging and < /b> the addition of a1< /b> -PTH or PIN -a < /b> to the medium Cells imaged before (Aa) and < /b> after (Ab) exposure to 10 lM a1< /b> -PTH in a < /b> ... PTH-containing and < /b> PIN-containing crude fractions were dialyzed against deionized water and < /b> freeze-dried, and < /b> a1< /b> -PTH, a2< /b> -PTH and < /b> b- PTH were separated (at room temperature) by semipreparative RP-HPLC...
... Health Insurance Portability and < /b> Accountability Act of 1996, Public Law 104–191, directed the Secretary to establish and < /b> maintain a < /b> national health care fraud and < /b> abuse data collection program ... Affordable Care Act requires the Secretary to establish a < /b> transition period to transfer all data in the Healthcare Integrity and < /b> Protection Data Bank to the National Practitioner Data Bank, and,< /b> ... PROPOSALS4 § 60.18 Requesting information from the National Practitioner Data Bank (a)< /b> Who may request information and < /b> what information may be available Information in the NPDB will be available,...
... (3) and < /b> (4), the dissociation rate constant, k, and < /b> the O2 affinity, K, can be derived for both the a < /b> and < /b> b subunits from the averaged parameters of HbA oxygenation (Table 1, Average) The association ... oxygenation parameters in the salt-free buffers (Table 1, Average) can be considered as follows The BR rate constant for the a < /b> subunits within triliganded HbA and < /b> the BR quantum yield for the a < /b> subunits ... ! ðaO2 ; bO2 ÞðaO2 ; bO2 Þ À a;< /b> bO2 ÞðaO2 ; bO2 Þ þ O2 ka À ðaO2 ; bO2 ÞðaO2 ; bO2 Þ ! hv ð1Þ ðaO2 ; bO2 ÞðaO2 ; bO2 Þ À ðaO2 ; b ðaO2 ; bO2 Þ þ O2 ! kb À ðaO2 ; bO2 ÞðaO2 ; bO2 Þ ! where (aO2,...
... PCR was carried out for 25 cycles of 30 s at 95 °C, 30 s at 55 °C and < /b> 30 s at 72 °C, using two primers 5¢-GGAATTCCATATGGGAGTCAAGACTGAGAA CAAC-3¢ and < /b> 5¢-CCGCTCGAGTCAACCTCCCGTCT G-3¢ The DNA products ... of a < /b> half-open b- barrel and < /b> two flanking a-< /b> helices, with secondary structure elements arranged as bbabbab in the sequence (Fig 1), identical to those of ubiquitin, SMT3 and < /b> SUMO-1 Fig 3B shows a < /b> ... proteins have a < /b> broader definition and < /b> comprise several subclasses [4] The enzymes Ulp1 and < /b> Ulp2 in yeast are located in the nuclear pore complex and < /b> nucleoplasm, and < /b> they are the protease and < /b> isopeptidase...
... serum and < /b> incubated with goat polyclonal anti-cPLA2 -a < /b> and < /b> rabbit polyclonal anti-calreticulin sera, followed by donkey FITC-conjugated anti-sheep and < /b> donkey Texas Red-conjugated anti-rabbit sera ... extracellular calcium Cells were then fixed and < /b> permeabilized and < /b> incubated with goat polyclonal anti-cPLA2 -a < /b> serum and < /b> mouse monoclonal antibodies against annexin V, annexin I, p11, caveolin, actin ... FEBS cPLA2 -a < /b> at its site of localization Several studies have also implied that cPLA2 -a < /b> may be regulated by cytoskeletal interactions Cytochalasin B, an inhibitor of actin polymerization, was...
... the wells not allow more than one ssDNA bead to be loaded into a < /b> well • Enzyme beads and < /b> packing beads are added Enzyme beads containing sulfurase and < /b> luciferase, and < /b> packing beads used only ... are broken, and < /b> the beads are released • Enrichment beads are added (containing biotin); these attach to DNA rich beads only • A < /b> magnetic field filters all DNA rich beads from empty beads, and < /b> ... The B adapter contains a < /b> 5’ biotin tag used for mobilization • The beads are magnetized and < /b> attract the biotin in the B adaptors Filtering the Mess • There are four adaptor combinations that are...
