yong yang bao yu chen shi yun 2006 inheritance analysis of herbicide resistance transgenic soybean lines acta genetica sinica 33 12 1105 1111
Tài liệu Báo cáo khoa học: "Subjectivity and Sentiment Analysis of Modern Standard Arabic" doc
... point of view in narrative Computional Linguistics, 20(2): 233 287 T Wilson, J Wiebe, and P Hoffmann 2009 Recognizing Contextual Polarity: an exploration of features for phrase-level sentiment analysis ... 88.06%.2 The distribution of classes in our data set was as follows: 128 1 OBJ, a total of 1574 SUBJ, where 491 were deemed S-POS, 689 S-NEG, and 394 S-NEUT Moreover, each of the sentences in our ... further processing of the morpho-tactics that result from the segmentation of clitics; (2) Lemma, where the stem words are reduced to their lemma citation forms, for instance in case of verbs it is...
- 5
- 581
- 0
Báo cáo khoa học: Proteomic and biochemical analysis of 14-3-3-binding proteins during C2-ceramide-induced apoptosis pot
... combination of 14-3-3-affinity chromatography and MALDI-TOF MS analysis under 333 4 normal growth conditions in HeLa cells, although confirmation by immunoblot analysis was not performed at the time [12] ... (2010) 332 1 334 2 ª 2010 The Author Journal compilation ª 2010 FEBS 333 7 14-3-3-binding status during apoptosis 10 11 12 13 14 15 16 M Pozuelo-Rubio ultrastructural localization analysis of 14-3-3 ... identification of genuine 14-3-3 ligands Detailed analysis of the 14-3-3-asociated proteins found showed that 46 of them were exclusively present in one of the conditions analyzed and 15 of them were...
- 22
- 424
- 0
Báo cáo khoa học: Semi-nested PCR analysis of unknown tags on serial analysis of gene expression potx
... Serial analysis of gene expression: rapid RT-PCR analysis of unknown SAGE tags Nucleic Acids Res 27, e17 Chen JJ, Rowley JD & Wang SM (2000) Generation of longer cDNA fragments from serial analysis ... Science 276, 126 8 127 2 Velculescu VE, Madden SL, Zhang L, Lash AE, Yu J, Rago C, Lal A, Wang CJ, Beaudry GA, Ciriello KM et al (1999) Analysis of human transcriptomes Nat Genet 23, 387–388 Hashimoto ... al (2003) An anatomy of normal and malignant gene expression Proc Natl Acad Sci USA 99, 1128 7– 1129 2 10 Lee S, Zhou G, Clark T, Chen J, Rowley JD & Wang SM (2001) The pattern of gene expression...
- 7
- 529
- 0
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
... and formation of the oxazolinium ion intermediate; (C) Hydrolysis of the oxazolinium ion intermediate Copyright National Academy of Sciences, USA questioned on the basis of studies of chitinase ... and there is no example of mutational analysis of all of these residues in the same enzyme To obtain an insight into how the many conserved residues in the active sites of family 18 chitinases ... kinetic parameters of Y10F could not be measured at pH 9.0 due to enzyme instability At pH 8.0 Y10F showed a kcat of 0.55 and Km of 47.2 (compared to a kcat of 3.5 and a Km of 24.9 in the wildtype...
- 10
- 651
- 0
Báo cáo khoa học: Structural and functional analysis of the interaction of the AAA-peroxins Pex1p and Pex6p pptx
... CTCGTACGCTGCAGGTCGAC KU532 KU616 KU617 KU718 KU719 KU1 233 KU1234 KU1235 KU1236 KU1237 KU1009 KU1010 KU1011 KU1 012 KU1130 KU1131 KU1132 KU1 133 fragments of pIB1 ⁄ (construct of PEX1 in pET21d) to plasmid pIB1 ⁄ ... cohort of 31 patients Am J Med Genet 126 A, 333 338 Chevray PM & Nathans D (1992) Protein interaction cloning in yeast: identification of mammalian proteins that react with the leucine zipper of Jun ... biological function of Pex1p and Pex6p 51 Domain function of Pex1p and Pex6p I Birschmann et al A B C D E F Fig Effects of point mutation of the WalkerA and B motifs of the AAA-cassettes of Pex1p on...
- 12
- 584
- 0
Báo cáo khoa học: Modular metabolic control analysis of large responses in branched systems – application to aspartate metabolism potx
... several groups of allosteric interactions: inhibition of both activities of bifunctional AK-HSDH (two isoforms: AKI-HSDHI and AKII-HSDHII) by Thr (G-II), inhibition of the isoforms of monofunctional ... definitions of the coefficients in Doc S1 and [21]) The number of response coefficients in cellular metabolism (number of parameters · number of variables) is very large, and measuring all of them ... the modular representation of the system, there is a small number of explicit variables and of module rates, resulting in a small number of control coefficients This set of control coefficients quantifies...
