... reported that 83% of parents are aware of the ESRB ratings, and 74% of parents use them regularly when buying games for their families Additionally, 91% of parents said they are at least somewhat confident ... Guidelines”), available at www.riaa.com/issues/parents/advisory.asp#notice (last visited Mar 27, 2007) The RIAA and the National Association of Recording Merchandisers (“NARM”), a trade association ... video game rating system Parental awareness and use of video game ratings are substantially higher than were reported in the Commission’s 2000 survey Nearly nine in ten parents are aware of the...
... Shimomura I, Sata M, Arita Y, Nishida M, Maeda N, Kumada M, Okamoto Y, Nagaretani H, Nishizawa H, Kishida K, Komuro R, Ouchi N, Kihara S, Nagai R, Funahashi T, Matsuzawa Y: Role of adiponectin ... regional prescription database, we obtained data regarding the use of medication up to 180 days preoperatively and year postoperatively The database contains data on all redeemed prescriptions at all ... and dates of refill Statistical analyses Baseline and procedural characteristics are presented as medians with interquartile ranges or 95% confidence intervals (95% CI) and categorical data as...
... per year, and average duration of ventilation Part 2: Data relating to analgesia and sedation These data included changes accomplished in sedation management since 2002, use of scores for pain ... medications for analgesia and sedation ؠ A trend toward conformity with the national guidelines on patient-oriented analgesia and sedation • Also according to our follow- up survey, a daily sedation ... Kirkham AJ: Decreased duration of mechanical ventilation when comparing analgesia-based sedation using remifentanil with standard hypnotic-based sedation for up to 10 days in intensive care unit...
... questionnaire Patients Patients included Female Male AVNRT AVRT EAT From symptom to diagnosis (Years) All patients AVNRT AVRT EAT From symptom to ablation (Years) All patients AVNRT AVRT EAT RF-Applications ... EAT patients Panel A: Quantity and duration of episodes and the associated symptoms Panel B: Detraction in daily life generally and in parts of daily life variable PANAL A Detraction in daily ... defective (5) and insufficient (6) Y-axis: Percentage of patients Panel A: AVNRT Panel B: AVRT Panel C: EAT Comparing the categorical variables before and after ablation in AVNRT patients, applying...
... identify a spokesperson who can present the group’s ideas in a class discussion Brainstorm about your answers and present them in any format that will communicate them most effectively For example, ... collect information to make an informed decision about the type of motorcycle that will attract new riders After you collect and analyze the information, you will be able to develop a design First, ... your answers through visual images, text, or a combination of both Activity 1.1: Designing aNew Type of Motorcycle Use this page to write down your ideas for Activity 1.1, “Designing aNew Type...
... Determination of cathepsin E and D activity N Zaidi et al A TAPA Cytosol CatE activity CaD activity Lysosomes Endosomes 20 40 60 80 100 120 pmol MOCAc liberated/min/20µg total protein B TAPA CatE activity ... localization of cathepsin E and cathepsin D in human gastric cells and various rat cells J Biochem (Tokyo) 110, 956–964 Tsukuba T, Hori H, Azuma T, Takahashi T, Taggart RT, Akamine A, Ezaki M, Nakanishi ... Tsukuba T, Yamamoto S, Yanagawa M, Okamoto K, Okamoto Y, Nakayama KI, Kadowaki T & Yamamoto K (2006) Cathepsin E-deficient mice show increased susceptibility to bacterial infection associated with...
... was spread, cells were harvested immediately following irradiation and analysed for pyrimidine dimer formation Non-irradiated cells and cells irradiated through a naked quartz plate served as ... in cyanobacteria Cells with high concentrations of MAAs are approximately 25% more resistant to UV radiation centered at 320 nm than those with no or low concentrations of MAAs [25] MAAs have ... amino-alcohol [11] In contrast, MAAs are UV absorbing metabolites of algae that contain an aminocyclohexenimine ring system, with UV absorption maxima between 310 and 360 nm To date, 17 different aminocyclohexenimines...
