write the standard form of the equation of a line through the given point with the given slope
Báo cáo khoa học: Common mode of DNA binding to cold shock domains Crystal structure of hexathymidine bound to the domain-swapped form of a major cold shock protein from Bacillus caldolyticus pot
... domain swap pairs one half, b strands 1–3, of Bc-Csp with the other half, b strands and 5, of a second molecule and serves as proof of an unanticipated structural plasticity in the CSD In contrast ... that the first three b strands may form association interfaces that promote aggregate growth In the late stage of amyloid formation, signals from the N-terminal half of the molecules (equivalent ... between Arg56 and the O2 of the nucleobase However, after evaluating both crystal structures we conclude that the alternative orientation of the base and sugar–phosphate backbone of the nucleotide...
- 15
- 333
- 0
Chronicles of a Dallas Cowboys Fan: Growing Up With America''''s Team in the 1960''''s by John Eisenberg pptx
... Landry, and started from scratch with a team that won one of 16 games I was home for the Christmas holidays that year and went to the last game of the season with my father It was a sunny day, but ... played at Turnpike Stadium in Arlington A minor league hockey team, the Blackhawks, played at the State Fair Coliseum to small crowds of displaced hockey nuts The Chaparrals, of the American Basketball ... League also began playing that year Owned by Lamar Hunt, the son of oilman H L Hunt, the AFL team was called the Texans and also played at the Cotton Bowl Competing for fans with each other as well...
- 18
- 466
- 0
Standard Form of Agreement for Design Services potx
... substantial damages and stopping the use of the infringing work Disclaimer of warranties and use of ALL CAPS If an agreement includes a disclaimer of any warranty, many states require by law that the ... www.lawyers.com (A commercial directory of U.S and Canadian attorneys that you can search by specialty and location) FindLaw www.findlaw.com (A searchable commercial database of attorneys, along with ... normal and acceptable Much more information is available about standard trade practices in the printing industry from organizations such as the PIA (Printing Industries of America) and the Graphic...
- 56
- 522
- 0
báo cáo hóa học:" Research Article Note on the Persistent Property of a Discrete Lotka-Volterra Competitive System with Delays and Feedback Controls" pptx
... Gopalsamy, Stability and Oscillations in Delay Differential Equations of Population Dynamics, vol 74 of Mathematics and Its Applications, Kluwer Academic Publishers, Dordrecht, The Netherlands, ... competition equations,” Proceedings of the American Mathematical Society, vol 117, no 1, pp 199–204, 1993 S Ahmad and A C Lazer, “On the nonautonomous N-competing species problems,” Applicable Analysis, ... LotkaVolterra competitive system with delays and feedback controls,” Journal of Computational and Applied Mathematics, vol 211, no 1, pp 1–10, 2008 S Ahmad, “On the nonautonomous Volterra-Lotka...
- 9
- 351
- 0
Improving the performance of a high power, lead–acid battery with paste additives docx
... that simulate the conductivity of the positive active material and the diffusion of sulfate ions Researchers w15,16x have found that after a certain amount of the active material has reacted the ... remaining material becomes isolated and cannot react The amount of active material that can be discharged before the remaining material becomes isolated is termed the critical volume fraction Values ... cell discharge was simulated Table gives the performance of this battery at a discharge rate of 18 Wrkg, approximately the 2-h rate The model predicts a discharge energy of 150 W h and a specific...
- 8
- 382
- 0
Báo cáo toán học: "A Note on the Critical Group of a Line Graph" doc
... The line graph, LG, for G is the multidigraph whose vertices are the edges of G and whose edges are (e, f ) with e+ = f − As with G, we have the Laplacian ∆LG and the critical group ... [1] Andrew Berget, Andrew Manion, Molly Maxwell, Aaron Potechin, and Victor Reiner The critical group of a line graph arxiv:math.CO/0904.1246 [2] Alexander E Holroyd, Lionel Levine, Karola M´sz´ros, ... Theorem and may be seen as analogous to Theorem 1.2 of [3] In [3], partially for convenience, some assumptions are made about the connectivity of G which are not made in this note For related work...