- 14
- 400
- 0
Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity doc
... packing of the protein tetramers in the crystal cell, which leaves a large amount of empty space, 80% of the volume, filled with solvent The alignment of the amino acid sequence of HP1287 shows 33% ... parameters (A) I 4122 a = b = 148.42, c = 233. 52 125 –2.7 (2.85–2.70) 36057 (5136) 9.4 (8.8) 99.8 (99.0) 9.4 (3.8) 0.081 (0.526) I 4122 a = b = 148.73, c = 233. 57 78–2.4 (2.53–2.40) 5120 0 (7 412) 9.9 (10.2) ... reminiscent of that of human heme oxygenase-1 [13] In the present study, we present the crystal structure of the HP1287 gene product as well as one of its mutants (F47Y) and discuss the in vivo role of...
- 9
- 491
- 0
Báo cáo khoa học: Antibody-based proteomics Analysis of signaling networks using reverse protein arrays pdf
... modulation of regulatory networks [5,6] A direct benefit of such an approach would be the early recognition of ‘off target’ and side effects of drug candidates [7], as well as the identification of putative ... comparative analysis of signaling pathway(s) events in normal versus diseased tissue, (b) the comparative analysis of protein expression in various systems, (c) elucidation of the dynamic aspects of pathway ... the action of the targeted kinase Because of the inherent potential promiscuity of kinase inhibitors, a more extensive characterization of compound activities across a wide range of signaling...
- 9
- 525
- 0
Báo cáo khóa học: Mutational and structural analysis of cobalt-containing nitrile hydratase on substrate and metal binding pdf
... Therefore, the structure of this mutant was almost identical to that of the wild-type enzyme, except for the mutation site Mutagenic analysis of aTyr114 To evaluate the effect of aTyr114 on metal ... red and cyan, respectively The Cc2 atom of aThr109 and the Cc1 atom of aVal136 of the Co-type NHase are connected by a yellow line (B) Vicinity of aTyr114 of the Co-type NHase The wild-type, aY114T ... aThr114 residue of the mutant formed a weak ˚ hydrogen bond (3.1 A) with an oxygen atom of the mainchain of aSer 112, as in the Fe-type NHase (Fig 5B) However, the conformation of the cysteine...
- 10
- 510
- 0
Báo cáo khoa học: Conformational and functional analysis of the lipid binding protein Ag-NPA-1 from the parasitic nematode Ascaridia galli potx
... assumed (K2 0.667 [30]) A value of 1.36 was taken for the refractive index n [31] MALDI-TOF analysis MALDI-TOF analysis of the peptides obtained after tryptic digestion of the labeled and nonlabeled ... partial accessibility of the marker to external solvent molecules Binding of palmitate, identified as one of the preferred ligands [12] , caused an additional 25–30 nm blue-shift of R Jordanova et ... MALDITOF analysis of the trypsin digested Ag-NPA-1 [20] Cys66 and Cys122 were found in the peptide fragments of the nontreated, natural protein with theoretically calculated masses of 1 033. 5459 Da (AKESLIGGCR)...
- 10
- 501
- 0
Báo cáo khoa học: "On-Line Semantic Analysis of English Texts" ppt
... the method of analysis I am describing is not based essentially on a grammatical analysis, as are a number of other systems of semantic analysis [1] The present system takes the notion of meaningful, ... operation of the system is exactly like that of a phrase structure parser, and the resulting interpretation can be thought of as a parsing of the fragments of a paragraph, just as the grammatical analysis ... grammatical analysis of a sentence can be thought of as a parsing of the words constituting the sentence A word of warning is necessary about the odd nature of examples in the field of ambiguity resolution...
- 14
- 347
- 0
Báo cáo khoa học: Cloning and functional analysis of 5¢-upstream region of the Pokemon gene pptx
... 2008 FEBS 1867 Analysis of upstream region of the Pokemon gene Y Yang et al decoy experiments using lg of the NEG-U decoy, lg of the NEG-D decoy, and a combination of lg each of the NEG-U and ... compilation ª 2008 FEBS 1861 Analysis of upstream region of the Pokemon gene Y Yang et al Fig Nucleotide sequence of the 5¢-upstream region of the Pokemon gene The upstream region of the Pokemon gene ... control expression of the Pokemon gene, a 2204-bp section of the 5¢-upstream region of the Pokemon gene was cloned by PCR using human genomic DNA as the Analysis of upstream region of the Pokemon...
- 14
- 340
- 0
Báo cáo khoa học: Characterization and expression analysis of the aspartic protease gene family of Cynara cardunculus L. docx
... relationships of cardosins and their plant counterparts The amino acid sequences of C cardunculus APs were compared with those of several other plant APs, by means of the phylogenetic analysis ... their effect on gene expression in transgenic plants Our results clearly show that the removal of kb of the cardo2530 Fig Histochemical analysis of GUS activity in transgenic A thaliana plants transformed ... regions of the genes fused to the reporter Each row of panels represents independent flowers of plant lines transformed with the same construct, at different stages of development The names of the...