... flax leaves Galactolipids were separated and < /b> purified as described in Materials and < /b> methods EDE content was measured by UV absorbance of MGDG and < /b> DGDG fractions at 267 nm Average values and < /b> standard ... diglyceride, from Arabidopsis thaliana J Biol Chem 276, 12832–12838 42 Hisamatsu Y, Goto N, Hasegawa K & Shigemori H (2003) Arabidopsides A < /b> and < /b> B, two new oxylipins from Arabidopsis thaliana Tetrahedron ... mass spectral data This work was supported in part by Grant 09-04-01023 -a < /b> from the Russian Foundation for Basic Research and < /b> a < /b> grant from the Russian Academy of Sciences (program ‘Molecular and...
... (Hsp9 0a,< /b> forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp9 0b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse ... Hsp90 clients and < /b> Hsp90 inhibitor sensitivity in such strains; analysis that showed that many mammalian clients are able to be activated by both Hsp9 0a < /b> and < /b> Hsp9 0b Whether Hsp9 0a < /b> or Hsp9 0b is expressed ... staining revealed almost instant loss of any actin organization following Hsp90 inhibitor treatment; data not shown) After h, many of these cells displayed an apparent arrest of DNA and < /b> vacuolar...
... water for each Partial acetylation of serines and < /b> threonines was avoided by adding 12 lL of a < /b> solution containing 0.5 mm hydroxylamine and < /b> 100 mm NaOH to the reaction chamber and < /b> incubating at ... [28,29] Although a < /b> general stromal processing peptidase (SPP) has been characterized, and < /b> a < /b> preferred consensus sequence for cleavage between a < /b> basic amino acid (arginine or lysine) and < /b> a < /b> C-terminal ... and < /b> potassium alkali metal and < /b> various di- and < /b> tri-alkali metal adducts if standard solvents with 0.1% formic acid were used for the UPLC separation (Fig 2A)< /b> In addition, the alkali metal adducts...
... fa ⁄ fa and < /b> Fa ⁄ ? rats (C) Phosphorylase immunoreactivity (arbitary densitometry units) and < /b> representative immunoblot of fa ⁄ fa (n) and < /b> Fa ⁄ ? (h) preparations Data are mean ± SE for n ¼ (A)< /b> , ... glycogen synthase against phosphorylase -a < /b> in fa ⁄ fa and < /b> Fa ⁄ ? hepatocytes (Figs 2C, 3B) could be explained by an increased activity of glycogen synthase phosphatase [13–15], because of increased expression ... kit (Amersham Pharmacia Biotech, Piscataway, NJ) Statistical analysis Results are expressed as means ± SE Statistical analysis was carried out using the Student’s t-test (either paired or unpaired)...
... 5¢-CATCTTGAAAGTCGGTGCGGGAGAAGCAA CACAATGC-3¢ (the reverse primer was the complementary sequence); pCA(E45 7A)< /b> forward primer, 5¢-CATCTTGA AAGTCGGTAAGGGAGCAGCAACACAATGC-3¢ (the reverse primer was ... polyclonal antibody against cabbage PLDa The immunoprecipitate was analyzed by western blotting using PLD antibody (upper panel) and < /b> a < /b> monospecific recombinant cardosin A < /b> antibody (lower panel) Lane ... [34] Activated samples were analyzed by SDS ⁄ PAGE, and < /b> native cardosin A < /b> (CA) was used as control The gel was stained with Coomassie Blue (B) After activation, recombinant wild-type cardosin A < /b> and...
... phylogenetic analysis Enzyme Species GenBank/EBI A < /b> transferase A < /b> transferase A < /b> transferase A < /b> (cis A/< /b> B) transferase A-< /b> likea Gal transferase Gal transferase Gal transferase Gal transferase Gal transferase ... Ó FEBS 2002 kidney, the urinary bladder, the uterus and < /b> the thymus A < /b> weaker signal was obtained from the pancreas and < /b> very weak, barely detectable, signals were visible from a < /b> salivary gland, ... intestine Caecum Large intestine Pancreas Parotid gland Submaxillary gland Liver Trachea Lung Kidney Urinary bladder Ovary Uterus Testis Seminal vesicle Thyroid gland Parathyroid gland Brain Muscle...