- 6
- 320
- 0
báo cáo khoa học: "Collaborative planning approach to inform the implementation of a healthcare manager intervention for hispanics with serious mental illness: a study protocol" pptx
... Scientific Software Development GmBH, Berlin, Germany), a qualitative data management software [58], will be used to manage and analyze all qualitative data Quantitative analysis All tests will ... initial effects V Analyze pilot study data and prepare manuscripts and future grant proposals CAB = community advisory board; PCARE = primary care, access referral and evaluation 1-3 Cabassa et al ... language (e.g., Spanish) to reduce language barriers and drafting all patient educational materials at the appropriate reading level (e.g., fourth grade) to enhance health literacy Surface adaptations...
- 12
- 423
- 0
Báo cáo y học: "Distinctive receptor binding properties of the surface glycoprotein of a natural Feline Leukemia Virus isolate with unusual disease spectrum" pps
... each case is underlined: 1) the mutant designated 61E/945-5 using primer 5’ACTAGTGTTGGATCCTAACAACGTTCGGCATGGAGCTAGGTATAGCAGTAGCAAATATGGATGTAAAACTACAGATAG-3’, 2) the mutant designated VRB3aa using ... 5’-GAGGGAGTAATCAGGACAATAGCTGCACAGGAAAATGCAACCCCC-3’, 3) the mutant designated N147S using primer 5’-GGGAGTAGTCAGGACAATAGCTGTGAGGG-3’, 4) the mutant designated K128N/S130T using primer 5’GCAACCCCCTAGTCTTACAGTTCACCCAGAAGGGAAGACAAGCCTCTTGG-3’, ... 5’GCAACCCCCTAGTCTTACAGTTCACCCAGAAGGGAAGACAAGCCTCTTGG-3’, 5) the mutant designated I156V/K164R using primer 5’-GGAGAAGCTTGGTGGAATCCCACCTCCTCATGG-3’, and 6) the mutant designated I186V using primer 5’GGATATGACCCTGTCGCTTTATTCACGGTGTCCCGGCAGG-3’...
- 17
- 267
- 0
Application of PEEC modeling for the development of a novel multi gigahertz test interface with fine pitch wafer level package
... resistors and 12 capacitors The ground planes are replaced by the image elements The partial inductance, partial potential coefficient (reciprocal of capacitance) and resistance values are obtained through ... [19]-[55] The availability of better CAD tools for the extraction of inductances and capacitances makes the PEEC models attractive PEECs are equivalent to Maxwell’s equations in the limit of an infinite ... typical of the PEEC topology The nodes are separated by the partial inductance L p11 and partial resistance R The excitation and the load currents are I S respectively The partial coefficients of...
- 202
- 532
- 0
Ecological performance of a generalized irreversible Carnot heat engine with complex heat transfer law
... finite The total heat transfer surface area ( F ) of the two heat exchangers is assumed to be a constant: F = F1 + F2 (3) There exists a constant rate of bypass heat leakage ( q ) from the heat ... is the overall heat transfer coefficient and F1 is the heat-transfer surface area of the hightemperature-side heat exchanger , β is the overall heat transfer coefficient and F2 is the heat-transfer ... m in the heat transfer processes between the working fluid and the heat reservoirs of the heat engine And they further obtained the optimal ecological performance of an endoreversible heat engine...
- 14
- 534
- 0
Báo cáo khoa học: Characterization of a-synuclein aggregation and synergistic toxicity with protein tau in yeast potx
... membranes or, alternatively, that the cells attempt to remove the aggregates formed at, and bound to, the plasma membrane via transport to the vacuole by the endocytic pathway As the a- synuclein aggregates ... models, the yeast-based models have the advantage that they are less complex and better genetically defined An additional benefit is the ease and rapidity with which yeast cells can be manipulated and ... only the formation of reactive oxygen species but also increased aggregation of a- synuclein Further data support the hypothesis that degradation of a- synuclein occurs by autophagy and proteasomes...
- 15
- 364
- 0
Combustion and emission characteristics of a natural gas fueled diesel engine with EGR
... contains a variety of air–fuel ratios Therefore, the flame is well-anchored depending on the value of the local AFR; irrespective of the value of the overall AFR, which can reach a value of 100 ... mode Appendix A The value of the specific heat ratio (c) used to calculate the net heat release rate (HRR) varies with the variation of the gas temperature inside the cylinder, and it can be calculated ... dual-fuel operation; with natural gas as a main fuel and diesel as a pilot The properties of both fuels are given in Table The engine intake system is modified via the installation of a specially...