... Lee DH, Ha MH, Kim JH, et al Gamma-glutamyltransferase and diabetes a year follow- up study Diabetologia 2003;46:359–64 Nakanishi N, Nishina K, Li W, et al Serum gamma-glutamyltransferase and development ... were also common The main laboratory data gathered at the time of NAFLD diagnosis are summarised in table ALT and AST levels were each within the normal range in few patients 1539 Hepatology Table ... aminotransferase (AST), alanine aminotransferase (ALT), alkaline phosphatase activity, c-glutamyl transferase (GGT), total bilirubin, albumin levels and prothrombin time), fasting blood glucose, fasting...
... scales and the FACT-G scales are concordant since decreased social withdrawal and avoidance, reduced psychosocial impact and less embarrassment are accompanied by better emotional and functional ... sizes partial Eta squared (p2) were calculated Partial Eta squared specifies what proportion of the sum of error variance and a certain effect variance is explained by this effect in the sample: ... weeks Assessment Figure Changes2in anxiety and depression (HADS) Changes in anxiety and depression (HADS) Avoidance, Psychosocial-Impact, Social Embarrassment and Total-Score (see Table 2, Table and...
... (occupation, educational attainment), general health (physical and mental SF-12 scores) and participation restriction Percentages and means were used to compare groups with different follow- up ... educational attainment, occupational class and general health (using SF-12 physical and mental health scores), as those who did complete the three year follow- up questionnaire These six stratadefining ... persistence of any restriction at three-year follow- up in older adults who completed the KAP at three year follow- up and those lost at follow- up; overall and stratified by age and gender Estimated onset...
... original German version, Cronbach's alpha was approximately 70 for most subscales, while the overall scale had an alpha value over 80 In the Norwegian version [37], generally satisfactory alpha values ... Mental Health', the organization 'Health and Rehabilitation' and St Olav University Hospital Thanks to all parents and pupils participating in the study, to all teachers in Sør-Trøndelag county and ... separately in different minor groups The national Norwegian database for primary education (GSI) was used to enumerate all pupils attending any of the targeted grades in all schools and relevant...
... tree analyses The gamma distance was applied to compute evolutionary distances The gamma shape parameter (alpha) was estimated using the GZ-GAMMA program [30] The sequence and annotation data for ... DNA polymerase II (PolII), bacterial DNA polymerase III α subunit (DnaE) and bacteriophage DNA polymerase I Among these, archaeal PolI belongs to the family B DNA polymerase Archaeal PolI contains ... KFVKPVSLEFEKVYYPYLLI -AEAMALGREAADWVSG HFPSPIRLEFEKVYFPYLLI -MKTIAKCQRAAKLINQ NVPKPQSIVYEKTLHPFILV - : : :: Sequence alignment of Family B DNA polymerases from the Archaea, Bacteria and Eukarya domains...
... CAGGTTAAAGGTCTTTGTATTAGGAGGCTGTAGGCA 6604m_969CAGGTTAATGATCTTTGtatTAGGAGGctgTAGGCa 6516m_90-0 CAGGTTAAA TATTAGGAGGCTGTAGGCA 6541m_27-0 CAGGTtAAA TATTAGGAGGCTGTAGGCA 6290m_1232 CAGGTTAAA ... Investigaciones Científicas y Tecnológicas (National Council for Science Research and Technology) and Organización Panamericana de la Salud (Health Panamerican Organization) grant The authors thank all ... TATTAGGAGGCTGTAGGCA 6290m_1232 CAGGTTAAA TATTAGGAGGCTGTAGGCA 467h_969-0 CAGGttAAA TATTAGGAGGCTGTAGGCA Consensus CAGGTTAAATATTAGGAGGCTGTAGGCA SspI r e c o g n i t i o n s i t e stop codon...