- 17
- 359
- 0
Báo cáo khoa học: Modular metabolic control analysis of large responses The general case for two modules and one linking intermediate docx
... the sensitivity of the rate of the supply module to changes in the concentration of its product and the sensitivity of the rate of the demand module to changes in the concentration of its substrate, ... measured for different ranges of values of S (see Fig of [17]) As a consequence, all values of mean-control coefficients calculated by this analysis involve values of mean-elasticity coefficients ... Authors Journal compilation ª 2006 FEBS 197 Metabolic control analysis of large responses L Acerenza and F Ortega could not be applied to the analysis of the effect of parameters that are related...
- 14
- 311
- 0
Báo cáo khoa học: Thermodynamic and kinetic analysis of the isolated FAD domain of rat neuronal nitric oxide synthase altered in the region of the FAD shielding residue Phe1395 docx
... determination of the midpoint reduction potentials of flavin cofactors, and also of the haems in the case of NOS and P450 BM3 In spectroelectrochemical titrations of the isolated domains, the lack of overlapping ... potentiometric analysis of the wild-type and mutant proteins to probe any thermodynamic consequences of mutation; and (b) studies of the kinetics of flavin reduction by reducing coenzymes in the absence of ... nm, with the E12 value being the midpoint of these E1 and E2 values [35]; and that for the FAD domain of P450 BM3; e E12 value cited for the FAD domain of P450 BM3 is the midpoint of the E1 and...
- 13
- 364
- 0
Báo cáo khoa học: Structural and functional analysis of ataxin-2 and ataxin-3 potx
... Higashiyama, H., Hirose, F., Yamaguchi, M., Inoue, Y.H., Fujikake, N., Matsukage, A & Kakizuka, A (2002) Identifica- Analysis of ataxins and (Eur J Biochem 271) 3169 122 123 124 125 126 127 128 129 ... [96 ,120 123 ,125 127 ] VCP binds the ubiquitin E3 ligase and the chain assembly factor UFD2a/E4B, which is a U box homologue of yeast Ufd2 [128 ], and interacts with and regulates the degradation of ... strand) of D3 and I41/L304, C43/A306 (both in b3), L69/S326 and L71/L328 (both in b4) of B Stacking interactions between guanidinium groups of arginines R69/V335 of D3 and R25/G287 and R49/T 312 of...
- 16
- 526
- 0
Báo cáo khoa học: Sulfoquinovosylmonoacylglycerol inhibitory mode analysis of rat DNA polymerase b pdf
... chemical shift changes of 0.030.04 p.p.m and 15N chemical shift changes of 0.25 0.35 p.p.m are indicated in orange NH chemical shift changes of more than 0.04 p.p.m and 15N chemical shift changes of ... chemical shift of K35 was greatly changed by addition of SQG Thus, the sulfonyl moiety of SQMG may form a salt bridge to the amino moiety of the sidechain of K35 The hydroxyl moieties of the sugar of ... mM) of SQG (d), MA (n) or a mixture of SQG and MA (s) The DNA polymerase activity in the absence of added compounds was taken to be 100% (C) Gel mobility shift analysis Gel mobility shift analysis...
- 13
- 333
- 0
báo cáo hóa học:" Gene and microRNA analysis of neutrophils from patients with polycythemia vera and essential thrombocytosis: down-regulation of micro RNA-1 and -133a" pot
... the expression of miR-216 and miR-217 and the lack of expression of miR-133a were characteristic of pancreatic tissue [36] Page of 17 (page number not for citation purposes) Journal of Translational ... down-regulation of miR-133a and miR-1 is associated with hypertrophic myocardium and skeletal muscle [33, 37-39] The suppression of miR- 133 has been shown to induce cardiac hypertrophy [37] miR-133a down-regulation ... healthy subjects The results of analysis by qRT-PCR and microRNA expression profiling were similar Page 12 of 17 (page number not for citation purposes) Journal of Translational Medicine 2009,...
- 17
- 524
- 0
báo cáo hóa học:" Comprehensive molecular etiology analysis of nonsyndromic hearing impairment from typical areas in China" doc
... Number of patients c.235delC c.235delC c.235delC c.235delC c.560_605ins46 c.299_300delAT c.176_191del16 c.223C>T Frameshift Frameshift Frameshift Frameshift Frameshift Frameshift Frameshift R75W ... 112: 329 -333 Yu F, Han DY, Dai P, Kang DY, Zhang X, Liu X, Zhu QW, Yuan YY, Sun Q, Xue DD, Li M, Liu J, Yuan HJ, Yang WY: Mutation of GJB2 gene in Chinese nonsyndromic hearing impairment patients: analysis ... of the populations are characteristic of northern and southern China, respectively This cohort of patients consisted of 158 males and 126 females from to 20 years old with an average age of 12. 30...
- 12
- 511
- 0
Báo cáo hóa học: " Mass spectrometry-based analysis of therapy-related changes in serum proteome patterns of patients with early-stage breast cancer" pot
... points Type of cluster All patients (n = 70) Adjuvant therapy (n = 39) Number of clusters Number of components Number of clusters Number of components A=B=C 261 212 A
- 11
- 391
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng 9 tr 25