- 12
- 573
- 0
Báo cáo hóa học: " Research Article Interior Controllability of a 2×2 Reaction-Diffusion System with Cross-Diffusion Matrix" pdf
... mathematicians who live in remote and inhospitable places, far from major research centers in the world, can also understand and enjoy the interior controllability with a minor effort 4 Boundary ... families of bounded linear operator in Z, with {Pj }j≥1 a family of complete orthogonal projection such that Aj P j P j Aj , j ≥ 2.9 Define the following family of linear operators: ∞ T t z eAj ... semigroup in the Hilbert space Z, whose infinitesimal generator A is given by ∞ Az z∈D A Aj Pj z, 2.11 j with ⎧ ⎨ D A ∞ ⎩ j z∈Z: Aj P j z ⎫ ⎬
- 9
- 279
- 0
Báo cáo y học: "Induction of a B-cell-dependent chronic arthritis with glucose-6-phosphate isomerase" pptx
... Takahashi T, Hata H, Nomura T, Tagami T, Yamazaki S, Sakihama T, Matsutani T, Negishi I, Nakatsuru S, Sakaguchi S: Altered thymic T-cell selection due to a mutation of the ZAP70 gene causes autoimmune ... hours and decalcified with EDTA The paraffin sections were stained with haematoxylin and erythrosine [26] Statistical analysis Frequency of arthritis was analyzed using the χ2 test, and antibody ... intradermally at the base of the tail with the indicated amounts of G6PI emulsified in complete Freund's adjuvant (CFA) to establish a dynamic immunization protocol allowing for an increase or decrease...
- 9
- 392
- 0
Báo cáo khoa học: "Surgical treatment of a rare primary renal carcinoid tumor with liver metastasis" docx
... centers for a total of 56 cases Renal carcinoids were associated with another renal pathology in 26.8% of cases [5] Only 7% of these patients presented with carcinoid syndrome at the time of diagnosis; ... reported a borderline tumor of the ovary; a total abdominal hysterectomy with bilateral salpingo-oophorectomy was performed This was followed by a radical right nephrectomy with lymphadenectomy and a ... in the gastrointestinal tract, and in these cases, the mainstay of treatment is resection [13-15] In our patient, an aggressive surgical approach including resection of the liver metastasis was...
- 4
- 329
- 0
báo cáo khoa học: " Biological activity of a genetically modified BMP-2 variant with inhibitory activity" potx
... (A3 4D/ D5 3A) was evaluated in vivo This variant features alterations of amino acids at position 34 and 53: alanine was substituted by aspartate and aspartate by alanine, respectively The mutation ... days the animals were sacrificed and the specimens were explanted Examination of the implants After explantation the mineralisation of the scaffolds was investigated radiographically in a 2-dimensional ... dose of the BMP-2 double mutant A3 4D/D5 3A (Fig 1) The areas of bone formation were portrayed 2-dimensionally after digitalisation of the X-rays The data of the test specimens (5 μg rhBMP-2 and...
- 5
- 384
- 0
Báo cáo y học: "Development of a triage protocol for patients presenting with gastrointestinal hemorrhage: a prospective cohort study" pdf
... participated in the design of the study, acquisition of data, and data analysis for the development set KH and LC participated in acquisition of data and in critical review and revision of the ... interests The authors declare that they have no competing interests Authors' contributions AMD participated in the design of the study, acquisition of data, and data analysis and drafted the manuscript ... manuscript SSC conceived of the study, participated in its design and coordination and in data analysis, and helped to draft the manuscript All authors read and approved the final manuscript Acknowledgements...
- 8
- 283
- 0
Finite time exergoeconomic performance of a generalized irreversible carnot heat engine with complex heat transfer law
... performance bound decrease with the increase of the internal irreversibility The heat leakage changes the profit versus efficiency relation quantitatively and qualitatively The characteristic of ... exchanger; β is the overall heat transfer coefficient and F2 is the heat transfer surface area of the low-temperature-side heat exchanger Defining the heat transfer surface area ratio ( f ) and ... heat-transfer surface areas ( F1 and F2 ) of high- and low-temperature heat exchangers are finite The total heat transfer surface area ( F ) of the two heat exchangers is assumed to be a constant:...
- 10
- 345
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25