... the sample available at T1 only and the sample available at both T1 and T2 Sample T-test (T1 and T2) sample vs sample (n = 784-821) Dependent variables measured at T1 and T2 Job satisfaction at ... conclusions about the relative importance of patient care and operational factors compared to sources other than ambulance work, such as the ‘managerial role’, the ‘relations with others at work’ and ... the statistical analyses and drafted the manuscript TS will act as guarantor for the paper All authors approved the final manuscript Competing interests The authors declare that they have no...
... Visual Analogue Scale pre and postoperatively Visual Analogue Scale pre and postoperatively tages of this technique include less paraspinal musculature trauma and smaller wounds Bone removal is ... improved after endoscopic discectomy compared to preoperation There was also significant improvement in NASS and VAS scores at months and years postoperation compared to preoperation Thus back pain and ... introduced at the safe triangle of Kambin, [2] the risk of nerve damage was low We did not have any neurological deficit in all the patients done under general anesthesia The advantage of general anesthesia...
... tree analyses The gamma distance was applied to compute evolutionary distances The gamma shape parameter (alpha) was estimated using the GZ-GAMMA program [30] The sequence and annotation data for ... DNA polymerase II (PolII), bacterial DNA polymerase III α subunit (DnaE) and bacteriophage DNA polymerase I Among these, archaeal PolI belongs to the family B DNA polymerase Archaeal PolI contains ... KFVKPVSLEFEKVYYPYLLI -AEAMALGREAADWVSG HFPSPIRLEFEKVYFPYLLI -MKTIAKCQRAAKLINQ NVPKPQSIVYEKTLHPFILV - : : :: Sequence alignment of Family B DNA polymerases from the Archaea, Bacteria and Eukarya domains...
... CAGGTTAAAGGTCTTTGTATTAGGAGGCTGTAGGCA 6604m_969CAGGTTAATGATCTTTGtatTAGGAGGctgTAGGCa 6516m_90-0 CAGGTTAAA TATTAGGAGGCTGTAGGCA 6541m_27-0 CAGGTtAAA TATTAGGAGGCTGTAGGCA 6290m_1232 CAGGTTAAA ... Investigaciones Científicas y Tecnológicas (National Council for Science Research and Technology) and Organización Panamericana de la Salud (Health Panamerican Organization) grant The authors thank all ... TATTAGGAGGCTGTAGGCA 6290m_1232 CAGGTTAAA TATTAGGAGGCTGTAGGCA 467h_969-0 CAGGttAAA TATTAGGAGGCTGTAGGCA Consensus CAGGTTAAATATTAGGAGGCTGTAGGCA SspI r e c o g n i t i o n s i t e stop codon...
... weight bearing age (when the brace was applied for twenty three hours a day) and five times daily for the next three years (when the brace was applied for twelve hours at night) The parent repeats ... times at a seating The patients were followed up on a weekly basis during the initial stages of treatment After orthosis was applied, the patient was seen on a monthly basis for three months and ... till the patients was three years of age The patient was also followed up every six moths to one year till years and then after 1-2 years till skeletal maturity is achieved Results A total number...
... weight bearing age (when the brace was applied for twenty three hours a day) and five times daily for the next three years (when the brace was applied for twelve hours at night) The parent repeats ... times at a seating The patients were followed up on a weekly basis during the initial stages of treatment After orthosis was applied, the patient was seen on a monthly basis for three months and ... till the patients was three years of age The patient was also followed up every six moths to one year till years and then after 1-2 years till skeletal maturity is achieved Results A total number...
... 1997, was identified as the initial date for the selection of the study population as by this date, HAART was widely available, and we wished to avoid the potential bias of availability of HAART ... baseline, and follow- up of the AmFAR Observational Database American Foundation for AIDS Research Community-Based Clinical Trials Network Journal of Clinical Epidemiology 1998, 51:779-793 26 Arici ... HAART and 48.5% not on HAART) compared with 31.9% of Transfers (p < 0.001) Factors associated with LFU among those receiving or not receiving HAART Overall, in a multivariate analysis, the factors...